DNA Barcoding and Biochemical Profiling of Medicinal Plants of Northern and Desert Areas of Pakistan: Improving Socio-economic Standard of the People of these Regions by Dr. Amer Jamil, University of Agriculture, Faisalabad

  • 931 views
Uploaded on

Presented on February 10th, 2013 at the Second Research Competitive Grants Conference in Islamabad, Pakistan.

Presented on February 10th, 2013 at the Second Research Competitive Grants Conference in Islamabad, Pakistan.

  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Be the first to comment
    Be the first to like this
No Downloads

Views

Total Views
931
On Slideshare
0
From Embeds
0
Number of Embeds
0

Actions

Shares
Downloads
31
Comments
0
Likes
0

Embeds 0

No embeds

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
    No notes for slide

Transcript

  • 1. DNA barcoding and biochemical profiling of medicinal plants ofNorthern and desert areas of Pakistan: Improving socio-economicstandard of people of these regions Principal Investigator: Prof Amer Jamil Dept of Chemistry and Biochemistry Co-Principal Investigator: Prof Muhammad Ashfaq Director, Institute of Agricultural and Resource Economics University of Agriculture, Faisalabad
  • 2. Core issues Associated with Medicinal Plants Lack of cultivation; mostly wild collection Inaccurate identification of medicinal plants Substitution or adulteration of the raw ingredients - decreased product’s efficacy - could prove fatal Poor socio-economic condition of the local people residing around this valuable resource Threat of losing our native medicinal plant species
  • 3. Threats to the medicinal plants1. Habitat degradation2. Poverty Collection of medicinal herbs without any consideration of their regeneration3. Negative exploitation – illegal extraction and transport of the plant material to other regions without any permission4. Lack of awareness – Not well aware of the modern values of the medicinal plants and the environmental consequences of loss of biodiversity
  • 4. PROBLEM STATEMENT• Biodiversity conservation – A step towards conservation of natural plant resources and endangered species of this region• Most of the local people of the targeted areas are living below poverty line – Lack of awareness about actual potential of such valuable resource; medicinal plants – No ownership• Many medicinal plants are being used due to health benefits however, – no proper documentation – active ingredients of the plants are mostly unknown The local people therefore are unable to exploit the valuable resource that exists in their vicinity
  • 5. HYPOTHESISPr oj ect w l l hel p del i ver i ng concr et e igui del i nes t o devel op i m em abl e pl entpol i ci es f or conser vat i on of nat ur alr esour ces (m ci nal pl ant s), pr ovi di ng ediow shi p of t he i ndi genous m er i al ner att o t he l ocal peopl e and st r engt heni ngof t he r ur al econom es of i t het ar get ed r egi ons
  • 6. Targets to be Achieved During First Six MonthsField Visits for the collection of Medicinal PlantsFlow of Medicinal PlantsDesigning of the primersOptimization of the PCR conditions for DNA barcoding
  • 7. Progress During First Six Months of the Project Selection of Two Regions of Pakistan Covering Northern and Desert Areas Main objectives of these visits: to identify the marketable species of medicinal plants to check the flow of medicinal plants to diagnose the problems, facing in performing their activities to explore pre and post conflict socioeconomic conditions and their impact on livelihood
  • 8. Questionnaires Questionnaires were designed for Farmers, pickers, shopkeepers and hakeems (herbal medicine practitioners) Questions concerning the utility of different plants, types of plants, quantity of plants used, mode of purchase, rate of consumption, availability, profit ratio, economic/ market value were asked
  • 9. Questionnaire for FarmersName_____________Village_____________Tehsils_____________District________________Age_______ (Years) Farming Experience________ (Years) SchoolingYears_______Family Members__________ Family type: i) Nuclear ii) Joint iii) ExtendedLand (kanals)Owned area________ Rented in ________ rented out_________ Sharedin_______________Shared out__________ Operational holding____________
  • 10. Particulars Name of Medicinal Plants A( B( C( Area ( kanal) ) ) )Seed Quantity Cost (Rs)Land Preparation No.(Culti+Sohagas) CostSowing Rs.Hoeing No. Cost (Rs)Irrigation Type No. CostFertilizers Type/Qty Price/bag
  • 11. Pesticide/Chemical Types Qty CostHarvesting/process CostingOtherCosts(Specify)Output (kg)( Fresh)Price per kgFreshOutput (kg) (Dry)Price per kg (Dry)Sowing andharvesting time
  • 12. Labor Cost Type Family labour Hired labour Permanent labour Working Value of Working Wages per Working Month hours family hours Day hour ly labour Wages Men Women Children otherTo whom do you sell?i) Assembler/shopkeeper ii) Medicinal companies iii) Collector iv) Hakim v)others (Specify)_______In which form you sell?•Fresh ii) Dry iii) other ( Specify) _______What problems you face during Production/Marketing etc of product?(Specify)What solutions you suggest to resolve these problems? (Specify)
  • 13. Questionnaire for Picker (Collector)Name_____________Village_____________Tehsils_____________District________________Age_______ (Years) picking Experience________ (Years) Schooling Years_______Family Members__________ Family type: i) Nuclear ii) Joint iii) ExtendedWhat types of plants you collect (Name)?1 ____________ 2 _____________ 3 ____________ 4 ____________ 5_______From where you collect?1) Private farms 2) Naturally grown 3) others (specify) _______ Family labour No. of hours for collection (per How many days spent in month) a year Men Women Children
  • 14. In which form do you sell the plants?•Fresh ii) Dry iii) After processing iv) other (Specify) …………….What is over time population of these plants?•Increasing ii) Decreasing iii) SameIf decreasing, give reasons;i…………………………………………ii)………………………………………….To whom do you sell the plants?i) Hakim ii) Assembler/shopkeeper iii) Send other cities iv) Consumer v) Others (Specify)…….Price per kg received for different plants?i)___________ ii) ______________ iii) _____________ iv) ____________ v)_______What is total quantity you sell in a year (Kgs)i)___________ ii) ______________ iii) _____________ iv) ____________ v)_______Have you any other business (job)? Yes _______, No_______, if Yes (Specify)_______Income per month from the job________________ Income of family from allsources………….Rs/monthWhat problems you face during Selling/Collection? (Specify)What solutions you suggest to resolve these problems?Time of picking for different plants1 ____________ 2 _____________ 3 ____________ 4 ____________ 5_______
  • 15. Questionnaire for Assembler (Shopkeeper)Name_____________Village_____________Tehsils_____________District________________Age_______ (Years) Assembling Experience________ (Years)Schooling Years_______Family Members__________ Family type: i) Nuclear ii) Joint iii)ExtendedWhat types of plants you Assemble?1 _______ 2 _______ 3 _______ 4 _______ 5 _______From where you purchase?i) Collector ii) private farm iii) other (Specify) _______What is your mode of purchase?i) Go yourself ii) People Come to Sell iii) Hired Collectors iv) Other(Specify) _______What price per kg you pay for different plants?•_____________ ii) ___________ iii) _____________ iv) ___________v) _______
  • 16. Ownership of shop? Yes……………..No……………, if No then rent ofshop…………./monthNo. of employees ………….. Salaries of employees ………………..(Rs/month)Chowkidar charges …………..(Rs/month)Avg. Electricity bill ………….(Rs/month), Ave. phone bill………….(Rs/month)Other costs………………..(Rs/month)In which form do you sell?•Fresh ii) Dry iii) After processing iv) other ( Specify) _______To whom do you sell?i) Hakim ii) Medicinal companies iii) export iv) Consumer v) other(Specify) _______Per kg selling price of these plants?i) ______________ ii) _____________ iii) ______________ iv)____________ v) _______If other business is also carried out, what is % of medicinal plant tototal business ………..What is your perception about the population of these plants?•Increasing ii) Decreasing iii) SameIf decreasing, give reasons;Is it your full time job? Yes _______, No _______ if No Then what is your other Business (Job)? (Specify) _______Income from other business______________ (Rs/month) What problems you face during Selling/Purchasing etc? (Specify)What solutions you suggest to resolve these problems? (Specify)
  • 17. Questionnaire For Hakim (The herbal medicine practitioner)Name_____________Village_____________Tehsils_____________District________________Age_______ (Years) Hikmat Experience________ (Years) Schooling Years_______What type of plants you Purchase from local market (top 5)?i) _________________ ii) ______________ iii) _____________ iv) ________ v)________Source?•Collector ii) Shopkeeper/Retailer iii) Other (Specify) _________________What price per kg you pay for different plants (Top 5)? i) _____________ ii) _____________ iii) ____________ iv) ___________ v) _______Quantity of plants ( kg) used per month?i) _____________ ii) _____________ iii) ____________ iv) ___________ v) _______Price of one unit of medicine you charge from customer?i) _____________ ii) _____________ iii) ____________ iv) ___________ v) _______Most common diseases cured by these plants?i) _____________ ii) _____________ iii) ____________ iv) ___________ v) _______
  • 18. Ownership of shop? Yes……………..No……………, if No thenrent of shop…………./monthNo. of employees ………….. Salaries of employees……………….. (Rs/month)Chowkidar charges …………..(Rs/month)Avg. Electricity bill ………….(Rs/month), Ave. phone bill………….(Rs/month)Other costs………………..(Rs/month)Total sale of shop (Income ofHikmat)…………………….(Rs/month)What problems you face during Selling/Purchasing of these localmedicinal plants? (Specify)What solutions you suggest to resolve these problems? (Specify)
  • 19. Visit to Northern Area Date News Headlines 4 April,At least 14 people were killed and over 50 others injured in sectarian violence in Gilgit-Baltistan region of northern Pakistan 2012 9 April,PAF evacuates 120 foreigners trapped in Giglit-Baltistan curfewThe Northern region included 2012 16 Aug, DIG Gilgit Ali Sher confirmed the attack on passengers and killing of about 20Gilgit-Baltistan. passengers in the attack of armed terrorists near at Gilgit. 2012 17 Aug, [News] Killing People of Giglit-Baltistan – Another Dark Day 2012 This is the second time in a span of three months, Armed terrorist of Taliban killed 43 people from Gilgit-Baltistan on the basis of sectarian affiliations. 18 Aug, Two truck drivers killed in Chalt Hunza Nagar 2012Switched to Swat Valley due 23 Aug, 2012 Gilgit Under Curfew:Gilgit (Monitoring Desk): In the post FC man killing and reported abductions of Truck drivers in various parts of Giglit-Baltistan, and due to the tense environment the law enforcement agencies have imposed an unannounced curfew in Giglit-City. It has caused sever problem form manyto Security reasons as the people who where visiting for many important official and business related tasks to the Capital City of Gilgit.contact person in GB did not 28 Aug, 2012 Two men including a policeman were killed and another was injured in shootings in the restive town of Gilgit on Saturday.recommend the visit at that 28 Aug, 2012 Criminals running toward GB: Interior Minister Rehman Malik 07 Sep, Aug 16: Terrorists ambushed four buses, pulled out the passengers and shot 2012 at least 19 of them dead in the Babusar Top area of Mansehra district ontime. Thursday. “More than 50 terrorists wearing commando uniform intercepted a convoy going from Rawalpindi to Gilgit-Baltistan before 7am, hauled off passengers from four vans, identified them through their national identity cards and shot 19 of them dead,” District Coordination Officer Dr Amber Ali Khan said 07 Sep, Gilgit Baltistan Legislative Assembly in a unanimous resolution on Tuesday 2012 condemned the recent terrorist attacks killing innocent people 12 Dec, Terror attacks increased in GB:Advocate Yawar was seriously injured at 2012 Domail locality, after attacked by a hand-grenade 12 Dec, 2012 Violence in Gilgit: two killed several injured
  • 20. Visit to Swat Collection, Photography and Preservation of Medicinal Plants More than 50 fresh medicinal plants were collected from the Swat valley About 35 dry Medicinal Plant Parts were also collected  Special thanks to Dr Hassan Sher for providing help
  • 21. Diagrammatic Representation of Medicinal Plants’ Flow in the Swat Valley Picker/ Collectors Shopkeeper Middlemen Consumers Pansaars Traders Pharma and other Hakeems Export Industries
  • 22. List of Medicinal Plants (in Dry Form) collected from Swat valley Sr. No Name Parts Collected 1 Buntal (Impatiens glandulifera) Seeds 2 Khakshir Seeds 3 Onion Seeds 4 Rehan Seeds 5 Tudari Surkh Seeds 6 Kehoon Seeds 7 Methi Seeds 8 Serala Seeds 9 Smaq dana Seeds 10 Kasoos Seeds 11 Curfus Seeds 12 Persosha Weeds 13 Aconitum heterophyllum Weeds 14 Guchi (Mushroom) Weeds 15 Anjabaar Weeds 16 Kakora Weeds 17 Kabab e khaddan Weeds 18 Berg e Bensa Weeds 19 Dar e hild/ Darishk/ Zarishka/ Kornay Weeds 20 Ephedra Weeds 21 Damasa Weeds 22 Gidder tobacco Weeds 23 Gul e banafsha Weeds 24 Noor Alum/ Shakakal Weeds 25 Zakhm e hayat Weeds 26 Gul e Tesu Weeds 27 Discoria Weeds 28 Mamekh Weeds 29 Mater Jer (Roots) Weeds 30 Mushk e Bala/ Asaroon Weeds 31 Kuth Weeds 32 Ratan Jo Weeds 33 Mushk e bala Weeds 34 Afsateeen/ Arae Weeds 35 Materikeria Weeds
  • 23. Medicinal Plants from Swat
  • 24. Visit to desert area (Cholistan desert) Yazman, Channer Pir and Derawer fort were visited About 50 medicinal plants were collected Special thanks to Cholistan Institute of Desert Studies for providing help during the visit
  • 25. Medicinal Plants collection from the Cholistan desert
  • 26. Seeds of medicinal plants collected from the Cholistan desert S. No. Botanical Name Common Name 1 Acacia ampliceps 2 Acacia nilotica 3 Capparis decidua Karir 4 Cenchrus biflorus 5 Cenchrus ciliaris 6 Cymbopogon jwarancusa Khawi 7 Ficus benghalensis 8 Ficus religiosa 9 Panicum turgidum 10 Sporobolus violadas 11 Vetiveria zizanioides Dhaman
  • 27. Medicinal Plants (Fresh) collected from the Cholistan DesertSr No Botanical Name Common Name Medicinal Use, if known1 Suaeda fruticosa Kali Lani2 Salsola foetida Lani3 Haloxylon salicornicum Lana4 Crotalaria burhia Chag5 Haloxylon recurvum Khar Treatment of intestinal ulcer6 Fagonia cretica Dhamasha7 Dipterygium glaucum Thuma8 Cenchrus prorate Durban9 Leptadenia pyrotechnica Khip10 Calotropis procera Ak Against inflammation, snake bite, digestive tract infections, etc11 Cymbopogon jwarancusa Khavi To treat cough and as blood purifier12 Capparis decidua Karir Against rheumatism, pain and wounds13 Aerva javanica Bui-Kaltan Against diarrhea and haematuria in cattle14 Tamarix dioica Lai15 Calligonum polygonoides Phog16 Prosopis cineraria Jandi/Kandi Treatment of rheumatism in animals
  • 28. • The local collectors provide the desert medicinal plants to the wholesale dealers and hakims at a very cost because of lack of awareness about the importance of medicinal plants.• No market is available for the sale/purchase of medicinal plants.• No policy by the Provisional or Federal Government exists regarding Pricing, Selling, Purchasing, Marketing, Distribution, Export and Sustainability of medicinal plants found naturally in Cholistan desert.• Cholistan Institute of Desert Studies (CIDS) has taken some initiative to make the farmers, collectors and Hakims aware of the importance of the medicinal plants.
  • 29. Preservation of medicinal plants
  • 30. Visit to the market of medicinal plants inLahore Central Market of Pakistan for selling/purchase/ export of the Medicinal Plants Usually peoples were reluctant to answers, they were afraid because they were considering as tax officer After detailed introduction and showing the visiting cards and ID card, some of them agreed and Few gave information due to references Suspicions prevailing in the market A few plants have been discovered recently with antidiabetic and/or anticancer potential. Price is up to Rs. 4000/kg, but are exported without acknowledging their real value; there is no export policy.
  • 31. An overview of visit to Medicinal Plant Market in LahoreWholesalers Name Name of plants (they Locality of M. Comments deal) Plants1.Shakoor Sahib Banafsha, Reetha, Swat Valley > No Adulteration in Swat Traders(Papar Market) Brooza, Koor, > Adulteration is here Bhman Surkh, Puth >If we go there (e,g in Swat, etc) our bargaining Patri, Malathi, etc. power becomes weak2.Mr. Naeem Banafsha Jungles/ Mountains > Majority of the traders about 150 in are(Paper Mandi) working in Akbari Mandi while only 35-40 in Papar Mandi3.Mr Asif 6-7 Major Plants From Local market >Incredible margins exist due to lack of price(Papar Mandi) and resell to Policy Retailer/ Processor4.Mr. Shahbaz Matar Jarri (Doodh From different > In Akbari Mandi genuine traders of M. Plants(Akbari Mandi) Bacha), Asheesh Localities are only 25-30 (Out of 150); Rest are doing mix business of karyana and medicinal plants > There is no export policy or price system > Hamdard, Marhaba, Ajmal, Hakeems, etc purchase to use5.Wahab Traders 5-6 Medicinal Plants Export from local D-S based price system(Akbar Mandi) market as well as from Swat
  • 32. DNA Barcoding Discriminatory power  Low intra-species variability  Species level genetic variability Short sequence length: 400-800 Universality
  • 33. Collection of Specimens (Leaves, roots, shoots or flowers of medicinal plants) DNA isolation Omitted step; replaced with an advanced method: Phire Plant Direct PCR kit (Thermo Scientific) Amplification of selected (ITS2 of nuclear genome; matK, psbA-trnH, rbcL of DNA regions by PCR cpDNA) Sequencing of amplified (Sanger Method) products Sequencing matching & (BLAST and Reference database of NCBI) alignment Species identification (various bioinfomatics tools) & Phylogenetic study
  • 34. DNA Barcoding and Conservation of Plant Biodiversity A standardized library of barcodes will enable - identification of rare, native or invasive, endangered species - systematic and conservation-based studies - track ancient divergences between basal lineages - trace organisms evolutionary history and systematic/taxonomic relationships Authentication of the status of our biodiversity Adulterated herbal medicinal materials Establish the evolutionary links of the plant species that are missing at the moment
  • 35. DNA barcoding analysis Primers designing and optimization of PCR conditions Selection of four genes ITS, rbcL, trnH-psbA, and matK Primers’ detail used for DNA barcoding studies Amplicon length S. No. Primer Name Sequence (bp) 1. ITS 5F 5′GGAAGTAAAAGTCGTAACAAGG 700 2. ITS 4R 5′TCCTCCGCTTATTGATATGC 700 3. rbcL 1f 5′ATGTCACCACAAACAGAAAC 750 4. rbcL 724r 5′TCGCATGTACCTGCAGTAGC 750 5. trnH-psbA psbAF 5′GTTATGCATGAACGTAATGCTC 400-600 6. trnH-psbA trnH2 5′CGCGCATGGTGGATTCACAATCC 400-600 7. matK 390F 5′CGATCTATTCATTCAATATTTC 850 8. matK 1326R 5′TCTAGCACACGAAAGTCGAAGT 850
  • 36. PCR conditions for different regions of DNA from the Plants PCR reaction Cycling Protocol 3 step protocol Component 25 µL reaction Cycle step Cycles Temp. Time Initial 98 ˚C 5 min H2 O 9.5 µL 1 denaturation Denaturation 98 ˚C 5 sec Phire plant PCR buffer 12.5 µL Annealing Variable* 1 min 30 Extension 72 ˚C 1 min Primer F and Primer R 1.3 µL each Final Extension 72 ˚C 7 min DNA polymerase 0.5 µL 1 Seed sample 0.5 mm punch *Annealing temperatures: ITS 51 oC, rbcL 56 oC, trnH-psbA 55 oC, matK 52 oCAgarose gel for amplified fragments after PCR. Lane 1 ITS, Lane 2 rbcL, Lane 3 DNA ladder, Lane 5 trnH-psbA, Lane 7 matK1
  • 37. Conclusions~100 plants collected and preserved from both the regions; another visit will be made to the desert area during March (best season) for further collection of the plants and in May to the Swat valley.No valid price system for the sale/purchase of the medicinal plants was found in the main markets.Wholesalers buy the medicinal plants from different collectors at a very low rate and sell in bulk amount at higher rates to the bigger markets.The PCR based method for DNA barcoding is optimized and ready to be applied on the medicinal plants.
  • 38. Conclusion….continuedIt was noted that the local people could not exploit the medicinal plants due to the following reasons:• Lack of awareness regarding time of harvesting of the medicinal plants• Roots and/or shoots that are grazed and collected for medicinal purpose are a threat for their regeneration• Lack of skills for using medicinal plants as economic opportunity• Lack of knowledge about the marketing of available medicinal plants species
  • 39. Conclusion….continued• Poor management of medicinal plants such as uncontrolled and unsystematic grazing, improper harvesting and mismanagement• Pickers suffer the problems including low price paid by dealers, lack of appropriate tools and equipments, etc., as well as no proper market for sale.
  • 40. Work in progress/future work Identification of the unidentified plants by a taxonomist Amplification of the desired DNA sequences from the collected medicinal plants followed by sequencing and phylogenetic analysis Detailed socio-economic analyses of the regions with respect to the medicinal plants Biochemical analysis on selected plants of both the regions to assess their real economic importance and value Organization of awareness workshops in both the regions Development of policy guidelines for implementation in the regions for conservation of medicinal plants and improving economic condition of the local people
  • 41. Documentation of medicinal plants on molecularbasis is necessary for conservation of biodiversity,and to provide ownership of the important plants tothe respective region, ultimately leading to improvethe socio-economic condition of the neglectedcommunities