Web. hboc visual aids
Upcoming SlideShare
Loading in...5
×
 

Web. hboc visual aids

on

  • 52 views

 

Statistics

Views

Total Views
52
Views on SlideShare
52
Embed Views
0

Actions

Likes
0
Downloads
0
Comments
0

0 Embeds 0

No embeds

Accessibility

Categories

Upload Details

Uploaded via as Microsoft PowerPoint

Usage Rights

© All Rights Reserved

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Processing…
Post Comment
Edit your comment

Web. hboc visual aids Web. hboc visual aids Presentation Transcript

  • How Much Breast & Ovarian Cancer Is Hereditary? Ovarian CancerBreast Cancer 10-25% 70-80% 5–10% 15-20% Sporadic Familial Hereditary
  • Features of Hereditary and Sporadic Cancer in Hereditary Breast and Ovarian Cancer Syndrome (HBOC) Hereditary Sporadic • Multiple affected blood relatives in more than one generation • Typically, earlier age of onset (<50) • Individuals with bilateral or more than one cancer diagnosis (breast/ovarian) •Males with breast cancer • One or only a few affected blood relatives • Typically, later age of onset Br, 42 Br, 47 Ov, 58 Br, 35Ov, 50 Br, 72
  • Chromosomes BRCA1BRCA2 ***~84% of HBOC is caused by BRCA1 & BRCA2
  • 50% 50% BRCA1 -chromosome 17 BRCA2 - chromosome 13
  • BRCA1 & BRCA2 Lifetime Cancer Risks Type of Cancer General Population BRCA1 BRCA2 Female Breast Cancer 12% 56-87% 56-87% 2nd Breast Cancer 0.8-1.5% (per year – 5y) 5 year: 20% Lifetime: 64% 5 year: 12% Lifetime: 50% Ovarian Cancer 1.8% 44% 27% Male Breast Cancer 0.1% ~1-2% 6-10% Pancreatic Cancer <1% - - ~1.5-5% Melanoma 1-2% - - Increased Prostate Cancer 12% ~15-20% ~15-20%
  • Cancer Screening and Risk-Reduction Options Increased Screening Risk-Reduction Surgery Medications Breast • Monthly breast-self exam • Clinical breast exam every 6 months • Yearly mammogram • Yearly MRI Bilateral Mastectomy can reduce the risk of breast cancer by 96% Tamoxifen/ Raloxifene can reduce the risk of breast cancer by approximately 50% Ovarian • Transvaginal Ultrasound • CA-125 blood tests every 6 months * Limitations: Screening is not effective at picking up early stage cancer * Bilateral Salpingo- Oophorectomy (removing both the ovaries and fallopian tubes) can reduce the risk of ovarian cancer by 96% Oral Contraceptives (birth control pills) can reduce the risk of ovarian cancer by approximately 50%
  • Genetic Testing for Breast Cancer BRCA1 BRCA2 ATGCCGTATAGCTAGTCGATGTACG • Blood Test • Misspellings, Deleted, or Added DNA [i.e., mutation] • Tests offered: -Analysis of BRCA1 & BRCA2 genes [3-4 weeks] -Breast/Ovarian Panels [12 weeks] -Targeted mutation analysis (when family mutation is known) [3 weeks]
  • Possible Test Results Positive Result Increased chance of certain cancers; (implications for other family members ) (Known mutation detected) Mutation has been identified in Negative Result family (True Negative) (No mutation detected) - No increase in risk above the general population Mutation has not been identified in family and patient has cancer - Cancer most likely not due to BRCA1/2 Mutation has not been identified in family and patient does not have cancer - Doesn’t rule out BRCA1/2 Variant of Uncertain Significance Cancer risk not yet known (Mutation, but implications/management are not known)
  • Implications for other family members
  • Breast/Ovarian Panels **Includes BRCA1/2 & 19 additional genes that can increase the risk for breast cancer **High risk gene panel-BRCA1/2, CDH1, PTEN, STK11, TP53