SlideShare a Scribd company logo
1 of 10
How Much Breast & Ovarian Cancer Is Hereditary?
Ovarian CancerBreast Cancer
10-25%
70-80%
5–10% 15-20%
Sporadic
Familial
Hereditary
Features of Hereditary and Sporadic Cancer in Hereditary
Breast and Ovarian Cancer Syndrome (HBOC)
Hereditary Sporadic
• Multiple affected blood relatives in more
than one generation
• Typically, earlier age of onset (<50)
• Individuals with bilateral or more than
one cancer diagnosis (breast/ovarian)
•Males with breast cancer
• One or only a few affected blood
relatives
• Typically, later age of onset
Br, 42
Br, 47
Ov, 58
Br, 35Ov, 50
Br, 72
Chromosomes
BRCA1BRCA2
***~84% of HBOC is caused by BRCA1 & BRCA2
50% 50%
BRCA1
-chromosome 17
BRCA2 -
chromosome 13
BRCA1 & BRCA2
Lifetime Cancer Risks
Type
of Cancer
General
Population
BRCA1 BRCA2
Female Breast
Cancer
12% 56-87% 56-87%
2nd
Breast Cancer 0.8-1.5%
(per year – 5y)
5 year: 20%
Lifetime: 64%
5 year: 12%
Lifetime: 50%
Ovarian Cancer 1.8% 44% 27%
Male Breast
Cancer
0.1% ~1-2% 6-10%
Pancreatic Cancer <1% - - ~1.5-5%
Melanoma 1-2% - - Increased
Prostate Cancer 12% ~15-20% ~15-20%
Cancer Screening and Risk-Reduction Options
Increased Screening Risk-Reduction
Surgery
Medications
Breast
• Monthly breast-self
exam
• Clinical breast exam
every 6 months
• Yearly mammogram
• Yearly MRI
Bilateral Mastectomy
can reduce the risk of
breast cancer by 96%
Tamoxifen/
Raloxifene can
reduce the risk of
breast cancer by
approximately 50%
Ovarian
• Transvaginal
Ultrasound
• CA-125 blood tests
every 6 months
* Limitations: Screening
is not effective at picking
up early stage cancer *
Bilateral Salpingo-
Oophorectomy
(removing both the
ovaries and fallopian
tubes) can reduce the
risk of ovarian cancer
by 96%
Oral Contraceptives
(birth control pills)
can reduce the risk
of ovarian cancer by
approximately 50%
Genetic Testing for Breast Cancer
BRCA1
BRCA2
ATGCCGTATAGCTAGTCGATGTACG
• Blood Test
• Misspellings, Deleted, or Added DNA [i.e., mutation]
• Tests offered:
-Analysis of BRCA1 & BRCA2 genes [3-4 weeks]
-Breast/Ovarian Panels [12 weeks]
-Targeted mutation analysis (when family mutation is known) [3 weeks]
Possible Test Results
Positive Result Increased chance of certain cancers;
(implications for other family
members ) (Known mutation detected)
Mutation has been identified in
Negative Result family (True Negative)
(No mutation detected) - No increase in risk above the
general population
Mutation has not been identified in
family and patient has cancer
- Cancer most likely not due to
BRCA1/2
Mutation has not been identified
in family and patient does not have
cancer
- Doesn’t rule out BRCA1/2
Variant of Uncertain Significance Cancer risk not yet known
(Mutation, but implications/management are not known)
Implications for
other family
members
Breast/Ovarian Panels
**Includes BRCA1/2 & 19 additional genes that can increase the risk for breast cancer
**High risk gene panel-BRCA1/2, CDH1, PTEN, STK11, TP53

More Related Content

What's hot

Beyond BRCA Mutations: What's New in the World of Genetic Testing?
Beyond BRCA Mutations: What's New in the World of Genetic Testing?Beyond BRCA Mutations: What's New in the World of Genetic Testing?
Beyond BRCA Mutations: What's New in the World of Genetic Testing?bkling
 
BRCA – IMPORTANCE IN HEREDITARY BREAST & OVARIAN CANCER by Dr Sharda Jain
BRCA – IMPORTANCE IN HEREDITARY  BREAST & OVARIAN CANCER by Dr Sharda Jain BRCA – IMPORTANCE IN HEREDITARY  BREAST & OVARIAN CANCER by Dr Sharda Jain
BRCA – IMPORTANCE IN HEREDITARY BREAST & OVARIAN CANCER by Dr Sharda Jain Lifecare Centre
 
Breast Cancer, Ovarian Cancer and Prostate Cancer
Breast Cancer, Ovarian Cancer and Prostate CancerBreast Cancer, Ovarian Cancer and Prostate Cancer
Breast Cancer, Ovarian Cancer and Prostate CancerThet Su Win
 
Brca2 mutation and their influence to cancer
Brca2 mutation and their influence to cancerBrca2 mutation and their influence to cancer
Brca2 mutation and their influence to cancergalinayakubova
 
Aviad Zick. Role of BRCA status in treatment planning
Aviad Zick. Role of BRCA status in treatment planningAviad Zick. Role of BRCA status in treatment planning
Aviad Zick. Role of BRCA status in treatment planningbreastcancerupdatecongress
 
Breast Cancer
Breast CancerBreast Cancer
Breast Cancercphcosu
 
Molecular biology of breast cancer and
Molecular biology of breast cancer andMolecular biology of breast cancer and
Molecular biology of breast cancer andbarun kumar
 
Prophylaxis and early diagnosis of breast cancer
Prophylaxis and early diagnosis of breast cancerProphylaxis and early diagnosis of breast cancer
Prophylaxis and early diagnosis of breast cancerINVICTA GENETICS
 
Breast cancer genetic testing: Is it right for you?
Breast cancer genetic testing: Is it right for you?Breast cancer genetic testing: Is it right for you?
Breast cancer genetic testing: Is it right for you?Via Christi Health
 
A data driven nomogram for breast cancer survival
A data driven nomogram for breast cancer survivalA data driven nomogram for breast cancer survival
A data driven nomogram for breast cancer survivalLisa Federer
 
Gene expression profiling in breast carcinoma
Gene expression profiling in breast carcinomaGene expression profiling in breast carcinoma
Gene expression profiling in breast carcinomaghoshparthanrs
 
HEREDITARY BREAST and OVARY CANCER [HBOC] SYNDROME, Dr BUI DAC CHI.
HEREDITARY BREAST and OVARY CANCER [HBOC] SYNDROME, Dr BUI DAC CHI.HEREDITARY BREAST and OVARY CANCER [HBOC] SYNDROME, Dr BUI DAC CHI.
HEREDITARY BREAST and OVARY CANCER [HBOC] SYNDROME, Dr BUI DAC CHI.hungnguyenthien
 
Activating Brca1 And Brca2 With Estrogen
Activating Brca1 And Brca2 With EstrogenActivating Brca1 And Brca2 With Estrogen
Activating Brca1 And Brca2 With Estrogennvani
 

What's hot (20)

Beyond BRCA Mutations: What's New in the World of Genetic Testing?
Beyond BRCA Mutations: What's New in the World of Genetic Testing?Beyond BRCA Mutations: What's New in the World of Genetic Testing?
Beyond BRCA Mutations: What's New in the World of Genetic Testing?
 
Breastcancer genes-ppt
Breastcancer genes-pptBreastcancer genes-ppt
Breastcancer genes-ppt
 
Brca testing
Brca testingBrca testing
Brca testing
 
BRCA – IMPORTANCE IN HEREDITARY BREAST & OVARIAN CANCER by Dr Sharda Jain
BRCA – IMPORTANCE IN HEREDITARY  BREAST & OVARIAN CANCER by Dr Sharda Jain BRCA – IMPORTANCE IN HEREDITARY  BREAST & OVARIAN CANCER by Dr Sharda Jain
BRCA – IMPORTANCE IN HEREDITARY BREAST & OVARIAN CANCER by Dr Sharda Jain
 
Genetics of Breast Cancer
Genetics of Breast CancerGenetics of Breast Cancer
Genetics of Breast Cancer
 
DrTerespolsky
DrTerespolskyDrTerespolsky
DrTerespolsky
 
Breast Cancer, Ovarian Cancer and Prostate Cancer
Breast Cancer, Ovarian Cancer and Prostate CancerBreast Cancer, Ovarian Cancer and Prostate Cancer
Breast Cancer, Ovarian Cancer and Prostate Cancer
 
Brca2 mutation and their influence to cancer
Brca2 mutation and their influence to cancerBrca2 mutation and their influence to cancer
Brca2 mutation and their influence to cancer
 
Aviad Zick. Role of BRCA status in treatment planning
Aviad Zick. Role of BRCA status in treatment planningAviad Zick. Role of BRCA status in treatment planning
Aviad Zick. Role of BRCA status in treatment planning
 
Breast Cancer
Breast CancerBreast Cancer
Breast Cancer
 
Molecular biology of breast cancer and
Molecular biology of breast cancer andMolecular biology of breast cancer and
Molecular biology of breast cancer and
 
Prophylaxis and early diagnosis of breast cancer
Prophylaxis and early diagnosis of breast cancerProphylaxis and early diagnosis of breast cancer
Prophylaxis and early diagnosis of breast cancer
 
12. brca in premenopausal breast cancer
12. brca in premenopausal breast cancer12. brca in premenopausal breast cancer
12. brca in premenopausal breast cancer
 
Understanding BRCA1/2 Cancer Risk
Understanding BRCA1/2 Cancer RiskUnderstanding BRCA1/2 Cancer Risk
Understanding BRCA1/2 Cancer Risk
 
Breast cancer genetic testing: Is it right for you?
Breast cancer genetic testing: Is it right for you?Breast cancer genetic testing: Is it right for you?
Breast cancer genetic testing: Is it right for you?
 
Genetics 101: Sandra Brown, MS, LCGC
Genetics 101: Sandra Brown, MS, LCGCGenetics 101: Sandra Brown, MS, LCGC
Genetics 101: Sandra Brown, MS, LCGC
 
A data driven nomogram for breast cancer survival
A data driven nomogram for breast cancer survivalA data driven nomogram for breast cancer survival
A data driven nomogram for breast cancer survival
 
Gene expression profiling in breast carcinoma
Gene expression profiling in breast carcinomaGene expression profiling in breast carcinoma
Gene expression profiling in breast carcinoma
 
HEREDITARY BREAST and OVARY CANCER [HBOC] SYNDROME, Dr BUI DAC CHI.
HEREDITARY BREAST and OVARY CANCER [HBOC] SYNDROME, Dr BUI DAC CHI.HEREDITARY BREAST and OVARY CANCER [HBOC] SYNDROME, Dr BUI DAC CHI.
HEREDITARY BREAST and OVARY CANCER [HBOC] SYNDROME, Dr BUI DAC CHI.
 
Activating Brca1 And Brca2 With Estrogen
Activating Brca1 And Brca2 With EstrogenActivating Brca1 And Brca2 With Estrogen
Activating Brca1 And Brca2 With Estrogen
 

Similar to Hereditary breast and ovarian cancer clinic visit visual aids (Mayo Clinic Florida)

Genetic Testing for Cancer Risk
Genetic Testing for Cancer RiskGenetic Testing for Cancer Risk
Genetic Testing for Cancer Riskflasco_org
 
All in the Family: Hereditary Risk for Gynecologic Cancer
All in the Family: Hereditary Risk for Gynecologic CancerAll in the Family: Hereditary Risk for Gynecologic Cancer
All in the Family: Hereditary Risk for Gynecologic Cancerbkling
 
Ver c 2014 clinical reviews amelia island (1)
Ver c 2014 clinical reviews amelia island (1)Ver c 2014 clinical reviews amelia island (1)
Ver c 2014 clinical reviews amelia island (1)Douglas Riegert-Johnson
 
Is surgical intervention in women with
Is surgical intervention in women withIs surgical intervention in women with
Is surgical intervention in women withWafaa Benjamin
 
Survivorship Issues Genetics 2016
Survivorship Issues Genetics 2016Survivorship Issues Genetics 2016
Survivorship Issues Genetics 2016OSUCCC - James
 
Hereditary Genetics focusing on Prostate Cancer
Hereditary Genetics focusing on Prostate CancerHereditary Genetics focusing on Prostate Cancer
Hereditary Genetics focusing on Prostate Cancerflasco_org
 
Hereditary Breast and Ovarian Cancer Syndrome
Hereditary Breast and Ovarian Cancer SyndromeHereditary Breast and Ovarian Cancer Syndrome
Hereditary Breast and Ovarian Cancer SyndromeAsha Reddy
 
Testing, genetic counselling and its implications in Gynaecological Cancers
Testing, genetic counselling and its implications in Gynaecological CancersTesting, genetic counselling and its implications in Gynaecological Cancers
Testing, genetic counselling and its implications in Gynaecological CancersNamrata Das
 
Hereditary Cancer Syndrome
Hereditary Cancer SyndromeHereditary Cancer Syndrome
Hereditary Cancer SyndromeSujoy Dasgupta
 
Genetic Connections to Breast Cancer - February 14, 2023
Genetic Connections to Breast Cancer - February 14, 2023Genetic Connections to Breast Cancer - February 14, 2023
Genetic Connections to Breast Cancer - February 14, 2023CHC Connecticut
 
Chapter 38 role of surgery in cancer prevention
Chapter 38 role of surgery in cancer preventionChapter 38 role of surgery in cancer prevention
Chapter 38 role of surgery in cancer preventionNilesh Kucha
 
All in the Family: Using Family Health History to Identify and Support Women ...
All in the Family: Using Family Health History to Identify and Support Women ...All in the Family: Using Family Health History to Identify and Support Women ...
All in the Family: Using Family Health History to Identify and Support Women ...Chicago Center for Jewish Genetic Disorders
 
Kawita bapat BRCA
Kawita bapat BRCA Kawita bapat BRCA
Kawita bapat BRCA Kawita Bapat
 
risk factor for breast cancer.pptx
risk factor for breast cancer.pptxrisk factor for breast cancer.pptx
risk factor for breast cancer.pptxPushpa Lal Bhadel
 
cancer_genetics_for_gps_13_july_2010 (1).ppt
cancer_genetics_for_gps_13_july_2010 (1).pptcancer_genetics_for_gps_13_july_2010 (1).ppt
cancer_genetics_for_gps_13_july_2010 (1).pptmidolyon1990gmailcom
 
cancer_genetics_for_gps_13_july_2010 (2).ppt
cancer_genetics_for_gps_13_july_2010 (2).pptcancer_genetics_for_gps_13_july_2010 (2).ppt
cancer_genetics_for_gps_13_july_2010 (2).pptmidolyon1990gmailcom
 
Etiopathogenesis and Risk factors of Ca Breast.pptx
Etiopathogenesis and Risk factors of Ca Breast.pptxEtiopathogenesis and Risk factors of Ca Breast.pptx
Etiopathogenesis and Risk factors of Ca Breast.pptxAkshaySarraf1
 

Similar to Hereditary breast and ovarian cancer clinic visit visual aids (Mayo Clinic Florida) (20)

Genetic Testing for Cancer Risk
Genetic Testing for Cancer RiskGenetic Testing for Cancer Risk
Genetic Testing for Cancer Risk
 
BRCA ONCOLOGY.ppt
BRCA ONCOLOGY.pptBRCA ONCOLOGY.ppt
BRCA ONCOLOGY.ppt
 
BRCA ONCOLOGY.ppt
BRCA ONCOLOGY.pptBRCA ONCOLOGY.ppt
BRCA ONCOLOGY.ppt
 
All in the Family: Hereditary Risk for Gynecologic Cancer
All in the Family: Hereditary Risk for Gynecologic CancerAll in the Family: Hereditary Risk for Gynecologic Cancer
All in the Family: Hereditary Risk for Gynecologic Cancer
 
Ver c 2014 clinical reviews amelia island (1)
Ver c 2014 clinical reviews amelia island (1)Ver c 2014 clinical reviews amelia island (1)
Ver c 2014 clinical reviews amelia island (1)
 
Cancer genetics.ppt
Cancer genetics.pptCancer genetics.ppt
Cancer genetics.ppt
 
Is surgical intervention in women with
Is surgical intervention in women withIs surgical intervention in women with
Is surgical intervention in women with
 
Survivorship Issues Genetics 2016
Survivorship Issues Genetics 2016Survivorship Issues Genetics 2016
Survivorship Issues Genetics 2016
 
Hereditary Genetics focusing on Prostate Cancer
Hereditary Genetics focusing on Prostate CancerHereditary Genetics focusing on Prostate Cancer
Hereditary Genetics focusing on Prostate Cancer
 
Hereditary Breast and Ovarian Cancer Syndrome
Hereditary Breast and Ovarian Cancer SyndromeHereditary Breast and Ovarian Cancer Syndrome
Hereditary Breast and Ovarian Cancer Syndrome
 
Testing, genetic counselling and its implications in Gynaecological Cancers
Testing, genetic counselling and its implications in Gynaecological CancersTesting, genetic counselling and its implications in Gynaecological Cancers
Testing, genetic counselling and its implications in Gynaecological Cancers
 
Hereditary Cancer Syndrome
Hereditary Cancer SyndromeHereditary Cancer Syndrome
Hereditary Cancer Syndrome
 
Genetic Connections to Breast Cancer - February 14, 2023
Genetic Connections to Breast Cancer - February 14, 2023Genetic Connections to Breast Cancer - February 14, 2023
Genetic Connections to Breast Cancer - February 14, 2023
 
Chapter 38 role of surgery in cancer prevention
Chapter 38 role of surgery in cancer preventionChapter 38 role of surgery in cancer prevention
Chapter 38 role of surgery in cancer prevention
 
All in the Family: Using Family Health History to Identify and Support Women ...
All in the Family: Using Family Health History to Identify and Support Women ...All in the Family: Using Family Health History to Identify and Support Women ...
All in the Family: Using Family Health History to Identify and Support Women ...
 
Kawita bapat BRCA
Kawita bapat BRCA Kawita bapat BRCA
Kawita bapat BRCA
 
risk factor for breast cancer.pptx
risk factor for breast cancer.pptxrisk factor for breast cancer.pptx
risk factor for breast cancer.pptx
 
cancer_genetics_for_gps_13_july_2010 (1).ppt
cancer_genetics_for_gps_13_july_2010 (1).pptcancer_genetics_for_gps_13_july_2010 (1).ppt
cancer_genetics_for_gps_13_july_2010 (1).ppt
 
cancer_genetics_for_gps_13_july_2010 (2).ppt
cancer_genetics_for_gps_13_july_2010 (2).pptcancer_genetics_for_gps_13_july_2010 (2).ppt
cancer_genetics_for_gps_13_july_2010 (2).ppt
 
Etiopathogenesis and Risk factors of Ca Breast.pptx
Etiopathogenesis and Risk factors of Ca Breast.pptxEtiopathogenesis and Risk factors of Ca Breast.pptx
Etiopathogenesis and Risk factors of Ca Breast.pptx
 

More from Douglas Riegert-Johnson

2020 Update In Hereditary Cancer Syndromes
2020 Update In Hereditary Cancer Syndromes2020 Update In Hereditary Cancer Syndromes
2020 Update In Hereditary Cancer SyndromesDouglas Riegert-Johnson
 
Version i. riegert johnson. colorectal neoplasms and hereditary syndromes
Version i. riegert johnson. colorectal neoplasms and hereditary syndromesVersion i. riegert johnson. colorectal neoplasms and hereditary syndromes
Version i. riegert johnson. colorectal neoplasms and hereditary syndromesDouglas Riegert-Johnson
 
Lynch Syndrome and Serrated Polyposis Syndrome in 20 minutes.
Lynch Syndrome and Serrated Polyposis Syndrome in 20 minutes.Lynch Syndrome and Serrated Polyposis Syndrome in 20 minutes.
Lynch Syndrome and Serrated Polyposis Syndrome in 20 minutes.Douglas Riegert-Johnson
 
Florida GI Society. Serrated polyps. Version i.
Florida GI Society. Serrated polyps. Version i.Florida GI Society. Serrated polyps. Version i.
Florida GI Society. Serrated polyps. Version i.Douglas Riegert-Johnson
 
2016 may. version c. pearls in the management of pjs
2016 may. version c. pearls in the management of pjs2016 may. version c. pearls in the management of pjs
2016 may. version c. pearls in the management of pjsDouglas Riegert-Johnson
 
Ver r 2015 clinical reviews amelia island (1)
Ver r 2015 clinical reviews amelia island (1)Ver r 2015 clinical reviews amelia island (1)
Ver r 2015 clinical reviews amelia island (1)Douglas Riegert-Johnson
 
Version e 2015 hawaii serrated adenoma follow up
Version e 2015 hawaii serrated adenoma follow upVersion e 2015 hawaii serrated adenoma follow up
Version e 2015 hawaii serrated adenoma follow upDouglas Riegert-Johnson
 
Companion slideshow for polyppolyp.com (Familial adenomatous polyposis)
Companion slideshow for polyppolyp.com (Familial adenomatous polyposis)Companion slideshow for polyppolyp.com (Familial adenomatous polyposis)
Companion slideshow for polyppolyp.com (Familial adenomatous polyposis)Douglas Riegert-Johnson
 
Familial Polyposis and Lynch syndrome review March 2014
Familial Polyposis and Lynch syndrome review March 2014Familial Polyposis and Lynch syndrome review March 2014
Familial Polyposis and Lynch syndrome review March 2014Douglas Riegert-Johnson
 

More from Douglas Riegert-Johnson (14)

Riegert Johnson Genetics Ver I.pptx
Riegert Johnson Genetics Ver I.pptxRiegert Johnson Genetics Ver I.pptx
Riegert Johnson Genetics Ver I.pptx
 
2020 Update In Hereditary Cancer Syndromes
2020 Update In Hereditary Cancer Syndromes2020 Update In Hereditary Cancer Syndromes
2020 Update In Hereditary Cancer Syndromes
 
Version i. riegert johnson. colorectal neoplasms and hereditary syndromes
Version i. riegert johnson. colorectal neoplasms and hereditary syndromesVersion i. riegert johnson. colorectal neoplasms and hereditary syndromes
Version i. riegert johnson. colorectal neoplasms and hereditary syndromes
 
Lynch Syndrome and Serrated Polyposis Syndrome in 20 minutes.
Lynch Syndrome and Serrated Polyposis Syndrome in 20 minutes.Lynch Syndrome and Serrated Polyposis Syndrome in 20 minutes.
Lynch Syndrome and Serrated Polyposis Syndrome in 20 minutes.
 
Version j 2017 uf medical grand rounds
Version j 2017 uf medical grand roundsVersion j 2017 uf medical grand rounds
Version j 2017 uf medical grand rounds
 
Florida GI Society. Serrated polyps. Version i.
Florida GI Society. Serrated polyps. Version i.Florida GI Society. Serrated polyps. Version i.
Florida GI Society. Serrated polyps. Version i.
 
2016 may. version c. pearls in the management of pjs
2016 may. version c. pearls in the management of pjs2016 may. version c. pearls in the management of pjs
2016 may. version c. pearls in the management of pjs
 
Ver r 2015 clinical reviews amelia island (1)
Ver r 2015 clinical reviews amelia island (1)Ver r 2015 clinical reviews amelia island (1)
Ver r 2015 clinical reviews amelia island (1)
 
2015 fellows lecture version d
2015 fellows lecture version d2015 fellows lecture version d
2015 fellows lecture version d
 
Version e 2015 hawaii serrated adenoma follow up
Version e 2015 hawaii serrated adenoma follow upVersion e 2015 hawaii serrated adenoma follow up
Version e 2015 hawaii serrated adenoma follow up
 
Polyppolyp lynch syndrome version a
Polyppolyp lynch syndrome version aPolyppolyp lynch syndrome version a
Polyppolyp lynch syndrome version a
 
Companion slideshow for polyppolyp.com (Familial adenomatous polyposis)
Companion slideshow for polyppolyp.com (Familial adenomatous polyposis)Companion slideshow for polyppolyp.com (Familial adenomatous polyposis)
Companion slideshow for polyppolyp.com (Familial adenomatous polyposis)
 
Case discussions in polyposis
Case discussions in polyposisCase discussions in polyposis
Case discussions in polyposis
 
Familial Polyposis and Lynch syndrome review March 2014
Familial Polyposis and Lynch syndrome review March 2014Familial Polyposis and Lynch syndrome review March 2014
Familial Polyposis and Lynch syndrome review March 2014
 

Recently uploaded

Call Girls Service in Bommanahalli - 7001305949 with real photos and phone nu...
Call Girls Service in Bommanahalli - 7001305949 with real photos and phone nu...Call Girls Service in Bommanahalli - 7001305949 with real photos and phone nu...
Call Girls Service in Bommanahalli - 7001305949 with real photos and phone nu...narwatsonia7
 
Sonagachi Call Girls Services 9907093804 @24x7 High Class Babes Here Call Now
Sonagachi Call Girls Services 9907093804 @24x7 High Class Babes Here Call NowSonagachi Call Girls Services 9907093804 @24x7 High Class Babes Here Call Now
Sonagachi Call Girls Services 9907093804 @24x7 High Class Babes Here Call NowRiya Pathan
 
Call Girls Jp Nagar Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Jp Nagar Just Call 7001305949 Top Class Call Girl Service AvailableCall Girls Jp Nagar Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Jp Nagar Just Call 7001305949 Top Class Call Girl Service Availablenarwatsonia7
 
Call Girls Service Nandiambakkam | 7001305949 At Low Cost Cash Payment Booking
Call Girls Service Nandiambakkam | 7001305949 At Low Cost Cash Payment BookingCall Girls Service Nandiambakkam | 7001305949 At Low Cost Cash Payment Booking
Call Girls Service Nandiambakkam | 7001305949 At Low Cost Cash Payment BookingNehru place Escorts
 
Call Girls In Andheri East Call 9920874524 Book Hot And Sexy Girls
Call Girls In Andheri East Call 9920874524 Book Hot And Sexy GirlsCall Girls In Andheri East Call 9920874524 Book Hot And Sexy Girls
Call Girls In Andheri East Call 9920874524 Book Hot And Sexy Girlsnehamumbai
 
Call Girls Hebbal Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Hebbal Just Call 7001305949 Top Class Call Girl Service AvailableCall Girls Hebbal Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Hebbal Just Call 7001305949 Top Class Call Girl Service Availablenarwatsonia7
 
Call Girls Whitefield Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Whitefield Just Call 7001305949 Top Class Call Girl Service AvailableCall Girls Whitefield Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Whitefield Just Call 7001305949 Top Class Call Girl Service Availablenarwatsonia7
 
Kolkata Call Girls Services 9907093804 @24x7 High Class Babes Here Call Now
Kolkata Call Girls Services 9907093804 @24x7 High Class Babes Here Call NowKolkata Call Girls Services 9907093804 @24x7 High Class Babes Here Call Now
Kolkata Call Girls Services 9907093804 @24x7 High Class Babes Here Call NowNehru place Escorts
 
Glomerular Filtration and determinants of glomerular filtration .pptx
Glomerular Filtration and  determinants of glomerular filtration .pptxGlomerular Filtration and  determinants of glomerular filtration .pptx
Glomerular Filtration and determinants of glomerular filtration .pptxDr.Nusrat Tariq
 
Bangalore Call Girls Marathahalli 📞 9907093804 High Profile Service 100% Safe
Bangalore Call Girls Marathahalli 📞 9907093804 High Profile Service 100% SafeBangalore Call Girls Marathahalli 📞 9907093804 High Profile Service 100% Safe
Bangalore Call Girls Marathahalli 📞 9907093804 High Profile Service 100% Safenarwatsonia7
 
High Profile Call Girls Jaipur Vani 8445551418 Independent Escort Service Jaipur
High Profile Call Girls Jaipur Vani 8445551418 Independent Escort Service JaipurHigh Profile Call Girls Jaipur Vani 8445551418 Independent Escort Service Jaipur
High Profile Call Girls Jaipur Vani 8445551418 Independent Escort Service Jaipurparulsinha
 
Call Girls Service Chennai Jiya 7001305949 Independent Escort Service Chennai
Call Girls Service Chennai Jiya 7001305949 Independent Escort Service ChennaiCall Girls Service Chennai Jiya 7001305949 Independent Escort Service Chennai
Call Girls Service Chennai Jiya 7001305949 Independent Escort Service ChennaiNehru place Escorts
 
College Call Girls Pune Mira 9907093804 Short 1500 Night 6000 Best call girls...
College Call Girls Pune Mira 9907093804 Short 1500 Night 6000 Best call girls...College Call Girls Pune Mira 9907093804 Short 1500 Night 6000 Best call girls...
College Call Girls Pune Mira 9907093804 Short 1500 Night 6000 Best call girls...Miss joya
 
call girls in Connaught Place DELHI 🔝 >༒9540349809 🔝 genuine Escort Service ...
call girls in Connaught Place  DELHI 🔝 >༒9540349809 🔝 genuine Escort Service ...call girls in Connaught Place  DELHI 🔝 >༒9540349809 🔝 genuine Escort Service ...
call girls in Connaught Place DELHI 🔝 >༒9540349809 🔝 genuine Escort Service ...saminamagar
 
Russian Call Girls in Pune Riya 9907093804 Short 1500 Night 6000 Best call gi...
Russian Call Girls in Pune Riya 9907093804 Short 1500 Night 6000 Best call gi...Russian Call Girls in Pune Riya 9907093804 Short 1500 Night 6000 Best call gi...
Russian Call Girls in Pune Riya 9907093804 Short 1500 Night 6000 Best call gi...Miss joya
 
Mumbai Call Girls Service 9910780858 Real Russian Girls Looking Models
Mumbai Call Girls Service 9910780858 Real Russian Girls Looking ModelsMumbai Call Girls Service 9910780858 Real Russian Girls Looking Models
Mumbai Call Girls Service 9910780858 Real Russian Girls Looking Modelssonalikaur4
 
See the 2,456 pharmacies on the National E-Pharmacy Platform
See the 2,456 pharmacies on the National E-Pharmacy PlatformSee the 2,456 pharmacies on the National E-Pharmacy Platform
See the 2,456 pharmacies on the National E-Pharmacy PlatformKweku Zurek
 
Russian Call Girls Chickpet - 7001305949 Booking and charges genuine rate for...
Russian Call Girls Chickpet - 7001305949 Booking and charges genuine rate for...Russian Call Girls Chickpet - 7001305949 Booking and charges genuine rate for...
Russian Call Girls Chickpet - 7001305949 Booking and charges genuine rate for...narwatsonia7
 
Call Girls ITPL Just Call 7001305949 Top Class Call Girl Service Available
Call Girls ITPL Just Call 7001305949 Top Class Call Girl Service AvailableCall Girls ITPL Just Call 7001305949 Top Class Call Girl Service Available
Call Girls ITPL Just Call 7001305949 Top Class Call Girl Service Availablenarwatsonia7
 
Call Girls Electronic City Just Call 7001305949 Top Class Call Girl Service A...
Call Girls Electronic City Just Call 7001305949 Top Class Call Girl Service A...Call Girls Electronic City Just Call 7001305949 Top Class Call Girl Service A...
Call Girls Electronic City Just Call 7001305949 Top Class Call Girl Service A...narwatsonia7
 

Recently uploaded (20)

Call Girls Service in Bommanahalli - 7001305949 with real photos and phone nu...
Call Girls Service in Bommanahalli - 7001305949 with real photos and phone nu...Call Girls Service in Bommanahalli - 7001305949 with real photos and phone nu...
Call Girls Service in Bommanahalli - 7001305949 with real photos and phone nu...
 
Sonagachi Call Girls Services 9907093804 @24x7 High Class Babes Here Call Now
Sonagachi Call Girls Services 9907093804 @24x7 High Class Babes Here Call NowSonagachi Call Girls Services 9907093804 @24x7 High Class Babes Here Call Now
Sonagachi Call Girls Services 9907093804 @24x7 High Class Babes Here Call Now
 
Call Girls Jp Nagar Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Jp Nagar Just Call 7001305949 Top Class Call Girl Service AvailableCall Girls Jp Nagar Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Jp Nagar Just Call 7001305949 Top Class Call Girl Service Available
 
Call Girls Service Nandiambakkam | 7001305949 At Low Cost Cash Payment Booking
Call Girls Service Nandiambakkam | 7001305949 At Low Cost Cash Payment BookingCall Girls Service Nandiambakkam | 7001305949 At Low Cost Cash Payment Booking
Call Girls Service Nandiambakkam | 7001305949 At Low Cost Cash Payment Booking
 
Call Girls In Andheri East Call 9920874524 Book Hot And Sexy Girls
Call Girls In Andheri East Call 9920874524 Book Hot And Sexy GirlsCall Girls In Andheri East Call 9920874524 Book Hot And Sexy Girls
Call Girls In Andheri East Call 9920874524 Book Hot And Sexy Girls
 
Call Girls Hebbal Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Hebbal Just Call 7001305949 Top Class Call Girl Service AvailableCall Girls Hebbal Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Hebbal Just Call 7001305949 Top Class Call Girl Service Available
 
Call Girls Whitefield Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Whitefield Just Call 7001305949 Top Class Call Girl Service AvailableCall Girls Whitefield Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Whitefield Just Call 7001305949 Top Class Call Girl Service Available
 
Kolkata Call Girls Services 9907093804 @24x7 High Class Babes Here Call Now
Kolkata Call Girls Services 9907093804 @24x7 High Class Babes Here Call NowKolkata Call Girls Services 9907093804 @24x7 High Class Babes Here Call Now
Kolkata Call Girls Services 9907093804 @24x7 High Class Babes Here Call Now
 
Glomerular Filtration and determinants of glomerular filtration .pptx
Glomerular Filtration and  determinants of glomerular filtration .pptxGlomerular Filtration and  determinants of glomerular filtration .pptx
Glomerular Filtration and determinants of glomerular filtration .pptx
 
Bangalore Call Girls Marathahalli 📞 9907093804 High Profile Service 100% Safe
Bangalore Call Girls Marathahalli 📞 9907093804 High Profile Service 100% SafeBangalore Call Girls Marathahalli 📞 9907093804 High Profile Service 100% Safe
Bangalore Call Girls Marathahalli 📞 9907093804 High Profile Service 100% Safe
 
High Profile Call Girls Jaipur Vani 8445551418 Independent Escort Service Jaipur
High Profile Call Girls Jaipur Vani 8445551418 Independent Escort Service JaipurHigh Profile Call Girls Jaipur Vani 8445551418 Independent Escort Service Jaipur
High Profile Call Girls Jaipur Vani 8445551418 Independent Escort Service Jaipur
 
Call Girls Service Chennai Jiya 7001305949 Independent Escort Service Chennai
Call Girls Service Chennai Jiya 7001305949 Independent Escort Service ChennaiCall Girls Service Chennai Jiya 7001305949 Independent Escort Service Chennai
Call Girls Service Chennai Jiya 7001305949 Independent Escort Service Chennai
 
College Call Girls Pune Mira 9907093804 Short 1500 Night 6000 Best call girls...
College Call Girls Pune Mira 9907093804 Short 1500 Night 6000 Best call girls...College Call Girls Pune Mira 9907093804 Short 1500 Night 6000 Best call girls...
College Call Girls Pune Mira 9907093804 Short 1500 Night 6000 Best call girls...
 
call girls in Connaught Place DELHI 🔝 >༒9540349809 🔝 genuine Escort Service ...
call girls in Connaught Place  DELHI 🔝 >༒9540349809 🔝 genuine Escort Service ...call girls in Connaught Place  DELHI 🔝 >༒9540349809 🔝 genuine Escort Service ...
call girls in Connaught Place DELHI 🔝 >༒9540349809 🔝 genuine Escort Service ...
 
Russian Call Girls in Pune Riya 9907093804 Short 1500 Night 6000 Best call gi...
Russian Call Girls in Pune Riya 9907093804 Short 1500 Night 6000 Best call gi...Russian Call Girls in Pune Riya 9907093804 Short 1500 Night 6000 Best call gi...
Russian Call Girls in Pune Riya 9907093804 Short 1500 Night 6000 Best call gi...
 
Mumbai Call Girls Service 9910780858 Real Russian Girls Looking Models
Mumbai Call Girls Service 9910780858 Real Russian Girls Looking ModelsMumbai Call Girls Service 9910780858 Real Russian Girls Looking Models
Mumbai Call Girls Service 9910780858 Real Russian Girls Looking Models
 
See the 2,456 pharmacies on the National E-Pharmacy Platform
See the 2,456 pharmacies on the National E-Pharmacy PlatformSee the 2,456 pharmacies on the National E-Pharmacy Platform
See the 2,456 pharmacies on the National E-Pharmacy Platform
 
Russian Call Girls Chickpet - 7001305949 Booking and charges genuine rate for...
Russian Call Girls Chickpet - 7001305949 Booking and charges genuine rate for...Russian Call Girls Chickpet - 7001305949 Booking and charges genuine rate for...
Russian Call Girls Chickpet - 7001305949 Booking and charges genuine rate for...
 
Call Girls ITPL Just Call 7001305949 Top Class Call Girl Service Available
Call Girls ITPL Just Call 7001305949 Top Class Call Girl Service AvailableCall Girls ITPL Just Call 7001305949 Top Class Call Girl Service Available
Call Girls ITPL Just Call 7001305949 Top Class Call Girl Service Available
 
Call Girls Electronic City Just Call 7001305949 Top Class Call Girl Service A...
Call Girls Electronic City Just Call 7001305949 Top Class Call Girl Service A...Call Girls Electronic City Just Call 7001305949 Top Class Call Girl Service A...
Call Girls Electronic City Just Call 7001305949 Top Class Call Girl Service A...
 

Hereditary breast and ovarian cancer clinic visit visual aids (Mayo Clinic Florida)

  • 1. How Much Breast & Ovarian Cancer Is Hereditary? Ovarian CancerBreast Cancer 10-25% 70-80% 5–10% 15-20% Sporadic Familial Hereditary
  • 2. Features of Hereditary and Sporadic Cancer in Hereditary Breast and Ovarian Cancer Syndrome (HBOC) Hereditary Sporadic • Multiple affected blood relatives in more than one generation • Typically, earlier age of onset (<50) • Individuals with bilateral or more than one cancer diagnosis (breast/ovarian) •Males with breast cancer • One or only a few affected blood relatives • Typically, later age of onset Br, 42 Br, 47 Ov, 58 Br, 35Ov, 50 Br, 72
  • 3. Chromosomes BRCA1BRCA2 ***~84% of HBOC is caused by BRCA1 & BRCA2
  • 5. BRCA1 & BRCA2 Lifetime Cancer Risks Type of Cancer General Population BRCA1 BRCA2 Female Breast Cancer 12% 56-87% 56-87% 2nd Breast Cancer 0.8-1.5% (per year – 5y) 5 year: 20% Lifetime: 64% 5 year: 12% Lifetime: 50% Ovarian Cancer 1.8% 44% 27% Male Breast Cancer 0.1% ~1-2% 6-10% Pancreatic Cancer <1% - - ~1.5-5% Melanoma 1-2% - - Increased Prostate Cancer 12% ~15-20% ~15-20%
  • 6. Cancer Screening and Risk-Reduction Options Increased Screening Risk-Reduction Surgery Medications Breast • Monthly breast-self exam • Clinical breast exam every 6 months • Yearly mammogram • Yearly MRI Bilateral Mastectomy can reduce the risk of breast cancer by 96% Tamoxifen/ Raloxifene can reduce the risk of breast cancer by approximately 50% Ovarian • Transvaginal Ultrasound • CA-125 blood tests every 6 months * Limitations: Screening is not effective at picking up early stage cancer * Bilateral Salpingo- Oophorectomy (removing both the ovaries and fallopian tubes) can reduce the risk of ovarian cancer by 96% Oral Contraceptives (birth control pills) can reduce the risk of ovarian cancer by approximately 50%
  • 7. Genetic Testing for Breast Cancer BRCA1 BRCA2 ATGCCGTATAGCTAGTCGATGTACG • Blood Test • Misspellings, Deleted, or Added DNA [i.e., mutation] • Tests offered: -Analysis of BRCA1 & BRCA2 genes [3-4 weeks] -Breast/Ovarian Panels [12 weeks] -Targeted mutation analysis (when family mutation is known) [3 weeks]
  • 8. Possible Test Results Positive Result Increased chance of certain cancers; (implications for other family members ) (Known mutation detected) Mutation has been identified in Negative Result family (True Negative) (No mutation detected) - No increase in risk above the general population Mutation has not been identified in family and patient has cancer - Cancer most likely not due to BRCA1/2 Mutation has not been identified in family and patient does not have cancer - Doesn’t rule out BRCA1/2 Variant of Uncertain Significance Cancer risk not yet known (Mutation, but implications/management are not known)
  • 10. Breast/Ovarian Panels **Includes BRCA1/2 & 19 additional genes that can increase the risk for breast cancer **High risk gene panel-BRCA1/2, CDH1, PTEN, STK11, TP53