Web. hboc visual aids

978 views

Published on

Published in: Health & Medicine
0 Comments
1 Like
Statistics
Notes
  • Be the first to comment

No Downloads
Views
Total views
978
On SlideShare
0
From Embeds
0
Number of Embeds
2
Actions
Shares
0
Downloads
6
Comments
0
Likes
1
Embeds 0
No embeds

No notes for slide

Web. hboc visual aids

  1. 1. How Much Breast & Ovarian Cancer Is Hereditary? Ovarian CancerBreast Cancer 10-25% 70-80% 5–10% 15-20% Sporadic Familial Hereditary
  2. 2. Features of Hereditary and Sporadic Cancer in Hereditary Breast and Ovarian Cancer Syndrome (HBOC) Hereditary Sporadic • Multiple affected blood relatives in more than one generation • Typically, earlier age of onset (<50) • Individuals with bilateral or more than one cancer diagnosis (breast/ovarian) •Males with breast cancer • One or only a few affected blood relatives • Typically, later age of onset Br, 42 Br, 47 Ov, 58 Br, 35Ov, 50 Br, 72
  3. 3. Chromosomes BRCA1BRCA2 ***~84% of HBOC is caused by BRCA1 & BRCA2
  4. 4. 50% 50% BRCA1 -chromosome 17 BRCA2 - chromosome 13
  5. 5. BRCA1 & BRCA2 Lifetime Cancer Risks Type of Cancer General Population BRCA1 BRCA2 Female Breast Cancer 12% 56-87% 56-87% 2nd Breast Cancer 0.8-1.5% (per year – 5y) 5 year: 20% Lifetime: 64% 5 year: 12% Lifetime: 50% Ovarian Cancer 1.8% 44% 27% Male Breast Cancer 0.1% ~1-2% 6-10% Pancreatic Cancer <1% - - ~1.5-5% Melanoma 1-2% - - Increased Prostate Cancer 12% ~15-20% ~15-20%
  6. 6. Cancer Screening and Risk-Reduction Options Increased Screening Risk-Reduction Surgery Medications Breast • Monthly breast-self exam • Clinical breast exam every 6 months • Yearly mammogram • Yearly MRI Bilateral Mastectomy can reduce the risk of breast cancer by 96% Tamoxifen/ Raloxifene can reduce the risk of breast cancer by approximately 50% Ovarian • Transvaginal Ultrasound • CA-125 blood tests every 6 months * Limitations: Screening is not effective at picking up early stage cancer * Bilateral Salpingo- Oophorectomy (removing both the ovaries and fallopian tubes) can reduce the risk of ovarian cancer by 96% Oral Contraceptives (birth control pills) can reduce the risk of ovarian cancer by approximately 50%
  7. 7. Genetic Testing for Breast Cancer BRCA1 BRCA2 ATGCCGTATAGCTAGTCGATGTACG • Blood Test • Misspellings, Deleted, or Added DNA [i.e., mutation] • Tests offered: -Analysis of BRCA1 & BRCA2 genes [3-4 weeks] -Breast/Ovarian Panels [12 weeks] -Targeted mutation analysis (when family mutation is known) [3 weeks]
  8. 8. Possible Test Results Positive Result Increased chance of certain cancers; (implications for other family members ) (Known mutation detected) Mutation has been identified in Negative Result family (True Negative) (No mutation detected) - No increase in risk above the general population Mutation has not been identified in family and patient has cancer - Cancer most likely not due to BRCA1/2 Mutation has not been identified in family and patient does not have cancer - Doesn’t rule out BRCA1/2 Variant of Uncertain Significance Cancer risk not yet known (Mutation, but implications/management are not known)
  9. 9. Implications for other family members
  10. 10. Breast/Ovarian Panels **Includes BRCA1/2 & 19 additional genes that can increase the risk for breast cancer **High risk gene panel-BRCA1/2, CDH1, PTEN, STK11, TP53

×