SlideShare a Scribd company logo

Strips.blogged

•Download as PPT, PDF•
•
O
Orkan

Strips - Cardiovascular

Health & MedicineTechnologyBusiness
1 of 12
As one of the first studies leading to emergence of reverse hybridization strip assays to be used as diagnostic tools in screening cardiovascular disease risks.
[object Object]
 
 
Steps of the actual work: ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
Challenges in multiplexing the PCR reactions ,[object Object],[object Object],[object Object]
Challenges in designing multiple probes; achieving the same Tm values
Challenges in designing multiple probes; achieving the same Tm values ,[object Object],[object Object],[object Object],[object Object],72.11 50.00% 28 CGATGCTAGCATGCATGCATGCTAGCTA 52.92 27.27% 22 ATTTACCAAAATTGCTCTAGAA 72.96 73.68% 19 GGGGTCACACCGCGGGCAT 63.23 60.00% 20 CAGTGCATGCGAGACGCTAG Tm (°C) GC% -mer Probe Sequence
Results and discussions ,[object Object],[object Object],[object Object],[object Object],[object Object]
[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],Results and discussions
[object Object],Results and discussions
 

Recommended

Western Blot
Western BlotWestern Blot
Western BlotASHIKH SEETHY
 
AllisonFoster_SRFPoster_Fa14 (2)
AllisonFoster_SRFPoster_Fa14 (2)AllisonFoster_SRFPoster_Fa14 (2)
AllisonFoster_SRFPoster_Fa14 (2)Allison Foster
 
Legia Warszawa - Lech Poznań (PP
Legia Warszawa - Lech Poznań (PP Legia Warszawa - Lech Poznań (PP
Legia Warszawa - Lech Poznań (PP Krzysztof Kropielnicki
 
Entrepreneurs Census Final Report
Entrepreneurs Census Final ReportEntrepreneurs Census Final Report
Entrepreneurs Census Final ReportMatt Shapiro
 
Competitive advantage in a networked world
Competitive advantage in a networked worldCompetitive advantage in a networked world
Competitive advantage in a networked worldTom Lucas
 
Entrepreneurs Census Final Report
Entrepreneurs Census Final ReportEntrepreneurs Census Final Report
Entrepreneurs Census Final ReportMatt Shapiro
 
The view from the dark side
The view from the dark sideThe view from the dark side
The view from the dark sideTom Lucas
 
Racons de joc
Racons de jocRacons de joc
Racons de jocsilvia
 

Recommended

Western Blot
Western BlotWestern Blot
Western BlotASHIKH SEETHY
 
AllisonFoster_SRFPoster_Fa14 (2)
AllisonFoster_SRFPoster_Fa14 (2)AllisonFoster_SRFPoster_Fa14 (2)
AllisonFoster_SRFPoster_Fa14 (2)Allison Foster
 
Legia Warszawa - Lech Poznań (PP
Legia Warszawa - Lech Poznań (PP Legia Warszawa - Lech Poznań (PP
Legia Warszawa - Lech Poznań (PP Krzysztof Kropielnicki
 
Entrepreneurs Census Final Report
Entrepreneurs Census Final ReportEntrepreneurs Census Final Report
Entrepreneurs Census Final ReportMatt Shapiro
 
Competitive advantage in a networked world
Competitive advantage in a networked worldCompetitive advantage in a networked world
Competitive advantage in a networked worldTom Lucas
 
Entrepreneurs Census Final Report
Entrepreneurs Census Final ReportEntrepreneurs Census Final Report
Entrepreneurs Census Final ReportMatt Shapiro
 
The view from the dark side
The view from the dark sideThe view from the dark side
The view from the dark sideTom Lucas
 
Racons de joc
Racons de jocRacons de joc
Racons de jocsilvia
 
Pyrosequencing slide presentation rev3.
Pyrosequencing slide presentation rev3.Pyrosequencing slide presentation rev3.
Pyrosequencing slide presentation rev3.Robert Bruce
 
Mastering RNA-Seq (NGS Data Analysis) - A Critical Approach To Transcriptomic...
Mastering RNA-Seq (NGS Data Analysis) - A Critical Approach To Transcriptomic...Mastering RNA-Seq (NGS Data Analysis) - A Critical Approach To Transcriptomic...
Mastering RNA-Seq (NGS Data Analysis) - A Critical Approach To Transcriptomic...Elia Brodsky
 
Microsatellites Markers
Microsatellites MarkersMicrosatellites Markers
Microsatellites MarkersKaran Veer Singh
 
Q biomarkersomaticmutation
Q biomarkersomaticmutationQ biomarkersomaticmutation
Q biomarkersomaticmutationElsa von Licy
 
Multiplex PCR ppt , its types and their applications along with advantages an...
Multiplex PCR ppt , its types and their applications along with advantages an...Multiplex PCR ppt , its types and their applications along with advantages an...
Multiplex PCR ppt , its types and their applications along with advantages an...ShimukhYadav
 
Technical Tips for qPCR
Technical Tips for qPCRTechnical Tips for qPCR
Technical Tips for qPCRIntegrated DNA Technologies
 
Thesis Intro for LinkedIn
Thesis Intro for LinkedInThesis Intro for LinkedIn
Thesis Intro for LinkedInMelissa C. Maranto
 
Micro array based comparative genomic hybridisation -Dr Yogesh D
Micro array based comparative genomic hybridisation -Dr Yogesh DMicro array based comparative genomic hybridisation -Dr Yogesh D
Micro array based comparative genomic hybridisation -Dr Yogesh DDr.Yogesh D
 
Mechanisms of Plaque Rupture in Advanced Atherosclerosis
Mechanisms of Plaque Rupture in Advanced AtherosclerosisMechanisms of Plaque Rupture in Advanced Atherosclerosis
Mechanisms of Plaque Rupture in Advanced AtherosclerosisTom Plasterer
 
Genomica - Microarreglos de DNA
Genomica - Microarreglos de DNAGenomica - Microarreglos de DNA
Genomica - Microarreglos de DNAUlises Urzua
 
How to do successful gene expression analysis - Siena 20100625
How to do successful gene expression analysis - Siena 20100625How to do successful gene expression analysis - Siena 20100625
How to do successful gene expression analysis - Siena 20100625Biogazelle
 
Ascbrn ai poster
Ascbrn ai posterAscbrn ai poster
Ascbrn ai posterElsa von Licy
 
An Investigation Of The Rigor Of Interpretation Rules
An Investigation Of The Rigor Of Interpretation RulesAn Investigation Of The Rigor Of Interpretation Rules
An Investigation Of The Rigor Of Interpretation RulesNick Brown
 
Evaluation of ctDNA extraction methods and amplifiable copy number yield usin...
Evaluation of ctDNA extraction methods and amplifiable copy number yield usin...Evaluation of ctDNA extraction methods and amplifiable copy number yield usin...
Evaluation of ctDNA extraction methods and amplifiable copy number yield usin...Thermo Fisher Scientific
 
Семинар ДНК 16/05/2014 Сибэнзим
Семинар ДНК 16/05/2014 СибэнзимСеминар ДНК 16/05/2014 Сибэнзим
Семинар ДНК 16/05/2014 СибэнзимRuslan Titov
 
pcr
pcrpcr
pcrASSEMELZENY
 
Qpcr1
Qpcr1Qpcr1
Qpcr1diya zara
 
Microarray validation
Microarray validationMicroarray validation
Microarray validationElsa von Licy
 
Concurrent Determination of ABO RhD Blood Types and the HIV-1 Resistance Mark...
Concurrent Determination of ABO RhD Blood Types and the HIV-1 Resistance Mark...Concurrent Determination of ABO RhD Blood Types and the HIV-1 Resistance Mark...
Concurrent Determination of ABO RhD Blood Types and the HIV-1 Resistance Mark...Thermo Fisher Scientific
 
Ross Excel 15 Final
Ross Excel 15 FinalRoss Excel 15 Final
Ross Excel 15 FinalBrandon Ross
 
Call Girl Number in Vashi Mumbai📲 9833363713 💞 Full Night Enjoy
Call Girl Number in Vashi Mumbai📲 9833363713 💞 Full Night EnjoyCall Girl Number in Vashi Mumbai📲 9833363713 💞 Full Night Enjoy
Call Girl Number in Vashi Mumbai📲 9833363713 💞 Full Night Enjoybabeytanya
 
Vip Call Girls Anna Salai Chennai 👉 8250192130 ❣️💯 Top Class Girls Available
Vip Call Girls Anna Salai Chennai 👉 8250192130 ❣️💯 Top Class Girls AvailableVip Call Girls Anna Salai Chennai 👉 8250192130 ❣️💯 Top Class Girls Available
Vip Call Girls Anna Salai Chennai 👉 8250192130 ❣️💯 Top Class Girls AvailableNehru place Escorts
 

More Related Content

Similar to Strips.blogged

Pyrosequencing slide presentation rev3.
Pyrosequencing slide presentation rev3.Pyrosequencing slide presentation rev3.
Pyrosequencing slide presentation rev3.Robert Bruce
 
Mastering RNA-Seq (NGS Data Analysis) - A Critical Approach To Transcriptomic...
Mastering RNA-Seq (NGS Data Analysis) - A Critical Approach To Transcriptomic...Mastering RNA-Seq (NGS Data Analysis) - A Critical Approach To Transcriptomic...
Mastering RNA-Seq (NGS Data Analysis) - A Critical Approach To Transcriptomic...Elia Brodsky
 
Q biomarkersomaticmutation
Q biomarkersomaticmutationQ biomarkersomaticmutation
Q biomarkersomaticmutationElsa von Licy
 
Multiplex PCR ppt , its types and their applications along with advantages an...
Multiplex PCR ppt , its types and their applications along with advantages an...Multiplex PCR ppt , its types and their applications along with advantages an...
Multiplex PCR ppt , its types and their applications along with advantages an...ShimukhYadav
 
Micro array based comparative genomic hybridisation -Dr Yogesh D
Micro array based comparative genomic hybridisation -Dr Yogesh DMicro array based comparative genomic hybridisation -Dr Yogesh D
Micro array based comparative genomic hybridisation -Dr Yogesh DDr.Yogesh D
 
Mechanisms of Plaque Rupture in Advanced Atherosclerosis
Mechanisms of Plaque Rupture in Advanced AtherosclerosisMechanisms of Plaque Rupture in Advanced Atherosclerosis
Mechanisms of Plaque Rupture in Advanced AtherosclerosisTom Plasterer
 
Genomica - Microarreglos de DNA
Genomica - Microarreglos de DNAGenomica - Microarreglos de DNA
Genomica - Microarreglos de DNAUlises Urzua
 
How to do successful gene expression analysis - Siena 20100625
How to do successful gene expression analysis - Siena 20100625How to do successful gene expression analysis - Siena 20100625
How to do successful gene expression analysis - Siena 20100625Biogazelle
 
An Investigation Of The Rigor Of Interpretation Rules
An Investigation Of The Rigor Of Interpretation RulesAn Investigation Of The Rigor Of Interpretation Rules
An Investigation Of The Rigor Of Interpretation RulesNick Brown
 
Evaluation of ctDNA extraction methods and amplifiable copy number yield usin...
Evaluation of ctDNA extraction methods and amplifiable copy number yield usin...Evaluation of ctDNA extraction methods and amplifiable copy number yield usin...
Evaluation of ctDNA extraction methods and amplifiable copy number yield usin...Thermo Fisher Scientific
 
Семинар ДНК 16/05/2014 Сибэнзим
Семинар ДНК 16/05/2014 СибэнзимСеминар ДНК 16/05/2014 Сибэнзим
Семинар ДНК 16/05/2014 СибэнзимRuslan Titov
 
Microarray validation
Microarray validationMicroarray validation
Microarray validationElsa von Licy
 
Concurrent Determination of ABO RhD Blood Types and the HIV-1 Resistance Mark...
Concurrent Determination of ABO RhD Blood Types and the HIV-1 Resistance Mark...Concurrent Determination of ABO RhD Blood Types and the HIV-1 Resistance Mark...
Concurrent Determination of ABO RhD Blood Types and the HIV-1 Resistance Mark...Thermo Fisher Scientific
 
Ross Excel 15 Final
Ross Excel 15 FinalRoss Excel 15 Final
Ross Excel 15 FinalBrandon Ross
 

Similar to Strips.blogged (20)

Pyrosequencing slide presentation rev3.
Pyrosequencing slide presentation rev3.Pyrosequencing slide presentation rev3.
Pyrosequencing slide presentation rev3.
 
Mastering RNA-Seq (NGS Data Analysis) - A Critical Approach To Transcriptomic...
Mastering RNA-Seq (NGS Data Analysis) - A Critical Approach To Transcriptomic...Mastering RNA-Seq (NGS Data Analysis) - A Critical Approach To Transcriptomic...
Mastering RNA-Seq (NGS Data Analysis) - A Critical Approach To Transcriptomic...
 
Microsatellites Markers
Microsatellites MarkersMicrosatellites Markers
Microsatellites Markers
 
Q biomarkersomaticmutation
Q biomarkersomaticmutationQ biomarkersomaticmutation
Q biomarkersomaticmutation
 
Multiplex PCR ppt , its types and their applications along with advantages an...
Multiplex PCR ppt , its types and their applications along with advantages an...Multiplex PCR ppt , its types and their applications along with advantages an...
Multiplex PCR ppt , its types and their applications along with advantages an...
 
Technical Tips for qPCR
Technical Tips for qPCRTechnical Tips for qPCR
Technical Tips for qPCR
 
Thesis Intro for LinkedIn
Thesis Intro for LinkedInThesis Intro for LinkedIn
Thesis Intro for LinkedIn
 
Micro array based comparative genomic hybridisation -Dr Yogesh D
Micro array based comparative genomic hybridisation -Dr Yogesh DMicro array based comparative genomic hybridisation -Dr Yogesh D
Micro array based comparative genomic hybridisation -Dr Yogesh D
 
Mechanisms of Plaque Rupture in Advanced Atherosclerosis
Mechanisms of Plaque Rupture in Advanced AtherosclerosisMechanisms of Plaque Rupture in Advanced Atherosclerosis
Mechanisms of Plaque Rupture in Advanced Atherosclerosis
 
Genomica - Microarreglos de DNA
Genomica - Microarreglos de DNAGenomica - Microarreglos de DNA
Genomica - Microarreglos de DNA
 
How to do successful gene expression analysis - Siena 20100625
How to do successful gene expression analysis - Siena 20100625How to do successful gene expression analysis - Siena 20100625
How to do successful gene expression analysis - Siena 20100625
 
Ascbrn ai poster
Ascbrn ai posterAscbrn ai poster
Ascbrn ai poster
 
An Investigation Of The Rigor Of Interpretation Rules
An Investigation Of The Rigor Of Interpretation RulesAn Investigation Of The Rigor Of Interpretation Rules
An Investigation Of The Rigor Of Interpretation Rules
 
Evaluation of ctDNA extraction methods and amplifiable copy number yield usin...
Evaluation of ctDNA extraction methods and amplifiable copy number yield usin...Evaluation of ctDNA extraction methods and amplifiable copy number yield usin...
Evaluation of ctDNA extraction methods and amplifiable copy number yield usin...
 
Семинар ДНК 16/05/2014 Сибэнзим
Семинар ДНК 16/05/2014 СибэнзимСеминар ДНК 16/05/2014 Сибэнзим
Семинар ДНК 16/05/2014 Сибэнзим
 
pcr
pcrpcr
pcr
 
Qpcr1
Qpcr1Qpcr1
Qpcr1
 
Microarray validation
Microarray validationMicroarray validation
Microarray validation
 
Concurrent Determination of ABO RhD Blood Types and the HIV-1 Resistance Mark...
Concurrent Determination of ABO RhD Blood Types and the HIV-1 Resistance Mark...Concurrent Determination of ABO RhD Blood Types and the HIV-1 Resistance Mark...
Concurrent Determination of ABO RhD Blood Types and the HIV-1 Resistance Mark...
 
Ross Excel 15 Final
Ross Excel 15 FinalRoss Excel 15 Final
Ross Excel 15 Final
 

Recently uploaded

Call Girl Number in Vashi Mumbai📲 9833363713 💞 Full Night Enjoy
Call Girl Number in Vashi Mumbai📲 9833363713 💞 Full Night EnjoyCall Girl Number in Vashi Mumbai📲 9833363713 💞 Full Night Enjoy
Call Girl Number in Vashi Mumbai📲 9833363713 💞 Full Night Enjoybabeytanya
 
Vip Call Girls Anna Salai Chennai 👉 8250192130 ❣️💯 Top Class Girls Available
Vip Call Girls Anna Salai Chennai 👉 8250192130 ❣️💯 Top Class Girls AvailableVip Call Girls Anna Salai Chennai 👉 8250192130 ❣️💯 Top Class Girls Available
Vip Call Girls Anna Salai Chennai 👉 8250192130 ❣️💯 Top Class Girls AvailableNehru place Escorts
 
Call Girls Siliguri Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Siliguri Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Siliguri Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Siliguri Just Call 9907093804 Top Class Call Girl Service AvailableDipal Arora
 
Low Rate Call Girls Kochi Anika 8250192130 Independent Escort Service Kochi
Low Rate Call Girls Kochi Anika 8250192130 Independent Escort Service KochiLow Rate Call Girls Kochi Anika 8250192130 Independent Escort Service Kochi
Low Rate Call Girls Kochi Anika 8250192130 Independent Escort Service KochiSuhani Kapoor
 
Night 7k to 12k Chennai City Center Call Girls 👉👉 7427069034⭐⭐ 100% Genuine E...
Night 7k to 12k Chennai City Center Call Girls 👉👉 7427069034⭐⭐ 100% Genuine E...Night 7k to 12k Chennai City Center Call Girls 👉👉 7427069034⭐⭐ 100% Genuine E...
Night 7k to 12k Chennai City Center Call Girls 👉👉 7427069034⭐⭐ 100% Genuine E...hotbabesbook
 
Premium Call Girls Cottonpet Whatsapp 7001035870 Independent Escort Service
Premium Call Girls Cottonpet Whatsapp 7001035870 Independent Escort ServicePremium Call Girls Cottonpet Whatsapp 7001035870 Independent Escort Service
Premium Call Girls Cottonpet Whatsapp 7001035870 Independent Escort Servicevidya singh
 
Call Girls Service Navi Mumbai Samaira 8617697112 Independent Escort Service ...
Call Girls Service Navi Mumbai Samaira 8617697112 Independent Escort Service ...Call Girls Service Navi Mumbai Samaira 8617697112 Independent Escort Service ...
Call Girls Service Navi Mumbai Samaira 8617697112 Independent Escort Service ...Call girls in Ahmedabad High profile
 
Call Girls Colaba Mumbai ❤️ 9920874524 👈 Cash on Delivery
Call Girls Colaba Mumbai ❤️ 9920874524 👈 Cash on DeliveryCall Girls Colaba Mumbai ❤️ 9920874524 👈 Cash on Delivery
Call Girls Colaba Mumbai ❤️ 9920874524 👈 Cash on Deliverynehamumbai
 
Call Girls Varanasi Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Varanasi Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Varanasi Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Varanasi Just Call 9907093804 Top Class Call Girl Service AvailableDipal Arora
 
VIP Russian Call Girls in Varanasi Samaira 8250192130 Independent Escort Serv...
VIP Russian Call Girls in Varanasi Samaira 8250192130 Independent Escort Serv...VIP Russian Call Girls in Varanasi Samaira 8250192130 Independent Escort Serv...
VIP Russian Call Girls in Varanasi Samaira 8250192130 Independent Escort Serv...Neha Kaur
 
VIP Mumbai Call Girls Hiranandani Gardens Just Call 9920874524 with A/C Room ...
VIP Mumbai Call Girls Hiranandani Gardens Just Call 9920874524 with A/C Room ...VIP Mumbai Call Girls Hiranandani Gardens Just Call 9920874524 with A/C Room ...
VIP Mumbai Call Girls Hiranandani Gardens Just Call 9920874524 with A/C Room ...Garima Khatri
 
VIP Call Girls Tirunelveli Aaradhya 8250192130 Independent Escort Service Tir...
VIP Call Girls Tirunelveli Aaradhya 8250192130 Independent Escort Service Tir...VIP Call Girls Tirunelveli Aaradhya 8250192130 Independent Escort Service Tir...
VIP Call Girls Tirunelveli Aaradhya 8250192130 Independent Escort Service Tir...narwatsonia7
 
Top Rated Bangalore Call Girls Richmond Circle ⟟ 8250192130 ⟟ Call Me For Gen...
Top Rated Bangalore Call Girls Richmond Circle ⟟ 8250192130 ⟟ Call Me For Gen...Top Rated Bangalore Call Girls Richmond Circle ⟟ 8250192130 ⟟ Call Me For Gen...
Top Rated Bangalore Call Girls Richmond Circle ⟟ 8250192130 ⟟ Call Me For Gen...narwatsonia7
 
VIP Service Call Girls Sindhi Colony 📳 7877925207 For 18+ VIP Call Girl At Th...
VIP Service Call Girls Sindhi Colony 📳 7877925207 For 18+ VIP Call Girl At Th...VIP Service Call Girls Sindhi Colony 📳 7877925207 For 18+ VIP Call Girl At Th...
VIP Service Call Girls Sindhi Colony 📳 7877925207 For 18+ VIP Call Girl At Th...jageshsingh5554
 
Artifacts in Nuclear Medicine with Identifying and resolving artifacts.
Artifacts in Nuclear Medicine with Identifying and resolving artifacts.Artifacts in Nuclear Medicine with Identifying and resolving artifacts.
Artifacts in Nuclear Medicine with Identifying and resolving artifacts.MiadAlsulami
 
Call Girls Cuttack Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Cuttack Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Cuttack Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Cuttack Just Call 9907093804 Top Class Call Girl Service AvailableDipal Arora
 
Call Girls Nagpur Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Nagpur Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Nagpur Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Nagpur Just Call 9907093804 Top Class Call Girl Service AvailableDipal Arora
 
Call Girl Coimbatore Prisha☎️ 8250192130 Independent Escort Service Coimbatore
Call Girl Coimbatore Prisha☎️ 8250192130 Independent Escort Service CoimbatoreCall Girl Coimbatore Prisha☎️ 8250192130 Independent Escort Service Coimbatore
Call Girl Coimbatore Prisha☎️ 8250192130 Independent Escort Service Coimbatorenarwatsonia7
 
Book Paid Powai Call Girls Mumbai 𖠋 9930245274 𖠋Low Budget Full Independent H...
Book Paid Powai Call Girls Mumbai 𖠋 9930245274 𖠋Low Budget Full Independent H...Book Paid Powai Call Girls Mumbai 𖠋 9930245274 𖠋Low Budget Full Independent H...
Book Paid Powai Call Girls Mumbai 𖠋 9930245274 𖠋Low Budget Full Independent H...Call Girls in Nagpur High Profile
 
Bangalore Call Girls Hebbal Kempapura Number 7001035870 Meetin With Bangalor...
Bangalore Call Girls Hebbal Kempapura Number 7001035870 Meetin With Bangalor...Bangalore Call Girls Hebbal Kempapura Number 7001035870 Meetin With Bangalor...
Bangalore Call Girls Hebbal Kempapura Number 7001035870 Meetin With Bangalor...narwatsonia7
 

Recently uploaded (20)

Call Girl Number in Vashi Mumbai📲 9833363713 💞 Full Night Enjoy
Call Girl Number in Vashi Mumbai📲 9833363713 💞 Full Night EnjoyCall Girl Number in Vashi Mumbai📲 9833363713 💞 Full Night Enjoy
Call Girl Number in Vashi Mumbai📲 9833363713 💞 Full Night Enjoy
 
Vip Call Girls Anna Salai Chennai 👉 8250192130 ❣️💯 Top Class Girls Available
Vip Call Girls Anna Salai Chennai 👉 8250192130 ❣️💯 Top Class Girls AvailableVip Call Girls Anna Salai Chennai 👉 8250192130 ❣️💯 Top Class Girls Available
Vip Call Girls Anna Salai Chennai 👉 8250192130 ❣️💯 Top Class Girls Available
 
Call Girls Siliguri Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Siliguri Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Siliguri Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Siliguri Just Call 9907093804 Top Class Call Girl Service Available
 
Low Rate Call Girls Kochi Anika 8250192130 Independent Escort Service Kochi
Low Rate Call Girls Kochi Anika 8250192130 Independent Escort Service KochiLow Rate Call Girls Kochi Anika 8250192130 Independent Escort Service Kochi
Low Rate Call Girls Kochi Anika 8250192130 Independent Escort Service Kochi
 
Night 7k to 12k Chennai City Center Call Girls 👉👉 7427069034⭐⭐ 100% Genuine E...
Night 7k to 12k Chennai City Center Call Girls 👉👉 7427069034⭐⭐ 100% Genuine E...Night 7k to 12k Chennai City Center Call Girls 👉👉 7427069034⭐⭐ 100% Genuine E...
Night 7k to 12k Chennai City Center Call Girls 👉👉 7427069034⭐⭐ 100% Genuine E...
 
Premium Call Girls Cottonpet Whatsapp 7001035870 Independent Escort Service
Premium Call Girls Cottonpet Whatsapp 7001035870 Independent Escort ServicePremium Call Girls Cottonpet Whatsapp 7001035870 Independent Escort Service
Premium Call Girls Cottonpet Whatsapp 7001035870 Independent Escort Service
 
Call Girls Service Navi Mumbai Samaira 8617697112 Independent Escort Service ...
Call Girls Service Navi Mumbai Samaira 8617697112 Independent Escort Service ...Call Girls Service Navi Mumbai Samaira 8617697112 Independent Escort Service ...
Call Girls Service Navi Mumbai Samaira 8617697112 Independent Escort Service ...
 
Call Girls Colaba Mumbai ❤️ 9920874524 👈 Cash on Delivery
Call Girls Colaba Mumbai ❤️ 9920874524 👈 Cash on DeliveryCall Girls Colaba Mumbai ❤️ 9920874524 👈 Cash on Delivery
Call Girls Colaba Mumbai ❤️ 9920874524 👈 Cash on Delivery
 
Call Girls Varanasi Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Varanasi Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Varanasi Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Varanasi Just Call 9907093804 Top Class Call Girl Service Available
 
VIP Russian Call Girls in Varanasi Samaira 8250192130 Independent Escort Serv...
VIP Russian Call Girls in Varanasi Samaira 8250192130 Independent Escort Serv...VIP Russian Call Girls in Varanasi Samaira 8250192130 Independent Escort Serv...
VIP Russian Call Girls in Varanasi Samaira 8250192130 Independent Escort Serv...
 
VIP Mumbai Call Girls Hiranandani Gardens Just Call 9920874524 with A/C Room ...
VIP Mumbai Call Girls Hiranandani Gardens Just Call 9920874524 with A/C Room ...VIP Mumbai Call Girls Hiranandani Gardens Just Call 9920874524 with A/C Room ...
VIP Mumbai Call Girls Hiranandani Gardens Just Call 9920874524 with A/C Room ...
 
VIP Call Girls Tirunelveli Aaradhya 8250192130 Independent Escort Service Tir...
VIP Call Girls Tirunelveli Aaradhya 8250192130 Independent Escort Service Tir...VIP Call Girls Tirunelveli Aaradhya 8250192130 Independent Escort Service Tir...
VIP Call Girls Tirunelveli Aaradhya 8250192130 Independent Escort Service Tir...
 
Top Rated Bangalore Call Girls Richmond Circle ⟟ 8250192130 ⟟ Call Me For Gen...
Top Rated Bangalore Call Girls Richmond Circle ⟟ 8250192130 ⟟ Call Me For Gen...Top Rated Bangalore Call Girls Richmond Circle ⟟ 8250192130 ⟟ Call Me For Gen...
Top Rated Bangalore Call Girls Richmond Circle ⟟ 8250192130 ⟟ Call Me For Gen...
 
VIP Service Call Girls Sindhi Colony 📳 7877925207 For 18+ VIP Call Girl At Th...
VIP Service Call Girls Sindhi Colony 📳 7877925207 For 18+ VIP Call Girl At Th...VIP Service Call Girls Sindhi Colony 📳 7877925207 For 18+ VIP Call Girl At Th...
VIP Service Call Girls Sindhi Colony 📳 7877925207 For 18+ VIP Call Girl At Th...
 
Artifacts in Nuclear Medicine with Identifying and resolving artifacts.
Artifacts in Nuclear Medicine with Identifying and resolving artifacts.Artifacts in Nuclear Medicine with Identifying and resolving artifacts.
Artifacts in Nuclear Medicine with Identifying and resolving artifacts.
 
Call Girls Cuttack Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Cuttack Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Cuttack Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Cuttack Just Call 9907093804 Top Class Call Girl Service Available
 
Call Girls Nagpur Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Nagpur Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Nagpur Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Nagpur Just Call 9907093804 Top Class Call Girl Service Available
 
Call Girl Coimbatore Prisha☎️ 8250192130 Independent Escort Service Coimbatore
Call Girl Coimbatore Prisha☎️ 8250192130 Independent Escort Service CoimbatoreCall Girl Coimbatore Prisha☎️ 8250192130 Independent Escort Service Coimbatore
Call Girl Coimbatore Prisha☎️ 8250192130 Independent Escort Service Coimbatore
 
Book Paid Powai Call Girls Mumbai 𖠋 9930245274 𖠋Low Budget Full Independent H...
Book Paid Powai Call Girls Mumbai 𖠋 9930245274 𖠋Low Budget Full Independent H...Book Paid Powai Call Girls Mumbai 𖠋 9930245274 𖠋Low Budget Full Independent H...
Book Paid Powai Call Girls Mumbai 𖠋 9930245274 𖠋Low Budget Full Independent H...
 
Bangalore Call Girls Hebbal Kempapura Number 7001035870 Meetin With Bangalor...
Bangalore Call Girls Hebbal Kempapura Number 7001035870 Meetin With Bangalor...Bangalore Call Girls Hebbal Kempapura Number 7001035870 Meetin With Bangalor...
Bangalore Call Girls Hebbal Kempapura Number 7001035870 Meetin With Bangalor...
 

Strips.blogged

  • 1. As one of the first studies leading to emergence of reverse hybridization strip assays to be used as diagnostic tools in screening cardiovascular disease risks.
  • 2.
  • 3.  
  • 4.  
  • 5.
  • 6.
  • 7. Challenges in designing multiple probes; achieving the same Tm values
  • 8.
  • 9.
  • 10.
  • 11.
  • 12.