Gastric cancer is one of the most common cancers in the world. Gastric cancer usually occurs at an advanced age (average ≥ 65 years) and has symptoms similar to gastric ulcers and other gastric infections, its early diagnosis is one of the major problems of this type of cancer. Molecular mechanisms initiate cancer and the molecular changes of normal cells compared to cancer cells are very important. dysfunction of Fucosyl transferase enzymes is associated with gastric cancer.
2. clinicsofoncology.com 2
Volume 4 Issue 4 -2021 Research Article
involved, while the rest of the tumors are non-Hodgkin's lympho-
ma, sarcoma, and carcinoid tumors [2]. Early-stage gastric cancer
is often asymptomatic or has nonspecific symptoms. Symptoms
develop over time, at which time cancer often reaches an advanced
stage and may metastasize, which is one of the main reasons for its
relatively poor prognosis [3]. Despite the declining incidence rate,
the absolute number of new cases is increasing each year, mainly
due to the aging of the world's population. More than half of pa-
tients with gastric cancer are over 60 years old and the average age
at diagnosis is 65 years [1].
Glycosylation is the main modification of proteins after transla-
tion. N or O-glycans play a major role in protein synthesis and then
modulate their functional activity [4] and the formation of recep-
tor-ligand complexes for cell and cell interactions [5]. It is often
found as an N-glycan carbohydrate compound in environmental
situations, but it is also linked to the N-acetyl glucosamine nucleus.
It is involved in the adhesion of selectin-dependent leukocytes, the
stability of the maternal-fetal interface, and the formation of Lewis
blood group antigen [6]. O-fucosylation is an unusual change after
the translation of proteins catalyzed by two glycosyltransferases,
protein O fucosyl transferase 1 (POFUT1) and protein O-fucosyl
transferase 2 (POFUT2). POFUT1 modulates domains such as
epidermal growth factor (EGF-like) and POFUT2 modifies throm-
bospondin modification (TSR) [7]. Increased evidence suggests
the role of POFUT1 in controlling the balance between undifferen-
tiated and differentiated normal cells [8]. The human glycoprotein
POFUT1 is composed of 393 arm amino acids of chromosome
20, near the centromere [9]. POFUT1 is an ER-resident enzyme
that allows focusing on S or T in C2X4 (S / T) C3 consensus mo-
tifs, where C2 and C3 are the second and third cysteines of the 6
protected species in EGF-like domains [10]. The most important
known target is the POFUT1 Notch receptor, with four similarities
in humans, NOTCH1 to NOTCH4, which contain between 29 and
36 EGF-like domains with 14 to 20 O-fucosylation consensus sites
[11, 12]. Proper glycosylation of notch receptors, especially their
O-fucosylation, is necessary for subsequent optimal degradation,
which results in the release of NICD (Notch intracellular domain),
which is displaced to control transcription of target genes in the
nucleus [13, 14]. In mice, Pofut1 knockout is lethal. Embryos die
in the middle of digestion with severe defects in somitogenesis,
carcinogenesis, neurogenesis, and their phenotype is similar to
that of low-impact embryos in the Notch signaling pathway [11].
O-fucose helps stabilize EGF-like, which participates in a new ER
quality control pathway, essential for correcting the targeting of
the Notch to the cell membrane and its interaction with ligands
[15]. Recent evidence demonstrates the implications of Notch in
tumor pathology. In acute T-cell lymphoblastic leukemia (T-ALL),
the NOTCH1 gene is mutated in at least 65% of cases [16]. An
extrauterine Notch1 expression induces epithelial-mesenchymal
transmission in cancer growth and metastasis in human breast can-
cer [17]. In gastric cancer cells, activation of the Notch pathway
also causes cell proliferation and metastasis, here phosphorylated
via STAT3 and TWIST [18]. Overexpression of POFUT1 was also
observed in oral squamous cell carcinoma and was associated with
increased tumor size [19]. In gastric cancer, increased POFUT1
expression is associated with some clinical features such as higher
TNM staging and tumor differentiation modes [20]. The POFUT1
gene is localized in the 20q11.21 region, which is often ampli-
fied in tumor cells such as the breast [21], acute myeloid leuke-
mia [22], colorectal cancer with poor prognosis [23], and gastric
cancer [24]. POFUT2 modifies thrombospondin type 1 (TSPs)
repeats [25]. Thrombospondin I (TSPs) are small proteins (40 to
60 amino acids) found in secreted proteins and high cell-surface
proteins that are involved in various cellular activities including
cell binding, Extracellular Matrix regeneration (ECM), migration,
Reproduction, and apoptosis are active. Many proteins contain-
ing TSPs require post translation modification with the unusual
Glucoseβ1-3Fucose disaccharides for proper positioning and func-
tion. These disaccharides bind only to properly folded TSPs that
are O-focalized by the enzyme Pofut2. Pofut2 deficiency impairs
the secretion of target proteins and causes severe gastrolith de-
fects in mouse embryos [26]. Our prior study of esophageal cancer
showed that POFUT1&2 was more expressed in tumor tissue than
in controls [27]. Although data from all of these studies suggest
that Pofut 1&2 may also play an important role in the development
of these cancers, and many studies have reported an association
between O-fucosylation change and other invasive tumors, our
knowledge of the impact O-fucosylation on gastric cancer remains
unknown. Therefore, we started this study to evaluate the expres-
sion of POFUT1&2 in gastric cancer and to determine its potential
value as a new biomarkers and therapeutic target for this cancer.
3. Methods
This study was approved by the Golestan Ethics Committee Uni-
versity of Medical Sciences (IR.GOUMS.REC.1398.235) and in-
formed written consent was obtained from all patients.
3.1. Patient Samples
In the present study, 25 tumor tissues and 25 healthy tumor mar-
gins were collected during 10 months (December 2019 to Sep-
tember 2020) from Sayyad Shirazi Hospital (Gorgan, Iran). Tumor
margin samples were collected from the same individuals from
whom the tumor samples were taken. These samples were taken
from seemingly normal tissue at a distance from the tumor site.
Written informed consent was obtained from all patients. All of
these specimens were confirmed by the pathology laboratory of
the hospital (Table 2).
3.2. Real-Time PCR Assay (qRT-PCR)
Total RNA extraction was performed by Trizol (Invitrogen Cat.
No.15596-026). cDNA synthesis was performed using the Rever-
tAid First Strand cDNA synthesis kit (Thermo Scientific # k1621).
3. clinicsofoncology.com 3
Volume 4 Issue 4 -2021 Research Article
According to the manufacturer's instructions. Sequences of prim-
ers were obtained from published papers and purchased from De-
nazist Co. The list of Primers is shown in (Table 1).
Real-time PCR was performed by the qPCR Kit (Amplicon
A325402–25 2x qPCR Master Mixed Green) using the Applied
Biosystems StepOnePlus Realtime PCR system. The thermal cy-
cle conditions were optimized for Pofut1 at 95°C for 5 min, 38
cycles at 95°C for 20 Second, 61°C for 20 Second, 72°C for 20
Second and a final extension of the extension at 72°C for 2 min.
To normalize gene expression, GAPDH was used as a household
gene.
Table 1: Primers used in the RT-PCR reactions.
Gene Accession Number Forward primer Reverse primer Ref
POFUT1 NM_015352.1 AAGCCTCCTTTCACCAACCTC TGATGACCCGATGGTAAGCCT (27)
POFUT2 NM_015227.5 GGCAGAGTCCTGACATCCAC ACTGCTCATACTCGATGACGG (27)
GapDH NM_001256799.2 CATCATCCCTGCCTCTACTG GCCTGCTTCACCACCTTC (28)
Table 2: Relationship between expression of POFUT1&2 in gastric cancer patients and clinicopathological features of patients (n=25).
Clinical Parameters Number of Cases
P- value (statistical significance)
POFUT1 POFUT2
Gender
Male 19
0.026a
0.015a
Female 6
Age
<65 years 9
0.364 (NS)a
0.45 (NS)a
≥65 years 16
Degree of Differentiation High 12 0.748 (NS)b
0.376 (NS)b
Data presented as number of patients. a
, Spearman's rho correlation. b
, Independent sample test. NS, not
statistically significant (P>0.05).
4. Statistical Analysis
Statistical analysis was performed using SPSS 25 software (SPSS
Inc). Differences in POFUT1&2 expression between gastric can-
cer tissues and adjacent non-tumor tissues were analyzed using
Mann-Whitney test and Independent sample test and Spearman’s
Rank-Order Correlation. To determine the sensitivity, specificity,
Positive Predictive Value (PPV), Negative Predictive Value (NPV)
and gene-related cut-off value, the area under the receptor yield
characteristic curve (ROC) was used. P <0.05 was considered sta-
tistically significant.
5. Result
To identify differences in POFUT1&2 gene expression, we per-
formed POFUT1&2 expression with real-time PCR-based func-
tional in tumor samples and cancerous healthy margins. There was
a significant difference in the level of POFUT1&2 expression be-
tween tumor tissues and tumor margins. POFUT1 gene expression
showed a Cycle of Threshold (CT) a maximum of 32.38 and a min-
imum of 27.22 in tumor tissue (mean = 29.8), and a maximum of
32.04, and a minimum of 28 in the healthy margin (mean = 31.22).
In this comparison, it was found that the amount of POFUT1 in tu-
mor tissue increased significantly compared to the healthy margin
(P value = 0.006) (Figure 1a). And too, POFUT2 gene expression
showed a maximum of 24.83 and a minimum of 18.47 in tumor
tissue (mean = 21.05), and a maximum of 26.69, and a minimum
of 18.4 in the healthy margin (mean = 21.5). It was found that
the amount of POFUT2 in tumor tissue increased compared to the
healthy margin (P value = 0.001) (Figure 1b).
The relation between POFUT1&2 expression and clinicopath-
ological features such as age, sex, and differentiation of tumors
were analyzed as well (Table 2). The data showed no significant
correlation between POFUT1&2 expression levels with age and
differentiation but a significant correlation between patient's sex.
Receptor Operational Characteristics Analysis (ROC) used to de-
scribe the discrimination accuracy of a diagnostic test or predictive
model. Determining the best evaluation for POFUT1&2 gene ex-
pression in tumor samples compared to healthy margins. Analysis
to evaluate the ability of POFUT1&2 as markers of gastric cancer
showed that the area under the ROC curve for POFUT1 was (0.76)
(Figure 2a) and for POFUT2 was (0.66) (Figure 2b) indicating the
potential of POFUT1&2 as biomarkers for this malignancy. Rela-
tive expression was calculated using ΔCT the method.
4. clinicsofoncology.com 4
Volume 4 Issue 4 -2021 Research Article
Figure 1: Quantitative expression(qRT-PCR) of the POFUT1 (a) and POFUT2 (b) genes in tumor samples was significantly higher than the healthy
margin. The housekeeping gene, GAPDH, was used as the control gene. Relative expression was calculated using the 2-ΔΔCT
method. The housekeeping
gene, GAPDH was used as the control gene. POFUT: Protein O-Fucosyl transferase.
Figure 2: Expression of (a) POFUT1 with 0.76 and (b) POFUT2 with 0.66 compared with the highest value of 1.0 (100% sensitivity) has a relatively
good potential for function as a biomarker for differentiating between tumor and non-tumor in gastric adenocarcinoma.
6. Discussion
Comprehensive mechanisms by which tumors begin to develop are
crucial because early detection of cancer can initiate treatment and
increase a patient's chances of recovery. Fucosylation promotes
the development of malignant tumors [29]. Recently, many studies
show that increasing the expression of O-fucosylation is import-
ant in the invasion and metastatic behavior of cancers [28, 30-33].
O-fucosylation associated with the expression of the protein O-fu-
cosyltransferase1 (POFUT1) and protein O-fucosyltransferase2
(POFUT2). Therefore, understanding the molecular mechanisms
of O-fucosylation, especially O-fucosyltransferase enzymes, may
be used to improve effective treatment strategies for cancers.
Our findings show that genes POFUT1&2 are expressed at the
level of mRNA in Gastric tissue (tumors and tumor margins).
Quantitative gene expression analysis showed that increased ex-
pression of POFUT1&2 was found in tumor tissue. In humans,
87 targets of POFUT1 have been reported [34, 35]. POFUT1 and
Notch have been described in two types of cancer. Notch receptors
were shown that their O-fucosylation is necessary for their inter-
action with ligands and therefore Notch signaling [36]. In breast
cancer, overexpression of POFUT1 and NOTCH1 was associated
with lymph node metastasis and advanced tumor stage [37] and
in hepatocellular carcinoma, overexpression of POFUT1 causes
abnormal activation of the NOTCH way in HES1, which increases
cell migration and proliferation [38]. Moreover, NOTCH signaling
and transcription factors are important regulators in the progres-
sion of gastric cancer [18]. It is hypothesized that POFUT1 may
act through the NOTCH signaling pathway during the progression
of gastric cancer.
Studies demonstrated that POFUT2 specifically adds O-fucose to
TSPs [39]. The potential importance of O-fucosylation of TSRs in
regulating TGFβ signaling is underscored [29]. POFUT2 is pre-
dicted to modify forty-nine targets, including members of Throm-
bospondin, ADAMTS (A Disintegrin and Metalloprotease with
Thrombospondin Type 1 Repeats) [25]. The secreted ADAMTS
proteases cleave a variety of ECM substrates and have important
5. Volume 4 Issue 4 -2021 Research Article
clinicsofoncology.com 5
roles in modulating the structure and function of the ECM com-
ponents and other secreted molecules. Several ADAMTs bind to
fibrillins, which form tissue microfibrils that provide important
mechanical ECM properties and regulate TGFβ signaling [29]. In
the present study increased POFUT2 expression may play a role in
tumor metastasis and progression in Gastric cancer by increasing
the TGFβ signaling pathway, which should be further explored in
future studies.
7. Conclusion
In conclusion, our findings showed that POFUT1&2 is overex-
pressed in gastric cancer and can serve as a candidate for a clini-
cally useful diagnostic biomarker and therapeutic target for gastric
cancer.
References
1. Rawla P, Barsouk A. Epidemiology of gastric cancer: global trends,
risk factors and prevention. Przeglad gastroenterologiczny. 2019;
14(1): 26.
2. Martin TA, Ye L, Sanders AJ, Lane J, Jiang WG. Cancer invasion
and metastasis: molecular and cellular perspective. Madame Curie
Bioscience Database [Internet]: Landes Bioscience; 2013.
3. Sitarz R, Skierucha M, Mielko J, Offerhaus GJA, Maciejewski R,
Polkowski WP. Gastric cancer: epidemiology, prevention, classifi-
cation, and treatment. Cancer management and research. 2018; 10:
239.
4. Reily C, Stewart TJ, Renfrow MB, Novak J. Glycosylation in health
and disease. Nature Reviews Nephrology. 2019: 1.
5. Uchikawa E, Choi E, Shang G, Yu H, Bai X-c. Activation mecha-
nism of the insulin receptor revealed by cryo-EM structure of the
fully liganded receptor–ligand complex. Elife. 2019; 8: e48630.
6. Varki A. Biological roles of glycans. Glycobiology. 2017; 27(1):
3-49.
7. Holdener BC, Haltiwanger RS. Protein O-fucosylation: structure and
function. Current opinion in structural biology. 2019; 56: 78-86.
8. Chabanais J, Labrousse F, Chaunavel A, Germot A, Maftah A. PO-
FUT1 as a promising novel biomarker of colorectal cancer. Cancers.
2018; 10(11): 411.
9. Wang Y, Shao L, Shi S, Harris RJ, Spellman MW, Stanley P, et al.
Modification of Epidermal Growth Factor-like Repeats withO-Fu-
cose Molecular Cloning and Expression of a Novel Gdp-Fucose
Proteino-Fucosyltransferase. Journal of Biological Chemistry. 2001;
276(43): 40338-45.
10. Der Vartanian A, Chabanais J, Carrion C, Maftah A, Germot A.
Downregulation of POFUT1 Impairs Secondary Myogenic Fusion
Through a Reduced NFATc2/IL-4 Signaling Pathway. International
journal of molecular sciences. 2019; 20(18): 4396.
11. Shi S, Stanley P. Protein O-fucosyltransferase 1 is an essential com-
ponent of Notch signaling pathways. Proceedings of the National
Academy of Sciences. 2003; 100(9): 5234-9.
12. Stahl M, Uemura K, Ge C, Shi S, Tashima Y, Stanley P. Roles of
Pofut1 and O-fucose in mammalian Notch signaling. Journal of Bi-
ological Chemistry. 2008; 283(20): 13638-51.
13. Groot AJ, Vooijs MA. The role of Adams in Notch signaling. Notch
Signaling in Embryology and Cancer: Springer. 2012; 15-36.
14. Takeuchi H, Haltiwanger RS, editors. Role of glycosylation of
Notch in development. Seminars in cell & developmental biology.
2010; 21(6): 638-45.
15. Takeuchi H. Significance of O-glycosylation in Notch signaling.
Seikagaku The Journal of Japanese Biochemical Society. 2015;
87(4): 459.
16. Tosello V, Ferrando AA. The NOTCH signaling pathway: role in
the pathogenesis of T-cell acute lymphoblastic leukemia and impli-
cation for therapy. Therapeutic advances in hematology. 2013; 4(3):
199-210.
17. Zhang Y, Xu B, Zhang X-p. Effects of miRNAs on functions of
breast cancer stem cells and treatment of breast cancer. OncoTargets
and therapy. 2018; 11: 4263.
18. Yao Y, Ni Y, Zhang J, Wang H, Shao S. The role of Notch signaling
in gastric carcinoma: molecular pathogenesis and novel therapeutic
targets. Oncotarget. 2017; 8(32): 53839.
19. Yokota S, Ogawara K, Kimura R, Shimizu F, Baba T, Minakawa Y,
et al. Protein O-fucosyltransferase 1: a potential diagnostic marker
and therapeutic target for human oral cancer. International journal of
oncology. 2013; 43(6): 1864-70.
20. Dong S, Wang Z, Huang B, Zhang J, Ge Y, Fan Q, et al. Bioin-
formatics insight into glycosyltransferase gene expression in gastric
cancer: POFUT1 is a potential biomarker. Biochemical and biophys-
ical research communications. 2017; 483(1): 171-7.
21. Kallioniemi A, Kallioniemi O-P, Sudar D, Rutovitz D, Gray JW,
Waldman F, et al. Comparative genomic hybridization for molecu-
lar cytogenetic analysis of solid tumors. Science. 1992; 258(5083):
818-21.
22. MacKinnon RN, Selan C, Wall M, Baker E, Nandurkar H, Campbell
LJ. The paradox of 20q11. 21 amplification in a subset of cases of
myeloid malignancy with chromosome 20 deletion. Genes, Chro-
mosomes and Cancer. 2010; 49(11): 998-1013.
23. Postma C, Hermsen MA, Coffa J, Baak JP, Mueller JD, Mueller E,
et al. Chromosomal instability in flat adenomas and carcinomas of
the colon. The Journal of Pathology: A Journal of the Pathological
Society of Great Britain and Ireland. 2005; 205(4): 514-21.
24. Kimura Y, Noguchi T, Kawahara K, Kashima K, Daa T, Yokoyama
S. Genetic alterations in 102 primary gastric cancers by comparative
genomic hybridization: gain of 20q and loss of 18q are associated
with tumor progression. Modern pathology. 2004; 17(11): 1328-37.
25. Du J, Takeuchi H, Leonhard-Melief C, Shroyer KR, Dlugosz M,
Haltiwanger RS, et al. O-fucosylation of thrombospondin type 1
repeats restricts epithelial to mesenchymal transition (EMT) and
maintains epiblast pluripotency during mouse gastrulation. Devel-
opmental biology. 2010; 346(1): 25-38.
26. Benz BA, Nandadasa S, Takeuchi M, Grady RC, Takeuchi H, Lo-
Pilato RK, et al. Genetic and biochemical evidence that gastrulation
6. defects in Pofut2 mutants result from defects in ADAMTS9 secre-
tion. Developmental biology. 2016; 416(1): 111-22.
27. Sadeghzadeh Z, Khosravi A, Jazi MS, Asadi J. Upregulation of Fu-
cosyltransferase 3, 8 and protein O-Fucosyltransferase 1, 2 genes in
esophageal cancer stem-like cells (CSLCs). Glycoconjugate journal.
2020: 1-9.
28. Yu C-C, Lo W-L, Chen Y-W, Huang P-I, Hsu H-S, Tseng L-M, et
al. Bmi-1 regulates snail expression and promotes metastasis ability
in head and neck squamous cancer-derived ALDH1 positive cells.
Journal of oncology. 2011; 2011.
29. Hubmacher D, Apte SS. Genetic and functional linkage between
ADAMTS superfamily proteins and fibrillin-1: a novel mechanism
influencing microfibril assembly and function. Cellular and Molec-
ular Life Sciences. 2011; 68(19): 3137-48.
30. Cui X, et al. Epiregulin promotes trophoblast epithelial–mesenchy-
mal transition through poFUT1 and O-fucosylation by poFUT1 on
uPA. Cell proliferation. 2020; 53(2): e12745.
31. Du Y, et al. POFUT1 promotes colorectal cancer development
through the activation of Notch1 signaling. Cell death & disease.
2018; 9(10): 1-12.
32. Sid B, et al. Thrombospondin 1: a multifunctional protein implicat-
ed in the regulation of tumor growth. Critical reviews in oncology/
hematology. 2004; 49(3): 245-58.
33. Zhang C, et al. Caveolin-1 promotes invasion and metastasis by
upregulating Pofut1 expression in mouse hepatocellular carcinoma.
Cell death & disease. 2019; 10(7): 1-13.
34. Schneider M, Al-Shareffi E, Haltiwanger RS. Biological functions
of fucose in mammals. Glycobiology. 2017; 27(7): 601-18.
35. Takeuchi H, et al. O-Glycosylation modulates the stability of epi-
dermal growth factor-like repeats and thereby regulates Notch traf-
ficking. Journal of Biological Chemistry. 2017; 292(38): 15964-73.
36. Lampreia FP, Carmelo JG, Anjos-Afonso F. Notch signaling in the
regulation of hematopoietic stem cell. Current stem cell reports.
2017; 3(3): 202-9.
37. Wan G, et al. Overexpression of Pofut1 and activated Notch1 may
be associated with poor prognosis in breast cancer. Biochemical and
Biophysical Research Communications. 2017; 491(1): 104-11.
38. Ma L, et al. Overexpression of protein O-fucosyltransferase 1 accel-
erates hepatocellular carcinoma progression via the Notch signaling
pathway. Biochemical and biophysical research communications.
2016; 473(2): 503-10.
39. Rozario T, DeSimone DW. The extracellular matrix in development
and morphogenesis: a dynamic view. Developmental biology. 2010;
341(1): 126-40.
Volume 4 Issue 4 -2021 Research Article
clinicsofoncology.com 6