SlideShare a Scribd company logo
ViBRANT
                                                                                           Virtual Biodiversity


  A decadal view of biodiversity informatics:
  challenges and priorities   Alex Hardisty, Dave Roberts, and the
                                                                  biodiversity informatics community*




* 80 people took part in the open debate that led to this paper


  SEVENTH FRAMEWORK
      PROGRAMME                                                                             -infrastructure
ViBRANT
                                                                                           Virtual Biodiversity


  A decadal view of biodiversity informatics:
  challenges and priorities   Alex Hardisty, Dave Roberts, and the
                                                                  biodiversity informatics community*
“We are drowning in information, while starving for wisdom. The world henceforth will
be run by synthesizers, people able to put together the right information at the right
time, think critically about it, and make important choices”       E. O. Wilson, Harvard




* 80 people took part in the open debate that led to this paper


  SEVENTH FRAMEWORK
      PROGRAMME                                                                             -infrastructure
ViBRANT
                                                                                           Virtual Biodiversity


  A decadal view of biodiversity informatics:
  challenges and priorities   Alex Hardisty, Dave Roberts, and the
                                                                  biodiversity informatics community*
“We are drowning in information, while starving for wisdom. The world henceforth will
be run by synthesizers, people able to put together the right information at the right
time, think critically about it, and make important choices”       E. O. Wilson, Harvard


                      Time to
                      model all
                       life on
                       Earth.
Purves et. al. (2013) Nature,
493: 295-297

* 80 people took part in the open debate that led to this paper


  SEVENTH FRAMEWORK
      PROGRAMME                                                                             -infrastructure
ViBRANT
                                                                                          Virtual Biodiversity


 A decadal view of biodiversity informatics:
 challenges and priorities    Alex Hardisty, Dave Roberts, and the
                                                                  biodiversity informatics community*
 The Grand Challenge for Biodiversity Informatics
           An infrastructure to allow the available data to be brought
           into a coordinated coupled modelling environment, capable
           of addressing questions relating to our use of the natural
           environment, that captures the variety, distinctiveness and
           complexity of all life on Earth
 To achieve it we need:
                     To build user confidence
                     Integrative flexible e-Science environments
                     Predictive models across multiple scales, coupled
* 80 people took part in the open debate that led to this paper


 SEVENTH FRAMEWORK
     PROGRAMME                                                                            -infrastructure
ViBRANT
                                          Virtual Biodiversity

1. Open Data should be normal practice;




SEVENTH FRAMEWORK
    PROGRAMME                             -infrastructure
ViBRANT
                                                      Virtual Biodiversity

1. Open Data should be normal practice;
                                          2. Data encoding should
                                             allow analysis across
                                             multiple scales;




SEVENTH FRAMEWORK
    PROGRAMME                                         -infrastructure
ViBRANT
                                                          Virtual Biodiversity

1. Open Data should be normal practice;
                                            2. Data encoding should
                                               allow analysis across
                                               multiple scales;




                                          3. Infrastructure projects
                                             should devote significant
                                             resources to market the
                                             service they develop;

SEVENTH FRAMEWORK
    PROGRAMME                                             -infrastructure
ViBRANT
                                                                                                                          Virtual Biodiversity




                                     Didimosphenia geminata               didymo                     Echinella geminata

                                  AAAAAGCTCGTAGTTGGATTTGTGATG             Gomphonema vulgare Bréb.
                                  GAATTTGAATACTTTTAAAGTGTTCTAG
                                  AAACTGTCATCCGTGGGTGGAATTTGT
                                  TTGGCATTAGGTTGTCAGRCAGAGGATG
                                  CCTATMCTTTACTGTGAAAAAATCAGTG            Didymosphenia
                                  CGTTCAAAGCAGACTTACGTCGATGAA             geminata (Lyngbye)
                                  TGTATTAGCATGGAA
                                  TGTATTAG
                                    TATTAG
                                    TATT
                                      TT                                  Schmidt 1899




                               Rock Snot
                                                                              D. geminata
                                    didymo           Didymosphenia
                                                     geminata (Lyngbye)
                                                                          Didymosphenia
                                                                          geminata




                    Courtesy of
                    ‘Linking Global Names and Pro-iBiosphere’, 2013, D. J. Patterson
SEVENTH FRAMEWORK
    PROGRAMME                                                                                                             -infrastructure
ViBRANT
                                                                                   Virtual Biodiversity



                                                             4. A list of taxon names
Names as strings of characters

Actinobacillus actimomycetemcomitans     Difficulties with Latinized Names
Actinobacillus actimycetemcomitans
Actinobacillus actinmycetemcomitans      Transcription errors
Actinobacillus actinomicetemcomitans
Actinobacillus actinomy
Actinobacillus actinomyce                Actinobacillus actinomycetemcommitans
Actinobacillus actinomycemcomitans       Actinobacillus actinomycetemocimitans
Actinobacillus actinomyceremcomitans     Actinobacillus actinomycetencomitans
Actinobacillus actinomycetam             Actinobacillus actinomycetum
Actinobacillus actinomycetamcomitans     Actinobacillus actinomyctemcomitans
Actinobacillus actinomycetecomitans      Actinobacillus actinomyectomcomitans
Actinobacillus actinomycetemcmitans      Actinobacillus actinomyetemcomitans
Actinobacillus actinomycetemcomintans    Actinobacillus actinonmycetemcomitans
Actinobacillus actinomycetemcomitance    Actinobacillus actionomycetemcomitans
Actinobacillus actinomycetemcomitans     Actinobacillus actynomicetemcomitans
Actinobacillus actinomycetemcomitants    Actinobacillus antinomycetemcomitans

Nomenclator provides correct spelling.   Indexing infrastructure resolves to it.

                                                         Courtesy of Dave Remsen, GBIF
SEVENTH FRAMEWORK
    PROGRAMME                                                                      -infrastructure
ViBRANT
                                                                                                                Virtual Biodiversity
Names as strings of characters

                                                                      4. A list of taxon names
Actinobacillus actimomycetemcomitans     Difficulties with Latinized Names
Actinobacillus actimycetemcomitans
Actinobacillus actinmycetemcomitans      Transcription errors
Actinobacillus actinomicetemcomitans
Actinobacillus actinomy
Actinobacillus actinomyce                Actinobacillus actinomycetemcommitans
Actinobacillus actinomycemcomitans       Actinobacillus actinomycetemocimitans
Actinobacillus actinomyceremcomitans     Actinobacillus actinomycetencomitans

                                                                                    5. Persistent
Actinobacillus actinomycetam             Actinobacillus actinomycetum
Actinobacillus actinomycetamcomitans     Actinobacillus actinomyctemcomitans
Actinobacillus actinomycetecomitans      Actinobacillus actinomyectomcomitans
Actinobacillus actinomycetemcmitans
Actinobacillus actinomycetemcomintans
                                         Actinobacillus actinomyetemcomitans
                                         Actinobacillus actinonmycetemcomitans         Identifiers
Actinobacillus actinomycetemcomitance    Actinobacillus actionomycetemcomitans
Actinobacillus actinomycetemcomitans     Actinobacillus actynomicetemcomitans
Actinobacillus actinomycetemcomitants    Actinobacillus antinomycetemcomitans

Nomenclator provides correct spelling.   Indexing infrastructure resolves to it.

                                                                                   DOI: 10.4289/0013-8797.115.1.75




SEVENTH FRAMEWORK
    PROGRAMME                                                                                                   -infrastructure
ViBRANT
                                                                                                                Virtual Biodiversity
Names as strings of characters

                                                                      4. A list of taxon names
Actinobacillus actimomycetemcomitans     Difficulties with Latinized Names
Actinobacillus actimycetemcomitans
Actinobacillus actinmycetemcomitans      Transcription errors
Actinobacillus actinomicetemcomitans
Actinobacillus actinomy
Actinobacillus actinomyce                Actinobacillus actinomycetemcommitans
Actinobacillus actinomycemcomitans       Actinobacillus actinomycetemocimitans
Actinobacillus actinomyceremcomitans     Actinobacillus actinomycetencomitans

                                                                                    5. Persistent
Actinobacillus actinomycetam             Actinobacillus actinomycetum
Actinobacillus actinomycetamcomitans     Actinobacillus actinomyctemcomitans
Actinobacillus actinomycetecomitans      Actinobacillus actinomyectomcomitans
Actinobacillus actinomycetemcmitans
Actinobacillus actinomycetemcomintans
                                         Actinobacillus actinomyetemcomitans
                                         Actinobacillus actinonmycetemcomitans         Identifiers
Actinobacillus actinomycetemcomitance    Actinobacillus actionomycetemcomitans
Actinobacillus actinomycetemcomitans     Actinobacillus actynomicetemcomitans
Actinobacillus actinomycetemcomitants    Actinobacillus antinomycetemcomitans

Nomenclator provides correct spelling.   Indexing infrastructure resolves to it.

                                                                                   DOI: 10.4289/0013-8797.115.1.75
                               6. Author
                                  identifiers




SEVENTH FRAMEWORK
    PROGRAMME                                                                                                   -infrastructure
ViBRANT
                                           Virtual Biodiversity




                    7. 3rd party authentication




SEVENTH FRAMEWORK
    PROGRAMME                              -infrastructure
ViBRANT
                                                                                                Virtual Biodiversity



                              Atopobium minutum            8. Classification Bank
                                    Sphaerobacter
                                    thermophilus
                     strain TH3
                                                         Actinomycetes: the antibiotic factories
                                    Bifidobacteriaceae


                                Actinomycetaceae

                              Arthrobacteriaceae,
                              Cellomonadaceae,
                              Microbacteriaceae,
                              Dermatophilaceae
 Insertion element            and realtives
 in 23S rRNA               Propionibacteriaceae


                     Nocardioidaceae


                      Frankiaceae


                       Corynebacteriaceae,
                       Mycobacteriaceae,
                       Nocardiaceae
                       and realtives

                      Actinoplanaceae



                      Pseudonocardiaceae


                      Streptomycetaceae,
                      Streptosporangiaceae
                      and relatives


    Embley & Stackebrandt (1994)                                Bregey’s Manual, 2nd Edition (2012)



SEVENTH FRAMEWORK
    PROGRAMME                                                                                    -infrastructure
ViBRANT
                                                                                                                                                                               Virtual Biodiversity


 9. Accepted names
                                                                                                                                                        Dynamic     Annual
                                                                                                                                               Home      Edition   Checklist




                                                       Welcome to the Catalogue of Life website: gateway to our
          Overview                                     database of the world's known species of animals, plants, fungi
            About the Catalogue of Life                and micro-organisms
            Contributors & partners
            Contact us
                                                                                                                                                                                I . P . N . I
          User Guide
                                                       Explore                                                    »
            Getting started
            Versions of the Catalogue
            Contributing your data
                                                       This Dynamic Edition is a constantly evolving version of the Catalogue of
                                                       Life.
            Glossary                                                                                                                       'The most comprehensive and
                                                                  Now tracking 70% of species known to science                             authoritative global index of
          Additional Services                                                                                                              species currently available, the
            Downloads
            Advanced services
                                                                      1,315,754 species                                                    Catalogue of Life consists of a
                                                                                                                                           single integrated checklist and
                                                                                                                                           taxonomic hierarchy for all the
         Latest on Twitter                                                                                                                 world's species.'
                   Catalogue of Life
                   catalogueoflife

         catalogueoflife Catalogue of Life,            Annual Checklist       »
         11th March 2013 is now online at
         catalogueoflife.org/col
         6 days ago · reply · retweet · favorite       The Annual Checklist is a snapshot of the entire
                                                       Catalogue of Life: a fixed imprint.
         catalogueoflife Catalogue of Life,
         08th February 2013 is now online at
         catalogueoflife.org/col                                                         Why two versions?
         37 days ago· reply · retweet · favorite


                               Join the conversation



        © 2013, Species 2000 at University of Reading | Disclaimer                       Design: Chris Turnbull   |   Content: Simon Thornton-Wood




SEVENTH FRAMEWORK
    PROGRAMME                                                                                                                                                                  -infrastructure
ViBRANT
                                                                      Virtual Biodiversity


       10. Tools to make LOD

    Humans are good at interpreting this:
            Implicit semantics
                                                  o
                    “Compound 2a melted at 119 C”

    Machines need this:
            Explicit semantics       CML Schema
             <cml:molecule ref=“2a”>
               <cml:property>        Molecules in CML/InChl
                <cml:scalar dictRef=“prop:mpt”
                   units=“units:celsius”         propertyDictionary
                   dataType=“xds:float”        unitsDictionary
                >119</cml:scalar>
               </cml:property>         W3CSchema
             </cml:molecule>

               4 namespaces, 3 dictionaries




SEVENTH FRAMEWORK
    PROGRAMME                                                         -infrastructure
ViBRANT
                                                                            Virtual Biodiversity




                    Most textbooks will tell you that, in 1610,
                    Galileo Galilei became the first person to
                    observe Saturn's rings.


                    But what did he really see?




                     GBIF/GBIC – 2-4 Jul 2012 – Copenhagen, © 2012, R. J. Robbins
SEVENTH FRAMEWORK
    PROGRAMME                                                               -infrastructure
ViBRANT
                                                                           Virtual Biodiversity




       This?




                    GBIF/GBIC – 2-4 Jul 2012 – Copenhagen, © 2012, R. J. Robbins
SEVENTH FRAMEWORK
    PROGRAMME                                                              -infrastructure
ViBRANT
                                                                           Virtual Biodiversity




       Or this?




                    GBIF/GBIC – 2-4 Jul 2012 – Copenhagen, © 2012, R. J. Robbins
SEVENTH FRAMEWORK
    PROGRAMME                                                              -infrastructure
ViBRANT
                                                                            Virtual Biodiversity




The generation of
important new
insights while
handicapped with
limited technology,
indirect
measurement, and
fuzzy data is the
mark of scientific
greatness.




                     GBIF/GBIC – 2-4 Jul 2012 – Copenhagen, © 2012, R. J. Robbins
 SEVENTH FRAMEWORK
     PROGRAMME                                                              -infrastructure
ViBRANT
                                                       Virtual Biodiversity



      11. Data fit for purpose
                                 Data are received at face-value,
                                 examined and tested. If the
                                 user is satisfied, then the data
                                 will be applied.




SEVENTH FRAMEWORK
    PROGRAMME                                           -infrastructure
ViBRANT
                                                                                             Virtual Biodiversity



  12. Observational data infrastructure
                                                                    http://www.earthobservations.org/geobon.shtml



                                                                                          http://www.eubon.eu




                                                                                      http://www.teamnetwork.org


                                                                                      http://mooreabiocode.org/


                                                    Moorea Biocode Project


                         http://www.ilternet.edu
http://www.neoninc.org                             Agriculture    Climate  Forest   Invasion  Urban
                                                    Systems       Change Management Biology Ecosystems




SEVENTH FRAMEWORK
    PROGRAMME                                                                                -infrastructure
ViBRANT
                                                                                    Virtual Biodiversity




                               To build user confidence

                    Thus far, all projects share a common problem of keeping services
                    running after project funding ended
                    New models are needed
                       To create translational pipelines to industry adoption
                       To encourage institutional adoption for care and maintenance
                       For recognition of contribution other than through publication of
                       academic papers
                    Stronger marketing and outreach
                       Invest more in up-skilling and hand-holding




SEVENTH FRAMEWORK
    PROGRAMME                                                                       -infrastructure
ViBRANT
                                                                                     Virtual Biodiversity




                        Integrative flexible e-Science environments
                    Using standardised building blocks and workflows
                       Interoperable components
                       With access to data from multiple sources
                    Recognise different kinds of VRE
                       General-purpose / specialised / single scientific objective
                       - cf. chemistry laboratory vs forensics lab vs HIV vaccine lab
                       - BioVeL / AquaMaps and iMarine / CarbonWaterCloud
                    Must generate immediate benefit for users
                       Science driven, with scientists as active participants in creation of
                       infrastructure
                       Functions people find useful: simple and intuitive
                       Technology invisible (disappears into background)


SEVENTH FRAMEWORK
    PROGRAMME                                                                        -infrastructure
ViBRANT
                                                                                                       Virtual Biodiversity



                       Predictive models across multiple scales
                    A new framework of methods, techniques, standards to bring about
                    interoperability of data and models across different biological scales
                       From Genetic through species and ecosystem to landscape
                       Learn from Virtual Physiological Human and from Numerical weather
                       prediction and climatology Edwards (2010). A Vast Machine
                       “General Ecological Models” Purves et al. (2013). doi:10.1038/493295a
                    Evolvable to incorporate new scientific insights
                       Re-analysis models
                    Making data we have global
                       Implies ‘inversion’ of existing infrastructure


             ‘inversion’ of existing infrastructure is about re-examining every element of data we have to
             re-construct the past biodiversity, as a guide and calibrator of models that can predict the future



SEVENTH FRAMEWORK
    PROGRAMME                                                                                          -infrastructure
ViBRANT
                                                                                                 Virtual Biodiversity

Section 1: The fundamental backbone (getting the basics right)
 1.   Why are names important?                               9.    How to balance professional and non-professional
 2.   How are names organised?                                     contributions
 3.   Which is the right name?                               10.   Engagement of users
 4.   What is the name of that organism?                     11.   Who's who?
 5.   Can biodiversity studies be done without names?        12.   User identification
 6.   Biodiversity data beyond names                         13.   How do we ensure the right metadata are created
 7.   To link resources we need identifiers                        at the point of data generation?
 8.   Centralised or networked services?                     14.   Sustaining the physical infrastructure
Section 2: The next steps
15.   Data Sharing                                           19. Beyond Sharing and Re-use: the problem of scale
16.   Why do we need vocabularies and ontologies?            20. How reliable are the data?
17.   How would Knowledge Organising Systems help?           21. What will the physical infrastructure look like?
18.   How easy is it to integrate data?
Section 3: New tools
22.   How much of the legacy collections can be digitised?   27. How do you aggregate the data you need?
23.   How to generate more targeted and reliable data?       28. How complete are the data?
24.   What role do mobile devices play?                      29. How can we encourage virtual research
25.   How do you find the data you need?                         environments?
26.   How do you extract the data you need?                  30. What can you do with your data in the future?
Section 4: The human interface
31. How can we give users confidence?
32. Who owns what?
33. What benefits come to contributors?


 SEVENTH FRAMEWORK
     PROGRAMME                                                                                   -infrastructure
ViBRANT
                                                        Virtual Biodiversity



         Thank you for your attention.
         Any questions
Alex Hardisty <hardistyAR@cardiff.ac.uk>
Dave Roberts <dmr@nomencurator.org>

 Hardisty et al. (2013) A decadal view of
 biodiversity informatics: challenges and priorities.
 BMC Ecology (in press)

http://www.biovel.eu                        http://vbrant.eu
SEVENTH FRAMEWORK
    PROGRAMME                                           -infrastructure

More Related Content

Similar to Hardistyroberts190313opt 130319072407-phpapp02

Hardisty roberts tdwg_301013_min
Hardisty roberts tdwg_301013_minHardisty roberts tdwg_301013_min
Hardisty roberts tdwg_301013_min
vibrantmanager
 
ViBRANT Overview
ViBRANT OverviewViBRANT Overview
ViBRANT OverviewEdward Baker
 
WP3 Overview (Training and Sociology)
WP3 Overview (Training and Sociology)WP3 Overview (Training and Sociology)
WP3 Overview (Training and Sociology)vbrant
 
Perspectives on Collaborative Research Environments offered by D4Science
Perspectives on Collaborative Research Environments offered by D4SciencePerspectives on Collaborative Research Environments offered by D4Science
Perspectives on Collaborative Research Environments offered by D4Science
FAO
 
Scratchpads Intro: Swiss Orchid Foundation
Scratchpads Intro: Swiss Orchid FoundationScratchpads Intro: Swiss Orchid Foundation
Scratchpads Intro: Swiss Orchid FoundationEdward Baker
 
XldbEuropeEdinburgh-09-jun2011
XldbEuropeEdinburgh-09-jun2011XldbEuropeEdinburgh-09-jun2011
XldbEuropeEdinburgh-09-jun2011
Alex Hardisty
 
Swiss Orchid Foundation Scratchpads and ViBRANT overview
Swiss Orchid Foundation Scratchpads and ViBRANT overviewSwiss Orchid Foundation Scratchpads and ViBRANT overview
Swiss Orchid Foundation Scratchpads and ViBRANT overviewEdward Baker
 
Presentatie Big Data Forum 22 januari 2013 - Big Data en Big Society
Presentatie Big Data Forum 22 januari 2013 - Big Data en Big SocietyPresentatie Big Data Forum 22 januari 2013 - Big Data en Big Society
Presentatie Big Data Forum 22 januari 2013 - Big Data en Big Society
SURFnet
 
Chavan Finland 13082009
Chavan Finland 13082009Chavan Finland 13082009
Chavan Finland 13082009
Vishwas Chavan
 
Bio Chip Project Report
Bio Chip Project ReportBio Chip Project Report
Bio Chip Project Report
piyu k
 
Friend p4c 2012-11-29
Friend p4c 2012-11-29Friend p4c 2012-11-29
Friend p4c 2012-11-29
Sage Base
 
Using e-Infrastructures for Biodiversity Conservation
Using e-Infrastructures for Biodiversity ConservationUsing e-Infrastructures for Biodiversity Conservation
Using e-Infrastructures for Biodiversity Conservation
Blue BRIDGE
 
GBIF registry (GBRDS), at European Nodes meeting in Alicante, Spain (10 March...
GBIF registry (GBRDS), at European Nodes meeting in Alicante, Spain (10 March...GBIF registry (GBRDS), at European Nodes meeting in Alicante, Spain (10 March...
GBIF registry (GBRDS), at European Nodes meeting in Alicante, Spain (10 March...
Dag Endresen
 
Data hosting infrastructure for primary biodiversity data
Data hosting infrastructure for primary biodiversity dataData hosting infrastructure for primary biodiversity data
Data hosting infrastructure for primary biodiversity data
Phil Cryer
 
Nomadeyes Brochure01 31oct08
Nomadeyes Brochure01 31oct08Nomadeyes Brochure01 31oct08
Nomadeyes Brochure01 31oct08
martindudziak
 
10th e concertation-brussels-06march2013-v2
10th e concertation-brussels-06march2013-v210th e concertation-brussels-06march2013-v2
10th e concertation-brussels-06march2013-v2Alex Hardisty
 
14A81A05A3
14A81A05A314A81A05A3
14A81A05A3
Chaitanya Ram
 
Smarter Computing Big Data
Smarter Computing Big DataSmarter Computing Big Data
Smarter Computing Big Data
Strategy Advisory Group
 
Emilie Robert Observatory of free healthcare in Mali 2012
Emilie Robert Observatory of free healthcare in Mali 2012Emilie Robert Observatory of free healthcare in Mali 2012
Emilie Robert Observatory of free healthcare in Mali 2012
Emilie Robert
 

Similar to Hardistyroberts190313opt 130319072407-phpapp02 (20)

Hardisty roberts tdwg_301013_min
Hardisty roberts tdwg_301013_minHardisty roberts tdwg_301013_min
Hardisty roberts tdwg_301013_min
 
ViBRANT Overview
ViBRANT OverviewViBRANT Overview
ViBRANT Overview
 
WP3 Overview (Training and Sociology)
WP3 Overview (Training and Sociology)WP3 Overview (Training and Sociology)
WP3 Overview (Training and Sociology)
 
Perspectives on Collaborative Research Environments offered by D4Science
Perspectives on Collaborative Research Environments offered by D4SciencePerspectives on Collaborative Research Environments offered by D4Science
Perspectives on Collaborative Research Environments offered by D4Science
 
Scratchpads Intro: Swiss Orchid Foundation
Scratchpads Intro: Swiss Orchid FoundationScratchpads Intro: Swiss Orchid Foundation
Scratchpads Intro: Swiss Orchid Foundation
 
XldbEuropeEdinburgh-09-jun2011
XldbEuropeEdinburgh-09-jun2011XldbEuropeEdinburgh-09-jun2011
XldbEuropeEdinburgh-09-jun2011
 
Swiss Orchid Foundation Scratchpads and ViBRANT overview
Swiss Orchid Foundation Scratchpads and ViBRANT overviewSwiss Orchid Foundation Scratchpads and ViBRANT overview
Swiss Orchid Foundation Scratchpads and ViBRANT overview
 
Presentatie Big Data Forum 22 januari 2013 - Big Data en Big Society
Presentatie Big Data Forum 22 januari 2013 - Big Data en Big SocietyPresentatie Big Data Forum 22 januari 2013 - Big Data en Big Society
Presentatie Big Data Forum 22 januari 2013 - Big Data en Big Society
 
Chavan Finland 13082009
Chavan Finland 13082009Chavan Finland 13082009
Chavan Finland 13082009
 
Collaborative System
Collaborative SystemCollaborative System
Collaborative System
 
Bio Chip Project Report
Bio Chip Project ReportBio Chip Project Report
Bio Chip Project Report
 
Friend p4c 2012-11-29
Friend p4c 2012-11-29Friend p4c 2012-11-29
Friend p4c 2012-11-29
 
Using e-Infrastructures for Biodiversity Conservation
Using e-Infrastructures for Biodiversity ConservationUsing e-Infrastructures for Biodiversity Conservation
Using e-Infrastructures for Biodiversity Conservation
 
GBIF registry (GBRDS), at European Nodes meeting in Alicante, Spain (10 March...
GBIF registry (GBRDS), at European Nodes meeting in Alicante, Spain (10 March...GBIF registry (GBRDS), at European Nodes meeting in Alicante, Spain (10 March...
GBIF registry (GBRDS), at European Nodes meeting in Alicante, Spain (10 March...
 
Data hosting infrastructure for primary biodiversity data
Data hosting infrastructure for primary biodiversity dataData hosting infrastructure for primary biodiversity data
Data hosting infrastructure for primary biodiversity data
 
Nomadeyes Brochure01 31oct08
Nomadeyes Brochure01 31oct08Nomadeyes Brochure01 31oct08
Nomadeyes Brochure01 31oct08
 
10th e concertation-brussels-06march2013-v2
10th e concertation-brussels-06march2013-v210th e concertation-brussels-06march2013-v2
10th e concertation-brussels-06march2013-v2
 
14A81A05A3
14A81A05A314A81A05A3
14A81A05A3
 
Smarter Computing Big Data
Smarter Computing Big DataSmarter Computing Big Data
Smarter Computing Big Data
 
Emilie Robert Observatory of free healthcare in Mali 2012
Emilie Robert Observatory of free healthcare in Mali 2012Emilie Robert Observatory of free healthcare in Mali 2012
Emilie Robert Observatory of free healthcare in Mali 2012
 

More from Alex Hardisty

openDS - A new standard for digital specimens
openDS - A new standard for digital specimensopenDS - A new standard for digital specimens
openDS - A new standard for digital specimens
Alex Hardisty
 
Global Research Infrastructures for Biodiversity and Ecosystems Research
Global Research Infrastructures for Biodiversity and Ecosystems ResearchGlobal Research Infrastructures for Biodiversity and Ecosystems Research
Global Research Infrastructures for Biodiversity and Ecosystems Research
Alex Hardisty
 
Approach and outcome of the Biodiversity Virtual e-Laboratory (BioVeL) project
Approach and outcome of the Biodiversity Virtual e-Laboratory (BioVeL) projectApproach and outcome of the Biodiversity Virtual e-Laboratory (BioVeL) project
Approach and outcome of the Biodiversity Virtual e-Laboratory (BioVeL) project
Alex Hardisty
 
Data accessibility and the role of informatics in predicting the biosphere
Data accessibility and the role of informatics in predicting the biosphereData accessibility and the role of informatics in predicting the biosphere
Data accessibility and the role of informatics in predicting the biosphere
Alex Hardisty
 
Constructing bottomup
Constructing bottomupConstructing bottomup
Constructing bottomup
Alex Hardisty
 
Mapping Research Infrastructures with the ENVRI Reference Model
Mapping Research Infrastructures with the ENVRI Reference ModelMapping Research Infrastructures with the ENVRI Reference Model
Mapping Research Infrastructures with the ENVRI Reference Model
Alex Hardisty
 
BioVeL at IBERGRID e-Infrastructures and biodiversity workshop, 19th Septembe...
BioVeL at IBERGRID e-Infrastructures and biodiversity workshop, 19th Septembe...BioVeL at IBERGRID e-Infrastructures and biodiversity workshop, 19th Septembe...
BioVeL at IBERGRID e-Infrastructures and biodiversity workshop, 19th Septembe...
Alex Hardisty
 
Biodiversity Informatics Horizons 2013 - Introduction and Scope
Biodiversity Informatics Horizons 2013 - Introduction and ScopeBiodiversity Informatics Horizons 2013 - Introduction and Scope
Biodiversity Informatics Horizons 2013 - Introduction and Scope
Alex Hardisty
 
Eudat user forum-london-11march2013-biovel-v3
Eudat user forum-london-11march2013-biovel-v3Eudat user forum-london-11march2013-biovel-v3
Eudat user forum-london-11march2013-biovel-v3Alex Hardisty
 
Biodiversity Virtual e-Laboratory (BioVeL)
Biodiversity Virtual e-Laboratory (BioVeL)Biodiversity Virtual e-Laboratory (BioVeL)
Biodiversity Virtual e-Laboratory (BioVeL)
Alex Hardisty
 
E cconcertation lyon-22-sep2011-v3
E cconcertation lyon-22-sep2011-v3E cconcertation lyon-22-sep2011-v3
E cconcertation lyon-22-sep2011-v3
Alex Hardisty
 
AH-XLDBEurope-position-09 jun2011
AH-XLDBEurope-position-09 jun2011AH-XLDBEurope-position-09 jun2011
AH-XLDBEurope-position-09 jun2011
Alex Hardisty
 
TextofKeynote-EGIforum-15-Sep2010
TextofKeynote-EGIforum-15-Sep2010TextofKeynote-EGIforum-15-Sep2010
TextofKeynote-EGIforum-15-Sep2010Alex Hardisty
 
EGIforum-Amsterdam-15-Sep2010
EGIforum-Amsterdam-15-Sep2010EGIforum-Amsterdam-15-Sep2010
EGIforum-Amsterdam-15-Sep2010
Alex Hardisty
 

More from Alex Hardisty (14)

openDS - A new standard for digital specimens
openDS - A new standard for digital specimensopenDS - A new standard for digital specimens
openDS - A new standard for digital specimens
 
Global Research Infrastructures for Biodiversity and Ecosystems Research
Global Research Infrastructures for Biodiversity and Ecosystems ResearchGlobal Research Infrastructures for Biodiversity and Ecosystems Research
Global Research Infrastructures for Biodiversity and Ecosystems Research
 
Approach and outcome of the Biodiversity Virtual e-Laboratory (BioVeL) project
Approach and outcome of the Biodiversity Virtual e-Laboratory (BioVeL) projectApproach and outcome of the Biodiversity Virtual e-Laboratory (BioVeL) project
Approach and outcome of the Biodiversity Virtual e-Laboratory (BioVeL) project
 
Data accessibility and the role of informatics in predicting the biosphere
Data accessibility and the role of informatics in predicting the biosphereData accessibility and the role of informatics in predicting the biosphere
Data accessibility and the role of informatics in predicting the biosphere
 
Constructing bottomup
Constructing bottomupConstructing bottomup
Constructing bottomup
 
Mapping Research Infrastructures with the ENVRI Reference Model
Mapping Research Infrastructures with the ENVRI Reference ModelMapping Research Infrastructures with the ENVRI Reference Model
Mapping Research Infrastructures with the ENVRI Reference Model
 
BioVeL at IBERGRID e-Infrastructures and biodiversity workshop, 19th Septembe...
BioVeL at IBERGRID e-Infrastructures and biodiversity workshop, 19th Septembe...BioVeL at IBERGRID e-Infrastructures and biodiversity workshop, 19th Septembe...
BioVeL at IBERGRID e-Infrastructures and biodiversity workshop, 19th Septembe...
 
Biodiversity Informatics Horizons 2013 - Introduction and Scope
Biodiversity Informatics Horizons 2013 - Introduction and ScopeBiodiversity Informatics Horizons 2013 - Introduction and Scope
Biodiversity Informatics Horizons 2013 - Introduction and Scope
 
Eudat user forum-london-11march2013-biovel-v3
Eudat user forum-london-11march2013-biovel-v3Eudat user forum-london-11march2013-biovel-v3
Eudat user forum-london-11march2013-biovel-v3
 
Biodiversity Virtual e-Laboratory (BioVeL)
Biodiversity Virtual e-Laboratory (BioVeL)Biodiversity Virtual e-Laboratory (BioVeL)
Biodiversity Virtual e-Laboratory (BioVeL)
 
E cconcertation lyon-22-sep2011-v3
E cconcertation lyon-22-sep2011-v3E cconcertation lyon-22-sep2011-v3
E cconcertation lyon-22-sep2011-v3
 
AH-XLDBEurope-position-09 jun2011
AH-XLDBEurope-position-09 jun2011AH-XLDBEurope-position-09 jun2011
AH-XLDBEurope-position-09 jun2011
 
TextofKeynote-EGIforum-15-Sep2010
TextofKeynote-EGIforum-15-Sep2010TextofKeynote-EGIforum-15-Sep2010
TextofKeynote-EGIforum-15-Sep2010
 
EGIforum-Amsterdam-15-Sep2010
EGIforum-Amsterdam-15-Sep2010EGIforum-Amsterdam-15-Sep2010
EGIforum-Amsterdam-15-Sep2010
 

Recently uploaded

Encryption in Microsoft 365 - ExpertsLive Netherlands 2024
Encryption in Microsoft 365 - ExpertsLive Netherlands 2024Encryption in Microsoft 365 - ExpertsLive Netherlands 2024
Encryption in Microsoft 365 - ExpertsLive Netherlands 2024
Albert Hoitingh
 
Assuring Contact Center Experiences for Your Customers With ThousandEyes
Assuring Contact Center Experiences for Your Customers With ThousandEyesAssuring Contact Center Experiences for Your Customers With ThousandEyes
Assuring Contact Center Experiences for Your Customers With ThousandEyes
ThousandEyes
 
How world-class product teams are winning in the AI era by CEO and Founder, P...
How world-class product teams are winning in the AI era by CEO and Founder, P...How world-class product teams are winning in the AI era by CEO and Founder, P...
How world-class product teams are winning in the AI era by CEO and Founder, P...
Product School
 
PCI PIN Basics Webinar from the Controlcase Team
PCI PIN Basics Webinar from the Controlcase TeamPCI PIN Basics Webinar from the Controlcase Team
PCI PIN Basics Webinar from the Controlcase Team
ControlCase
 
GraphRAG is All You need? LLM & Knowledge Graph
GraphRAG is All You need? LLM & Knowledge GraphGraphRAG is All You need? LLM & Knowledge Graph
GraphRAG is All You need? LLM & Knowledge Graph
Guy Korland
 
Generative AI Deep Dive: Advancing from Proof of Concept to Production
Generative AI Deep Dive: Advancing from Proof of Concept to ProductionGenerative AI Deep Dive: Advancing from Proof of Concept to Production
Generative AI Deep Dive: Advancing from Proof of Concept to Production
Aggregage
 
Dev Dives: Train smarter, not harder – active learning and UiPath LLMs for do...
Dev Dives: Train smarter, not harder – active learning and UiPath LLMs for do...Dev Dives: Train smarter, not harder – active learning and UiPath LLMs for do...
Dev Dives: Train smarter, not harder – active learning and UiPath LLMs for do...
UiPathCommunity
 
A tale of scale & speed: How the US Navy is enabling software delivery from l...
A tale of scale & speed: How the US Navy is enabling software delivery from l...A tale of scale & speed: How the US Navy is enabling software delivery from l...
A tale of scale & speed: How the US Navy is enabling software delivery from l...
sonjaschweigert1
 
Le nuove frontiere dell'AI nell'RPA con UiPath Autopilotℱ
Le nuove frontiere dell'AI nell'RPA con UiPath AutopilotℱLe nuove frontiere dell'AI nell'RPA con UiPath Autopilotℱ
Le nuove frontiere dell'AI nell'RPA con UiPath Autopilotℱ
UiPathCommunity
 
Secstrike : Reverse Engineering & Pwnable tools for CTF.pptx
Secstrike : Reverse Engineering & Pwnable tools for CTF.pptxSecstrike : Reverse Engineering & Pwnable tools for CTF.pptx
Secstrike : Reverse Engineering & Pwnable tools for CTF.pptx
nkrafacyberclub
 
Free Complete Python - A step towards Data Science
Free Complete Python - A step towards Data ScienceFree Complete Python - A step towards Data Science
Free Complete Python - A step towards Data Science
RinaMondal9
 
Unsubscribed: Combat Subscription Fatigue With a Membership Mentality by Head...
Unsubscribed: Combat Subscription Fatigue With a Membership Mentality by Head...Unsubscribed: Combat Subscription Fatigue With a Membership Mentality by Head...
Unsubscribed: Combat Subscription Fatigue With a Membership Mentality by Head...
Product School
 
Transcript: Selling digital books in 2024: Insights from industry leaders - T...
Transcript: Selling digital books in 2024: Insights from industry leaders - T...Transcript: Selling digital books in 2024: Insights from industry leaders - T...
Transcript: Selling digital books in 2024: Insights from industry leaders - T...
BookNet Canada
 
Key Trends Shaping the Future of Infrastructure.pdf
Key Trends Shaping the Future of Infrastructure.pdfKey Trends Shaping the Future of Infrastructure.pdf
Key Trends Shaping the Future of Infrastructure.pdf
Cheryl Hung
 
Securing your Kubernetes cluster_ a step-by-step guide to success !
Securing your Kubernetes cluster_ a step-by-step guide to success !Securing your Kubernetes cluster_ a step-by-step guide to success !
Securing your Kubernetes cluster_ a step-by-step guide to success !
KatiaHIMEUR1
 
Monitoring Java Application Security with JDK Tools and JFR Events
Monitoring Java Application Security with JDK Tools and JFR EventsMonitoring Java Application Security with JDK Tools and JFR Events
Monitoring Java Application Security with JDK Tools and JFR Events
Ana-Maria Mihalceanu
 
Empowering NextGen Mobility via Large Action Model Infrastructure (LAMI): pav...
Empowering NextGen Mobility via Large Action Model Infrastructure (LAMI): pav...Empowering NextGen Mobility via Large Action Model Infrastructure (LAMI): pav...
Empowering NextGen Mobility via Large Action Model Infrastructure (LAMI): pav...
Thierry Lestable
 
LF Energy Webinar: Electrical Grid Modelling and Simulation Through PowSyBl -...
LF Energy Webinar: Electrical Grid Modelling and Simulation Through PowSyBl -...LF Energy Webinar: Electrical Grid Modelling and Simulation Through PowSyBl -...
LF Energy Webinar: Electrical Grid Modelling and Simulation Through PowSyBl -...
DanBrown980551
 
The Future of Platform Engineering
The Future of Platform EngineeringThe Future of Platform Engineering
The Future of Platform Engineering
Jemma Hussein Allen
 
GDG Cloud Southlake #33: Boule & Rebala: Effective AppSec in SDLC using Deplo...
GDG Cloud Southlake #33: Boule & Rebala: Effective AppSec in SDLC using Deplo...GDG Cloud Southlake #33: Boule & Rebala: Effective AppSec in SDLC using Deplo...
GDG Cloud Southlake #33: Boule & Rebala: Effective AppSec in SDLC using Deplo...
James Anderson
 

Recently uploaded (20)

Encryption in Microsoft 365 - ExpertsLive Netherlands 2024
Encryption in Microsoft 365 - ExpertsLive Netherlands 2024Encryption in Microsoft 365 - ExpertsLive Netherlands 2024
Encryption in Microsoft 365 - ExpertsLive Netherlands 2024
 
Assuring Contact Center Experiences for Your Customers With ThousandEyes
Assuring Contact Center Experiences for Your Customers With ThousandEyesAssuring Contact Center Experiences for Your Customers With ThousandEyes
Assuring Contact Center Experiences for Your Customers With ThousandEyes
 
How world-class product teams are winning in the AI era by CEO and Founder, P...
How world-class product teams are winning in the AI era by CEO and Founder, P...How world-class product teams are winning in the AI era by CEO and Founder, P...
How world-class product teams are winning in the AI era by CEO and Founder, P...
 
PCI PIN Basics Webinar from the Controlcase Team
PCI PIN Basics Webinar from the Controlcase TeamPCI PIN Basics Webinar from the Controlcase Team
PCI PIN Basics Webinar from the Controlcase Team
 
GraphRAG is All You need? LLM & Knowledge Graph
GraphRAG is All You need? LLM & Knowledge GraphGraphRAG is All You need? LLM & Knowledge Graph
GraphRAG is All You need? LLM & Knowledge Graph
 
Generative AI Deep Dive: Advancing from Proof of Concept to Production
Generative AI Deep Dive: Advancing from Proof of Concept to ProductionGenerative AI Deep Dive: Advancing from Proof of Concept to Production
Generative AI Deep Dive: Advancing from Proof of Concept to Production
 
Dev Dives: Train smarter, not harder – active learning and UiPath LLMs for do...
Dev Dives: Train smarter, not harder – active learning and UiPath LLMs for do...Dev Dives: Train smarter, not harder – active learning and UiPath LLMs for do...
Dev Dives: Train smarter, not harder – active learning and UiPath LLMs for do...
 
A tale of scale & speed: How the US Navy is enabling software delivery from l...
A tale of scale & speed: How the US Navy is enabling software delivery from l...A tale of scale & speed: How the US Navy is enabling software delivery from l...
A tale of scale & speed: How the US Navy is enabling software delivery from l...
 
Le nuove frontiere dell'AI nell'RPA con UiPath Autopilotℱ
Le nuove frontiere dell'AI nell'RPA con UiPath AutopilotℱLe nuove frontiere dell'AI nell'RPA con UiPath Autopilotℱ
Le nuove frontiere dell'AI nell'RPA con UiPath Autopilotℱ
 
Secstrike : Reverse Engineering & Pwnable tools for CTF.pptx
Secstrike : Reverse Engineering & Pwnable tools for CTF.pptxSecstrike : Reverse Engineering & Pwnable tools for CTF.pptx
Secstrike : Reverse Engineering & Pwnable tools for CTF.pptx
 
Free Complete Python - A step towards Data Science
Free Complete Python - A step towards Data ScienceFree Complete Python - A step towards Data Science
Free Complete Python - A step towards Data Science
 
Unsubscribed: Combat Subscription Fatigue With a Membership Mentality by Head...
Unsubscribed: Combat Subscription Fatigue With a Membership Mentality by Head...Unsubscribed: Combat Subscription Fatigue With a Membership Mentality by Head...
Unsubscribed: Combat Subscription Fatigue With a Membership Mentality by Head...
 
Transcript: Selling digital books in 2024: Insights from industry leaders - T...
Transcript: Selling digital books in 2024: Insights from industry leaders - T...Transcript: Selling digital books in 2024: Insights from industry leaders - T...
Transcript: Selling digital books in 2024: Insights from industry leaders - T...
 
Key Trends Shaping the Future of Infrastructure.pdf
Key Trends Shaping the Future of Infrastructure.pdfKey Trends Shaping the Future of Infrastructure.pdf
Key Trends Shaping the Future of Infrastructure.pdf
 
Securing your Kubernetes cluster_ a step-by-step guide to success !
Securing your Kubernetes cluster_ a step-by-step guide to success !Securing your Kubernetes cluster_ a step-by-step guide to success !
Securing your Kubernetes cluster_ a step-by-step guide to success !
 
Monitoring Java Application Security with JDK Tools and JFR Events
Monitoring Java Application Security with JDK Tools and JFR EventsMonitoring Java Application Security with JDK Tools and JFR Events
Monitoring Java Application Security with JDK Tools and JFR Events
 
Empowering NextGen Mobility via Large Action Model Infrastructure (LAMI): pav...
Empowering NextGen Mobility via Large Action Model Infrastructure (LAMI): pav...Empowering NextGen Mobility via Large Action Model Infrastructure (LAMI): pav...
Empowering NextGen Mobility via Large Action Model Infrastructure (LAMI): pav...
 
LF Energy Webinar: Electrical Grid Modelling and Simulation Through PowSyBl -...
LF Energy Webinar: Electrical Grid Modelling and Simulation Through PowSyBl -...LF Energy Webinar: Electrical Grid Modelling and Simulation Through PowSyBl -...
LF Energy Webinar: Electrical Grid Modelling and Simulation Through PowSyBl -...
 
The Future of Platform Engineering
The Future of Platform EngineeringThe Future of Platform Engineering
The Future of Platform Engineering
 
GDG Cloud Southlake #33: Boule & Rebala: Effective AppSec in SDLC using Deplo...
GDG Cloud Southlake #33: Boule & Rebala: Effective AppSec in SDLC using Deplo...GDG Cloud Southlake #33: Boule & Rebala: Effective AppSec in SDLC using Deplo...
GDG Cloud Southlake #33: Boule & Rebala: Effective AppSec in SDLC using Deplo...
 

Hardistyroberts190313opt 130319072407-phpapp02

  • 1. ViBRANT Virtual Biodiversity A decadal view of biodiversity informatics: challenges and priorities Alex Hardisty, Dave Roberts, and the biodiversity informatics community* * 80 people took part in the open debate that led to this paper SEVENTH FRAMEWORK PROGRAMME -infrastructure
  • 2. ViBRANT Virtual Biodiversity A decadal view of biodiversity informatics: challenges and priorities Alex Hardisty, Dave Roberts, and the biodiversity informatics community* “We are drowning in information, while starving for wisdom. The world henceforth will be run by synthesizers, people able to put together the right information at the right time, think critically about it, and make important choices” E. O. Wilson, Harvard * 80 people took part in the open debate that led to this paper SEVENTH FRAMEWORK PROGRAMME -infrastructure
  • 3. ViBRANT Virtual Biodiversity A decadal view of biodiversity informatics: challenges and priorities Alex Hardisty, Dave Roberts, and the biodiversity informatics community* “We are drowning in information, while starving for wisdom. The world henceforth will be run by synthesizers, people able to put together the right information at the right time, think critically about it, and make important choices” E. O. Wilson, Harvard Time to model all life on Earth. Purves et. al. (2013) Nature, 493: 295-297 * 80 people took part in the open debate that led to this paper SEVENTH FRAMEWORK PROGRAMME -infrastructure
  • 4. ViBRANT Virtual Biodiversity A decadal view of biodiversity informatics: challenges and priorities Alex Hardisty, Dave Roberts, and the biodiversity informatics community* The Grand Challenge for Biodiversity Informatics An infrastructure to allow the available data to be brought into a coordinated coupled modelling environment, capable of addressing questions relating to our use of the natural environment, that captures the variety, distinctiveness and complexity of all life on Earth To achieve it we need: To build user confidence Integrative flexible e-Science environments Predictive models across multiple scales, coupled * 80 people took part in the open debate that led to this paper SEVENTH FRAMEWORK PROGRAMME -infrastructure
  • 5. ViBRANT Virtual Biodiversity 1. Open Data should be normal practice; SEVENTH FRAMEWORK PROGRAMME -infrastructure
  • 6. ViBRANT Virtual Biodiversity 1. Open Data should be normal practice; 2. Data encoding should allow analysis across multiple scales; SEVENTH FRAMEWORK PROGRAMME -infrastructure
  • 7. ViBRANT Virtual Biodiversity 1. Open Data should be normal practice; 2. Data encoding should allow analysis across multiple scales; 3. Infrastructure projects should devote significant resources to market the service they develop; SEVENTH FRAMEWORK PROGRAMME -infrastructure
  • 8. ViBRANT Virtual Biodiversity Didimosphenia geminata didymo Echinella geminata AAAAAGCTCGTAGTTGGATTTGTGATG Gomphonema vulgare BrĂ©b. GAATTTGAATACTTTTAAAGTGTTCTAG AAACTGTCATCCGTGGGTGGAATTTGT TTGGCATTAGGTTGTCAGRCAGAGGATG CCTATMCTTTACTGTGAAAAAATCAGTG Didymosphenia CGTTCAAAGCAGACTTACGTCGATGAA geminata (Lyngbye) TGTATTAGCATGGAA TGTATTAG TATTAG TATT TT Schmidt 1899 Rock Snot D. geminata didymo Didymosphenia geminata (Lyngbye) Didymosphenia geminata Courtesy of ‘Linking Global Names and Pro-iBiosphere’, 2013, D. J. Patterson SEVENTH FRAMEWORK PROGRAMME -infrastructure
  • 9. ViBRANT Virtual Biodiversity 4. A list of taxon names Names as strings of characters
 Actinobacillus actimomycetemcomitans Difficulties with Latinized Names Actinobacillus actimycetemcomitans Actinobacillus actinmycetemcomitans Transcription errors Actinobacillus actinomicetemcomitans Actinobacillus actinomy Actinobacillus actinomyce Actinobacillus actinomycetemcommitans Actinobacillus actinomycemcomitans Actinobacillus actinomycetemocimitans Actinobacillus actinomyceremcomitans Actinobacillus actinomycetencomitans Actinobacillus actinomycetam Actinobacillus actinomycetum Actinobacillus actinomycetamcomitans Actinobacillus actinomyctemcomitans Actinobacillus actinomycetecomitans Actinobacillus actinomyectomcomitans Actinobacillus actinomycetemcmitans Actinobacillus actinomyetemcomitans Actinobacillus actinomycetemcomintans Actinobacillus actinonmycetemcomitans Actinobacillus actinomycetemcomitance Actinobacillus actionomycetemcomitans Actinobacillus actinomycetemcomitans Actinobacillus actynomicetemcomitans Actinobacillus actinomycetemcomitants Actinobacillus antinomycetemcomitans Nomenclator provides correct spelling. Indexing infrastructure resolves to it. Courtesy of Dave Remsen, GBIF SEVENTH FRAMEWORK PROGRAMME -infrastructure
  • 10. ViBRANT Virtual Biodiversity Names as strings of characters
 4. A list of taxon names Actinobacillus actimomycetemcomitans Difficulties with Latinized Names Actinobacillus actimycetemcomitans Actinobacillus actinmycetemcomitans Transcription errors Actinobacillus actinomicetemcomitans Actinobacillus actinomy Actinobacillus actinomyce Actinobacillus actinomycetemcommitans Actinobacillus actinomycemcomitans Actinobacillus actinomycetemocimitans Actinobacillus actinomyceremcomitans Actinobacillus actinomycetencomitans 5. Persistent Actinobacillus actinomycetam Actinobacillus actinomycetum Actinobacillus actinomycetamcomitans Actinobacillus actinomyctemcomitans Actinobacillus actinomycetecomitans Actinobacillus actinomyectomcomitans Actinobacillus actinomycetemcmitans Actinobacillus actinomycetemcomintans Actinobacillus actinomyetemcomitans Actinobacillus actinonmycetemcomitans Identifiers Actinobacillus actinomycetemcomitance Actinobacillus actionomycetemcomitans Actinobacillus actinomycetemcomitans Actinobacillus actynomicetemcomitans Actinobacillus actinomycetemcomitants Actinobacillus antinomycetemcomitans Nomenclator provides correct spelling. Indexing infrastructure resolves to it. DOI: 10.4289/0013-8797.115.1.75 SEVENTH FRAMEWORK PROGRAMME -infrastructure
  • 11. ViBRANT Virtual Biodiversity Names as strings of characters
 4. A list of taxon names Actinobacillus actimomycetemcomitans Difficulties with Latinized Names Actinobacillus actimycetemcomitans Actinobacillus actinmycetemcomitans Transcription errors Actinobacillus actinomicetemcomitans Actinobacillus actinomy Actinobacillus actinomyce Actinobacillus actinomycetemcommitans Actinobacillus actinomycemcomitans Actinobacillus actinomycetemocimitans Actinobacillus actinomyceremcomitans Actinobacillus actinomycetencomitans 5. Persistent Actinobacillus actinomycetam Actinobacillus actinomycetum Actinobacillus actinomycetamcomitans Actinobacillus actinomyctemcomitans Actinobacillus actinomycetecomitans Actinobacillus actinomyectomcomitans Actinobacillus actinomycetemcmitans Actinobacillus actinomycetemcomintans Actinobacillus actinomyetemcomitans Actinobacillus actinonmycetemcomitans Identifiers Actinobacillus actinomycetemcomitance Actinobacillus actionomycetemcomitans Actinobacillus actinomycetemcomitans Actinobacillus actynomicetemcomitans Actinobacillus actinomycetemcomitants Actinobacillus antinomycetemcomitans Nomenclator provides correct spelling. Indexing infrastructure resolves to it. DOI: 10.4289/0013-8797.115.1.75 6. Author identifiers SEVENTH FRAMEWORK PROGRAMME -infrastructure
  • 12. ViBRANT Virtual Biodiversity 7. 3rd party authentication SEVENTH FRAMEWORK PROGRAMME -infrastructure
  • 13. ViBRANT Virtual Biodiversity Atopobium minutum 8. Classification Bank Sphaerobacter thermophilus strain TH3 Actinomycetes: the antibiotic factories Bifidobacteriaceae Actinomycetaceae Arthrobacteriaceae, Cellomonadaceae, Microbacteriaceae, Dermatophilaceae Insertion element and realtives in 23S rRNA Propionibacteriaceae Nocardioidaceae Frankiaceae Corynebacteriaceae, Mycobacteriaceae, Nocardiaceae and realtives Actinoplanaceae Pseudonocardiaceae Streptomycetaceae, Streptosporangiaceae and relatives Embley & Stackebrandt (1994) Bregey’s Manual, 2nd Edition (2012) SEVENTH FRAMEWORK PROGRAMME -infrastructure
  • 14. ViBRANT Virtual Biodiversity 9. Accepted names Dynamic Annual Home Edition Checklist Welcome to the Catalogue of Life website: gateway to our Overview database of the world's known species of animals, plants, fungi About the Catalogue of Life and micro-organisms Contributors & partners Contact us I . P . N . I User Guide Explore » Getting started Versions of the Catalogue Contributing your data This Dynamic Edition is a constantly evolving version of the Catalogue of Life. Glossary 'The most comprehensive and Now tracking 70% of species known to science authoritative global index of Additional Services species currently available, the Downloads Advanced services 1,315,754 species Catalogue of Life consists of a single integrated checklist and taxonomic hierarchy for all the Latest on Twitter world's species.' Catalogue of Life catalogueoflife catalogueoflife Catalogue of Life, Annual Checklist » 11th March 2013 is now online at catalogueoflife.org/col 6 days ago · reply · retweet · favorite The Annual Checklist is a snapshot of the entire Catalogue of Life: a fixed imprint. catalogueoflife Catalogue of Life, 08th February 2013 is now online at catalogueoflife.org/col Why two versions? 37 days ago· reply · retweet · favorite Join the conversation © 2013, Species 2000 at University of Reading | Disclaimer Design: Chris Turnbull | Content: Simon Thornton-Wood SEVENTH FRAMEWORK PROGRAMME -infrastructure
  • 15. ViBRANT Virtual Biodiversity 10. Tools to make LOD Humans are good at interpreting this: Implicit semantics o “Compound 2a melted at 119 C” Machines need this: Explicit semantics CML Schema <cml:molecule ref=“2a”> <cml:property> Molecules in CML/InChl <cml:scalar dictRef=“prop:mpt” units=“units:celsius” propertyDictionary dataType=“xds:float” unitsDictionary >119</cml:scalar> </cml:property> W3CSchema </cml:molecule> 4 namespaces, 3 dictionaries SEVENTH FRAMEWORK PROGRAMME -infrastructure
  • 16. ViBRANT Virtual Biodiversity Most textbooks will tell you that, in 1610, Galileo Galilei became the first person to observe Saturn's rings. But what did he really see? GBIF/GBIC – 2-4 Jul 2012 – Copenhagen, © 2012, R. J. Robbins SEVENTH FRAMEWORK PROGRAMME -infrastructure
  • 17. ViBRANT Virtual Biodiversity This? GBIF/GBIC – 2-4 Jul 2012 – Copenhagen, © 2012, R. J. Robbins SEVENTH FRAMEWORK PROGRAMME -infrastructure
  • 18. ViBRANT Virtual Biodiversity Or this? GBIF/GBIC – 2-4 Jul 2012 – Copenhagen, © 2012, R. J. Robbins SEVENTH FRAMEWORK PROGRAMME -infrastructure
  • 19. ViBRANT Virtual Biodiversity The generation of important new insights while handicapped with limited technology, indirect measurement, and fuzzy data is the mark of scientific greatness. GBIF/GBIC – 2-4 Jul 2012 – Copenhagen, © 2012, R. J. Robbins SEVENTH FRAMEWORK PROGRAMME -infrastructure
  • 20. ViBRANT Virtual Biodiversity 11. Data fit for purpose Data are received at face-value, examined and tested. If the user is satisfied, then the data will be applied. SEVENTH FRAMEWORK PROGRAMME -infrastructure
  • 21. ViBRANT Virtual Biodiversity 12. Observational data infrastructure http://www.earthobservations.org/geobon.shtml http://www.eubon.eu http://www.teamnetwork.org http://mooreabiocode.org/ Moorea Biocode Project http://www.ilternet.edu http://www.neoninc.org Agriculture Climate Forest Invasion Urban Systems Change Management Biology Ecosystems SEVENTH FRAMEWORK PROGRAMME -infrastructure
  • 22. ViBRANT Virtual Biodiversity To build user confidence Thus far, all projects share a common problem of keeping services running after project funding ended New models are needed To create translational pipelines to industry adoption To encourage institutional adoption for care and maintenance For recognition of contribution other than through publication of academic papers Stronger marketing and outreach Invest more in up-skilling and hand-holding SEVENTH FRAMEWORK PROGRAMME -infrastructure
  • 23. ViBRANT Virtual Biodiversity Integrative flexible e-Science environments Using standardised building blocks and workflows Interoperable components With access to data from multiple sources Recognise different kinds of VRE General-purpose / specialised / single scientific objective - cf. chemistry laboratory vs forensics lab vs HIV vaccine lab - BioVeL / AquaMaps and iMarine / CarbonWaterCloud Must generate immediate benefit for users Science driven, with scientists as active participants in creation of infrastructure Functions people find useful: simple and intuitive Technology invisible (disappears into background) SEVENTH FRAMEWORK PROGRAMME -infrastructure
  • 24. ViBRANT Virtual Biodiversity Predictive models across multiple scales A new framework of methods, techniques, standards to bring about interoperability of data and models across different biological scales From Genetic through species and ecosystem to landscape Learn from Virtual Physiological Human and from Numerical weather prediction and climatology Edwards (2010). A Vast Machine “General Ecological Models” Purves et al. (2013). doi:10.1038/493295a Evolvable to incorporate new scientific insights Re-analysis models Making data we have global Implies ‘inversion’ of existing infrastructure ‘inversion’ of existing infrastructure is about re-examining every element of data we have to re-construct the past biodiversity, as a guide and calibrator of models that can predict the future SEVENTH FRAMEWORK PROGRAMME -infrastructure
  • 25. ViBRANT Virtual Biodiversity Section 1: The fundamental backbone (getting the basics right) 1. Why are names important? 9. How to balance professional and non-professional 2. How are names organised? contributions 3. Which is the right name? 10. Engagement of users 4. What is the name of that organism? 11. Who's who? 5. Can biodiversity studies be done without names? 12. User identification 6. Biodiversity data beyond names 13. How do we ensure the right metadata are created 7. To link resources we need identifiers at the point of data generation? 8. Centralised or networked services? 14. Sustaining the physical infrastructure Section 2: The next steps 15. Data Sharing 19. Beyond Sharing and Re-use: the problem of scale 16. Why do we need vocabularies and ontologies? 20. How reliable are the data? 17. How would Knowledge Organising Systems help? 21. What will the physical infrastructure look like? 18. How easy is it to integrate data? Section 3: New tools 22. How much of the legacy collections can be digitised? 27. How do you aggregate the data you need? 23. How to generate more targeted and reliable data? 28. How complete are the data? 24. What role do mobile devices play? 29. How can we encourage virtual research 25. How do you find the data you need? environments? 26. How do you extract the data you need? 30. What can you do with your data in the future? Section 4: The human interface 31. How can we give users confidence? 32. Who owns what? 33. What benefits come to contributors? SEVENTH FRAMEWORK PROGRAMME -infrastructure
  • 26. ViBRANT Virtual Biodiversity Thank you for your attention. Any questions Alex Hardisty <hardistyAR@cardiff.ac.uk> Dave Roberts <dmr@nomencurator.org> Hardisty et al. (2013) A decadal view of biodiversity informatics: challenges and priorities. BMC Ecology (in press) http://www.biovel.eu http://vbrant.eu SEVENTH FRAMEWORK PROGRAMME -infrastructure