SlideShare a Scribd company logo
1 of 35
© The Children's Mercy Hospital, 2014. 11/14
Center for Genomic MedicineCenter for Genomic Medicine
Joshua E. Petrikin, MDJoshua E. Petrikin, MD
Director of Neonatal GenomicsDirector of Neonatal Genomics
Genomic Medicine in the NICUGenomic Medicine in the NICU
© The Children's Mercy Hospital, 2014. 03/14
2
© The Children's Mercy Hospital, 2014. 11/14
DisclosuresDisclosures
• I have no conflicts of interest to
disclose
• I will not be discussing off label
medication uses
© The Children's Mercy Hospital, 2014. 03/14
3
© The Children's Mercy Hospital, 2014. 11/14
OverviewOverview
• Discuss past and current genetic
testing
• Define Genomic Medicine
• Speculate on future directions for
genomics
• Elucidate some ethical considerations
in Neonatal genomic testing
© The Children's Mercy Hospital, 2014. 03/14
4
© The Children's Mercy Hospital, 2014. 11/14
Genetic TestingGenetic Testing
• The analysis of human DNA, RNA,
chromosomes, proteins, and certain
metabolites in order to detect heritable
disease-related genotypes, mutations,
phenotypes or karyotypes for clinical
purposes.
• Prenatal, newborn, and carrier screening
included.
© The Children's Mercy Hospital, 2014. 03/14
5
© The Children's Mercy Hospital, 2014. 11/14
http://www.indiana.edu/~oso/lessons/Genetics/MyFamily2.html
© The Children's Mercy Hospital, 2014. 03/14
6
© The Children's Mercy Hospital, 2014. 11/14
Genetic Testing:Genetic Testing:
Chromosome KaryotypeChromosome Karyotype
© The Children's Mercy Hospital, 2014. 03/14
7
© The Children's Mercy Hospital, 2014. 11/14
ExampleExample
Patient #1 is a 10 year old girl with short stature and a broad neckPatient #1 is a 10 year old girl with short stature and a broad neck
© The Children's Mercy Hospital, 2014. 03/14
8
© The Children's Mercy Hospital, 2014. 11/14
Microarrays aka “CHIPS”
• Short oligos are
attached to a solid
support
(microarray).
• Hybridize with
fluorescently
labeled PCR
products
containing SNP of
interest.
• Can analyze many
mutations at once
• Currently > 740k
SNP per chip
© The Children's Mercy Hospital, 2014. 03/14
9
© The Children's Mercy Hospital, 2014. 11/14
Array-CGH
(comparative genomic hybridization)
© The Children's Mercy Hospital, 2014. 03/14
10
© The Children's Mercy Hospital, 2014. 11/14
Deletion on array
Muscular Dystrophy
• Since 65-85% of cases
are due to deletions,
start with deletion
testing.
• The lab we use for
dystrophin deletion
testing uses an “exon
array” with high density
probes spanning entire
dystrophin gene.
• Case 4 patient has a
deletion including
exons 44-48 (not shown
here).
• If no deletion
detectable, sequence
entire DMD gene (79
exons!).
© The Children's Mercy Hospital, 2014. 03/14
11
© The Children's Mercy Hospital, 2014. 11/14
Genomic MedicineGenomic Medicine
• A structured approach
to disease diagnosis &
management that
prominently features
genome sequence
information.
• Decoding Genomes to
diagnose diseases better
and help choose the best
treatments
© The Children's Mercy Hospital, 2014. 03/14
12
© The Children's Mercy Hospital, 2014. 11/14
Monogenic DiseasesMonogenic Diseases
J Clin Invest. 2008;118:1590-1605. doi:10.1172/JCI34772.
© The Children's Mercy Hospital, 2014. 03/14
13
© The Children's Mercy Hospital, 2014. 11/14
7,700 monogenic diseases7,700 monogenic diseases
• 4,174 causal genes known
• Affect 4% of children
• Cause 20% of infant deaths
• Cause 17% of pediatric hospitalizations
• Genome Variants determine phenotype
• Genome variants = individual changes in the DNA
sequence from “normal”
• Proving ground for genomic medicine
• 20 year experience with sequence-based diagnosis
• 1-gene-at-a-time
• Slow (months – years)
• Expensive ($2500 - $10,000)
• Requires right gene to be nominated
© The Children's Mercy Hospital, 2014. 03/14
14
© The Children's Mercy Hospital, 2014. 11/14
Neonatal Intensive CareNeonatal Intensive Care
• 4.1 million babies born in US / year
• 1 in 20 admitted to NICU
• 220,000 (5.4%) NICU admissions/year
• 30% due to congenital abnormalities
• 19,000 neonatal deaths/year
• 6.8/1000
• 22% due to congenital abnormalities
• $3,000 - $8,000 per day
© The Children's Mercy Hospital, 2014. 03/14
15
© The Children's Mercy Hospital, 2014. 11/14
Neonatal Diseases are UniqueNeonatal Diseases are Unique
• Emergencies
• Rapid results can guide management
• Largely stereotyped presentation
• Broad differential diagnosis workups
• Considerable genetic heterogeneity
• Molecular diagnoses almost never made
© The Children's Mercy Hospital, 2014. 03/14
16
© The Children's Mercy Hospital, 2014. 11/14
Neonatal Genomic Medicine
NICU
$3,000 - $8,000 per day
Rapid Genome Sequence
• Test for things too rare and/or
heterogeneous to be considered
• Identification of genotype before
phenotype fully manifests
• Diagnose or rule out known
mutations
• Reduce unnecessary tests &
empiric therapies
• Improve prognostic assessment,
genetic counseling
• Unique opportunity to intervene
before irreversible disease
processes manifests with
irreversible symptoms
© The Children's Mercy Hospital, 2014. 03/14
17
© The Children's Mercy Hospital, 2014. 11/14
Genomic Sequencing – Sanger
© The Children's Mercy Hospital, 2014. 03/14
18
© The Children's Mercy Hospital, 2014. 11/14
Human GenomeHuman Genome
3.2 billion base pairs, 6.4 billion nt
Equal to typing 60 words/min x 8hrs/day x 50 years
20,000 genes (just 2% of genome)
which encode 100,000 proteins
7700 Monogenic diseases
© The Children's Mercy Hospital, 2014. 03/14
19
© The Children's Mercy Hospital, 2014. 11/14
© The Children's Mercy Hospital, 2014. 03/14
20
© The Children's Mercy Hospital, 2014. 11/14
Primary Analysis – Base CallingPrimary Analysis – Base Calling
• In Illumina sequencing, each sequencing cycle produces 4 images, one for
each base, where clusters that show that base are lit up
• Base calling done by
• detecting the coordinates of each cluster
• measuring the intensity of the signal at each cluster for each base
• determining which base has the strongest signal
• strength of call results in a quality score for each base
Whiteford N
et al.
Bioinformatics
2009;25:
2194-2199
http://www.
clinchem.or
g/content/5
5/4/641/F4.l
arge.jpg
© The Children's Mercy Hospital, 2014. 03/14
21
© The Children's Mercy Hospital, 2014. 11/14
Shotgun SequencingShotgun Sequencing
• Shotgun sequencing techniques rely on breaking long strands of DNA
into fragments and then sequencing them individually
• NextGen Sequencing is massively parallel, ultra high throughput
• HiSeq 2500 run produces 1 trillion base pairs in 8 billion 125 bp reads
• Interpreting an individual’s DNA sequence means taking all the pieces
and putting them together into some meaningful context
© The Children's Mercy Hospital, 2014. 03/14
22
© The Children's Mercy Hospital, 2014. 11/14
Sequence Alignment – Read MappingSequence Alignment – Read Mapping
AGCTATTTATGACCATGATTTTTCTTTTTTTATTTTTTCCATATAAGATAAGATGGAGACGGTCTTTTCTTGTGAGTCTGTTTTTCTGTATTCA
AGCTATTTATGACCATGATTTTTCTTTTTTTATTTTTTCCATATAAGATA
TTTATGACCATGATTTTTCTTTTTTTATTTTTTCCATATAAGATAAGATG
GACCATGATTTTTCTTTTTTTATTTTTTCCATNTAAGATAAGATGGAGAC
TGATTTTTCTTTTTTTATTTTTTCCATATAAGATAAGATNGAGACGGTCT
TTTCTTTTTTTATTTTTTCCATATAAGATCAGATGAAGACGGTCTTTTCTTG
CCATATAAGATAAGATGGAGACGGTCTTTTCTTGTGAGTCTGTTTTTCTG
TATAAGATAAGATGGAGACGGTCTTTTCTTGTGAGTCTGTTTTTCTGTAT
TAAGATAAGATGGAGACGGTCTTTTCTTGTGAGTCTGTTTTTCTGTATTC
• Most human sequence analysis is done by mapping reads to the
human reference genome
• Alignment results are stored in a compact standard file format called
Sequence Alignment Map (SAM) or its binary version BAM
• Each alignment records:
• read position in reference (e.g. chr10:1000-1125)
• mismatch between read and reference
• strand read aligned to
• mapping quality score
© The Children's Mercy Hospital, 2014. 03/14
23
© The Children's Mercy Hospital, 2014. 11/14
Alignment Visualization in theAlignment Visualization in the
Integrative Genomics Viewer (IGV)Integrative Genomics Viewer (IGV)
• Red reads pointing right aligned to the forward strand
• Blue reads pointing left aligned to the complement strand
© The Children's Mercy Hospital, 2014. 03/14
24
© The Children's Mercy Hospital, 2014. 11/14
SubstitutionsSubstitutions
© The Children's Mercy Hospital, 2014. 03/14
25
© The Children's Mercy Hospital, 2014. 11/14
DeletionsDeletions
© The Children's Mercy Hospital, 2014. 03/14
26
© The Children's Mercy Hospital, 2014. 11/14
Infant CMH487
Diagnosis!
Bioinformatic Filter 5
© The Children's Mercy Hospital, 2014. 03/14
27
© The Children's Mercy Hospital, 2014. 11/14
Newborn TestingNewborn Testing
• ““If medical or psychosocial benefits of
genetic test will not accrue until adulthood,
as in case of carrier status or adult-onset
diseases, genetic testing should be
deferred…”
• Guides gene analysis/interpretation
• Do not analyze newborns for carrier status or
adult conditions or off-target diseases
© The Children's Mercy Hospital, 2014. 03/14
28
© The Children's Mercy Hospital, 2014. 11/14
SecondarySecondary Findings
• Also called incidental or unanticipated
findings
• Highly likely, if not inevitable, whenever
WGS/WES is performed
• Examples include:
• finding of a previously unsuspected high risk of
future disease
• discovery of a disorder in an asymptomatic
individual
• detection of carrier status
© The Children's Mercy Hospital, 2014. 03/14
29
© The Children's Mercy Hospital, 2014. 11/14
Incidental Findings inIncidental Findings in
Neonates?Neonates?
• Mandate to avoid violating a child’s right to
an open future?
• Considerations
• Parents of critically-ill children “just tell me where
to sign”
• Feasibility of reporting secondary findings -
accuracy, expectations, defining the scope
• Impacts:
• Test design (SSAGA)
• Consent
• Communication of results
© The Children's Mercy Hospital, 2014. 03/14
30
© The Children's Mercy Hospital, 2014. 11/14
Francis Collins, Director of the NIH,Francis Collins, Director of the NIH,
Wall Street Journal, July 8, 2014
 "Over the course of the next few decades,
the availability of cheap, efficient DNA
sequencing technology will lead to a
medical landscape in which each baby's
genome is sequenced, and that
information is used to shape a lifetime of
personalized strategies for disease
prevention, detection and treatment."
© The Children's Mercy Hospital, 2014. 03/14
31
© The Children's Mercy Hospital, 2014. 11/14
Not quite inexpensive
enough for generalized
newborn screening—
but right up there for
diagnosis of ill infants
in the NICU
© The Children's Mercy Hospital, 2014. 03/14
32
© The Children's Mercy Hospital, 2014. 11/14
Adapted from Sir George Poste,
circa1999
© The Children's Mercy Hospital, 2014. 03/14
33
© The Children's Mercy Hospital, 2014. 11/14
Take Home PointsTake Home Points
• Genomic Medicine hold promise, but is
not the final answer
• Proteinomics, metabolomics, epigenetics
• WGS compares most of a patient’s
genome against a reference genome
• Deletions, insertions, triplet repeats
centrimeric anomalies undetected
• The focus on care will shift from disease
centered to patientcentered
© The Children's Mercy Hospital, 2014. 03/14
34
© The Children's Mercy Hospital, 2014. 11/14
Take Home PointsTake Home Points
• Whole genome sequencing is not ready for
prime time use for newborn screening
• Don’t invest in WGS equipment and
bioinformatics tools yet
• Ethical questions arise as to the use of WGS
for NBS
• Adult onset disorders
• Variants of unknown significance
• Paternity
© The Children's Mercy Hospital, 2014. 03/14
35
© The Children's Mercy Hospital, 2014. 11/14
Children’s Mercy Hospital
Center for Pediatric Genomic Medicine
Supported By
Clements
Foundation
Marion Merrell Dow
Foundation
National Institutes of
Health
WT Kemper
Foundation
Patton Trust
Director Dr. Stephen Kingsmore

More Related Content

What's hot

Newborn screening
Newborn screeningNewborn screening
Newborn screeningSarath Mb
 
Session 6C - MHS Vision
Session 6C - MHS VisionSession 6C - MHS Vision
Session 6C - MHS VisionMedXellence
 
RDD Conf Day 2: Pediatric Vasculitis Initiative, David Cabral, British Columb...
RDD Conf Day 2: Pediatric Vasculitis Initiative, David Cabral, British Columb...RDD Conf Day 2: Pediatric Vasculitis Initiative, David Cabral, British Columb...
RDD Conf Day 2: Pediatric Vasculitis Initiative, David Cabral, British Columb...Canadian Organization for Rare Disorders
 
Kuwait Newborn Screening Annual report 2015
Kuwait Newborn Screening Annual report  2015Kuwait Newborn Screening Annual report  2015
Kuwait Newborn Screening Annual report 2015Newborn Screening KW
 
Newborn Screening Bootcamp
Newborn Screening BootcampNewborn Screening Bootcamp
Newborn Screening BootcampSarahGelbard1
 
Reliability, accuracy and cost effectiveness of prenatal screening
Reliability, accuracy and cost effectiveness of prenatal screeningReliability, accuracy and cost effectiveness of prenatal screening
Reliability, accuracy and cost effectiveness of prenatal screeningRustem Celami
 
Newborn hearing screeing_UAPS & LPS _APR 2017
Newborn hearing screeing_UAPS & LPS _APR 2017Newborn hearing screeing_UAPS & LPS _APR 2017
Newborn hearing screeing_UAPS & LPS _APR 2017ZIAD RAFII MD
 
Medical Information Retrieval Workshop Keynote (MedIR@SIGIR2014)
Medical Information Retrieval Workshop Keynote (MedIR@SIGIR2014)Medical Information Retrieval Workshop Keynote (MedIR@SIGIR2014)
Medical Information Retrieval Workshop Keynote (MedIR@SIGIR2014)Karin Verspoor
 
Annual2018 kuwait newborn screening
Annual2018 kuwait newborn screening Annual2018 kuwait newborn screening
Annual2018 kuwait newborn screening Newborn Screening KW
 
Kirsten Edwards_CV_Physician_Assistant
Kirsten Edwards_CV_Physician_AssistantKirsten Edwards_CV_Physician_Assistant
Kirsten Edwards_CV_Physician_AssistantKirsten Edwards
 
Cloud envision ivf electronic medical records
Cloud envision ivf electronic medical recordsCloud envision ivf electronic medical records
Cloud envision ivf electronic medical recordsarunsahayakumar
 

What's hot (18)

Newborn screening
Newborn screeningNewborn screening
Newborn screening
 
Ehdi summit ppt
Ehdi summit pptEhdi summit ppt
Ehdi summit ppt
 
Session 6C - MHS Vision
Session 6C - MHS VisionSession 6C - MHS Vision
Session 6C - MHS Vision
 
RDD Conf Day 2: Pediatric Vasculitis Initiative, David Cabral, British Columb...
RDD Conf Day 2: Pediatric Vasculitis Initiative, David Cabral, British Columb...RDD Conf Day 2: Pediatric Vasculitis Initiative, David Cabral, British Columb...
RDD Conf Day 2: Pediatric Vasculitis Initiative, David Cabral, British Columb...
 
Kuwait Newborn Screening Annual report 2015
Kuwait Newborn Screening Annual report  2015Kuwait Newborn Screening Annual report  2015
Kuwait Newborn Screening Annual report 2015
 
HoMeS: Home Medication Support
HoMeS: Home Medication SupportHoMeS: Home Medication Support
HoMeS: Home Medication Support
 
Newborn Screening Bootcamp
Newborn Screening BootcampNewborn Screening Bootcamp
Newborn Screening Bootcamp
 
Action Meningitis in Malawi
Action Meningitis in MalawiAction Meningitis in Malawi
Action Meningitis in Malawi
 
Reliability, accuracy and cost effectiveness of prenatal screening
Reliability, accuracy and cost effectiveness of prenatal screeningReliability, accuracy and cost effectiveness of prenatal screening
Reliability, accuracy and cost effectiveness of prenatal screening
 
Newborn hearing screeing_UAPS & LPS _APR 2017
Newborn hearing screeing_UAPS & LPS _APR 2017Newborn hearing screeing_UAPS & LPS _APR 2017
Newborn hearing screeing_UAPS & LPS _APR 2017
 
Safer, Faster, Better
Safer, Faster, BetterSafer, Faster, Better
Safer, Faster, Better
 
The ‘Impossibility’ of Working in the Current NHS
The ‘Impossibility’ of Working in the Current NHSThe ‘Impossibility’ of Working in the Current NHS
The ‘Impossibility’ of Working in the Current NHS
 
Newborn Screening Programs in Utah
Newborn Screening Programs in UtahNewborn Screening Programs in Utah
Newborn Screening Programs in Utah
 
Cheryl Howley resume
Cheryl Howley resumeCheryl Howley resume
Cheryl Howley resume
 
Medical Information Retrieval Workshop Keynote (MedIR@SIGIR2014)
Medical Information Retrieval Workshop Keynote (MedIR@SIGIR2014)Medical Information Retrieval Workshop Keynote (MedIR@SIGIR2014)
Medical Information Retrieval Workshop Keynote (MedIR@SIGIR2014)
 
Annual2018 kuwait newborn screening
Annual2018 kuwait newborn screening Annual2018 kuwait newborn screening
Annual2018 kuwait newborn screening
 
Kirsten Edwards_CV_Physician_Assistant
Kirsten Edwards_CV_Physician_AssistantKirsten Edwards_CV_Physician_Assistant
Kirsten Edwards_CV_Physician_Assistant
 
Cloud envision ivf electronic medical records
Cloud envision ivf electronic medical recordsCloud envision ivf electronic medical records
Cloud envision ivf electronic medical records
 

Viewers also liked

Therapeutic cooling during neonatal transport
Therapeutic cooling during neonatal transportTherapeutic cooling during neonatal transport
Therapeutic cooling during neonatal transportGopakumar Hariharan
 
Direct To Consumer Genomics and the Future of Healthcare
Direct To Consumer Genomics and the Future of HealthcareDirect To Consumer Genomics and the Future of Healthcare
Direct To Consumer Genomics and the Future of HealthcareRyan Squire
 
Genetics of Congenital Heart Disease
Genetics of Congenital Heart DiseaseGenetics of Congenital Heart Disease
Genetics of Congenital Heart DiseaseLaxmi Ghimire
 
The Knowns and Unknowns: Genetic Testing and Congenital Heart Disease by Kirs...
The Knowns and Unknowns: Genetic Testing and Congenital Heart Disease by Kirs...The Knowns and Unknowns: Genetic Testing and Congenital Heart Disease by Kirs...
The Knowns and Unknowns: Genetic Testing and Congenital Heart Disease by Kirs...Providence Health Care
 
Microsoft power point ยีนและโครโมโซม
Microsoft power point   ยีนและโครโมโซมMicrosoft power point   ยีนและโครโมโซม
Microsoft power point ยีนและโครโมโซมThanyamon Chat.
 
Genomic Medicine: Personalized Care for Just Pennies
Genomic Medicine: Personalized Care for Just PenniesGenomic Medicine: Personalized Care for Just Pennies
Genomic Medicine: Personalized Care for Just PenniesHealth Catalyst
 
Congenital cyanotic heart disease approach
Congenital cyanotic heart disease approachCongenital cyanotic heart disease approach
Congenital cyanotic heart disease approachVarsha Shah
 
Congenital heart disease (chd)
Congenital heart disease (chd)Congenital heart disease (chd)
Congenital heart disease (chd)Girmawi-Mekelle
 

Viewers also liked (12)

Therapeutic cooling during neonatal transport
Therapeutic cooling during neonatal transportTherapeutic cooling during neonatal transport
Therapeutic cooling during neonatal transport
 
Integrating Genomic Medicine into Patient Care with Trish Brown, MS, CGC
Integrating Genomic Medicine into Patient Care with Trish Brown, MS, CGCIntegrating Genomic Medicine into Patient Care with Trish Brown, MS, CGC
Integrating Genomic Medicine into Patient Care with Trish Brown, MS, CGC
 
Human Genom Project, NCBI, Blast
Human Genom Project, NCBI, BlastHuman Genom Project, NCBI, Blast
Human Genom Project, NCBI, Blast
 
Genes in psychiatry
Genes in psychiatryGenes in psychiatry
Genes in psychiatry
 
2013 03 genomic medicine slides
2013 03 genomic medicine slides2013 03 genomic medicine slides
2013 03 genomic medicine slides
 
Direct To Consumer Genomics and the Future of Healthcare
Direct To Consumer Genomics and the Future of HealthcareDirect To Consumer Genomics and the Future of Healthcare
Direct To Consumer Genomics and the Future of Healthcare
 
Genetics of Congenital Heart Disease
Genetics of Congenital Heart DiseaseGenetics of Congenital Heart Disease
Genetics of Congenital Heart Disease
 
The Knowns and Unknowns: Genetic Testing and Congenital Heart Disease by Kirs...
The Knowns and Unknowns: Genetic Testing and Congenital Heart Disease by Kirs...The Knowns and Unknowns: Genetic Testing and Congenital Heart Disease by Kirs...
The Knowns and Unknowns: Genetic Testing and Congenital Heart Disease by Kirs...
 
Microsoft power point ยีนและโครโมโซม
Microsoft power point   ยีนและโครโมโซมMicrosoft power point   ยีนและโครโมโซม
Microsoft power point ยีนและโครโมโซม
 
Genomic Medicine: Personalized Care for Just Pennies
Genomic Medicine: Personalized Care for Just PenniesGenomic Medicine: Personalized Care for Just Pennies
Genomic Medicine: Personalized Care for Just Pennies
 
Congenital cyanotic heart disease approach
Congenital cyanotic heart disease approachCongenital cyanotic heart disease approach
Congenital cyanotic heart disease approach
 
Congenital heart disease (chd)
Congenital heart disease (chd)Congenital heart disease (chd)
Congenital heart disease (chd)
 

Similar to Genomic Medicine in the NICU

Clinical Decision Making with Machine Learning
Clinical Decision Making with Machine LearningClinical Decision Making with Machine Learning
Clinical Decision Making with Machine LearningSri Ambati
 
Using Genomic Sequencing & HPC to Help Save the Lives of Critically Ill Children
Using Genomic Sequencing & HPC to Help Save the Lives of Critically Ill ChildrenUsing Genomic Sequencing & HPC to Help Save the Lives of Critically Ill Children
Using Genomic Sequencing & HPC to Help Save the Lives of Critically Ill Childreninside-BigData.com
 
Prenatal Genetic Screening with VarSeq
Prenatal Genetic Screening with VarSeqPrenatal Genetic Screening with VarSeq
Prenatal Genetic Screening with VarSeqGolden Helix
 
rgh-portfolio-brochure
rgh-portfolio-brochurergh-portfolio-brochure
rgh-portfolio-brochureTristan Orpin
 
Prenatal screening.pptx
Prenatal screening.pptxPrenatal screening.pptx
Prenatal screening.pptxdivya kumar
 
LATCH SCORE.pptx
LATCH SCORE.pptxLATCH SCORE.pptx
LATCH SCORE.pptxpujanaik16
 
Genetic counselling
Genetic counselling Genetic counselling
Genetic counselling Pinki sah
 
Gene screen technology
Gene screen technologyGene screen technology
Gene screen technologyMiriya Johnson
 
Toward Universal HIV Testing:Is the CDC Recommendation of “Opt-out” Screening...
Toward Universal HIV Testing:Is the CDC Recommendation of “Opt-out” Screening...Toward Universal HIV Testing:Is the CDC Recommendation of “Opt-out” Screening...
Toward Universal HIV Testing:Is the CDC Recommendation of “Opt-out” Screening...CDC NPIN
 
Pulse Oximetry Screening for Detecting Critical Congenital Heart Disease
Pulse Oximetry Screening for Detecting Critical Congenital Heart DiseasePulse Oximetry Screening for Detecting Critical Congenital Heart Disease
Pulse Oximetry Screening for Detecting Critical Congenital Heart Diseasejrhoffmann
 
Pulse Oximetry Screening for Detecting Critical Congenital Heart Disease
Pulse Oximetry Screening for Detecting Critical Congenital Heart DiseasePulse Oximetry Screening for Detecting Critical Congenital Heart Disease
Pulse Oximetry Screening for Detecting Critical Congenital Heart DiseaseChildrensMercyKC
 
qpcr 1 s2.0-s0015028213005499-main (1)
qpcr           1 s2.0-s0015028213005499-main (1)qpcr           1 s2.0-s0015028213005499-main (1)
qpcr 1 s2.0-s0015028213005499-main (1)鋒博 蔡
 
1 s2.0-s0015028213005499-main (1)
1 s2.0-s0015028213005499-main (1)1 s2.0-s0015028213005499-main (1)
1 s2.0-s0015028213005499-main (1)鋒博 蔡
 
Hepatitis C Infection – Screening, Treatment and (as) Prevention in the Comm...
Hepatitis C Infection  – Screening, Treatment and (as) Prevention in the Comm...Hepatitis C Infection  – Screening, Treatment and (as) Prevention in the Comm...
Hepatitis C Infection – Screening, Treatment and (as) Prevention in the Comm...icornpresentations
 

Similar to Genomic Medicine in the NICU (20)

Nbs manual 28-6-2015
Nbs manual 28-6-2015 Nbs manual 28-6-2015
Nbs manual 28-6-2015
 
Nbs manual 28-6-2015
Nbs manual 28-6-2015 Nbs manual 28-6-2015
Nbs manual 28-6-2015
 
Clinical Decision Making with Machine Learning
Clinical Decision Making with Machine LearningClinical Decision Making with Machine Learning
Clinical Decision Making with Machine Learning
 
Using Genomic Sequencing & HPC to Help Save the Lives of Critically Ill Children
Using Genomic Sequencing & HPC to Help Save the Lives of Critically Ill ChildrenUsing Genomic Sequencing & HPC to Help Save the Lives of Critically Ill Children
Using Genomic Sequencing & HPC to Help Save the Lives of Critically Ill Children
 
Prenatal Genetic Screening with VarSeq
Prenatal Genetic Screening with VarSeqPrenatal Genetic Screening with VarSeq
Prenatal Genetic Screening with VarSeq
 
rgh-portfolio-brochure
rgh-portfolio-brochurergh-portfolio-brochure
rgh-portfolio-brochure
 
Story to Sepsis Screen: A Journey in the Details by Elizabeth R. Alpern, MD, ...
Story to Sepsis Screen: A Journey in the Details by Elizabeth R. Alpern, MD, ...Story to Sepsis Screen: A Journey in the Details by Elizabeth R. Alpern, MD, ...
Story to Sepsis Screen: A Journey in the Details by Elizabeth R. Alpern, MD, ...
 
Prenatal screening.pptx
Prenatal screening.pptxPrenatal screening.pptx
Prenatal screening.pptx
 
LATCH SCORE.pptx
LATCH SCORE.pptxLATCH SCORE.pptx
LATCH SCORE.pptx
 
Genetic counselling
Genetic counselling Genetic counselling
Genetic counselling
 
The Generation study by Alice Tuff-Lacey
The Generation study by Alice Tuff-LaceyThe Generation study by Alice Tuff-Lacey
The Generation study by Alice Tuff-Lacey
 
GENETIC ADVANCE 2.pptx
GENETIC ADVANCE 2.pptxGENETIC ADVANCE 2.pptx
GENETIC ADVANCE 2.pptx
 
Gene screen technology
Gene screen technologyGene screen technology
Gene screen technology
 
Toward Universal HIV Testing:Is the CDC Recommendation of “Opt-out” Screening...
Toward Universal HIV Testing:Is the CDC Recommendation of “Opt-out” Screening...Toward Universal HIV Testing:Is the CDC Recommendation of “Opt-out” Screening...
Toward Universal HIV Testing:Is the CDC Recommendation of “Opt-out” Screening...
 
Pulse Oximetry Screening for Detecting Critical Congenital Heart Disease
Pulse Oximetry Screening for Detecting Critical Congenital Heart DiseasePulse Oximetry Screening for Detecting Critical Congenital Heart Disease
Pulse Oximetry Screening for Detecting Critical Congenital Heart Disease
 
Pulse Oximetry Screening for Detecting Critical Congenital Heart Disease
Pulse Oximetry Screening for Detecting Critical Congenital Heart DiseasePulse Oximetry Screening for Detecting Critical Congenital Heart Disease
Pulse Oximetry Screening for Detecting Critical Congenital Heart Disease
 
qpcr 1 s2.0-s0015028213005499-main (1)
qpcr           1 s2.0-s0015028213005499-main (1)qpcr           1 s2.0-s0015028213005499-main (1)
qpcr 1 s2.0-s0015028213005499-main (1)
 
1 s2.0-s0015028213005499-main (1)
1 s2.0-s0015028213005499-main (1)1 s2.0-s0015028213005499-main (1)
1 s2.0-s0015028213005499-main (1)
 
Neonatal Jaundice NICE 2015.pptx
Neonatal Jaundice NICE 2015.pptxNeonatal Jaundice NICE 2015.pptx
Neonatal Jaundice NICE 2015.pptx
 
Hepatitis C Infection – Screening, Treatment and (as) Prevention in the Comm...
Hepatitis C Infection  – Screening, Treatment and (as) Prevention in the Comm...Hepatitis C Infection  – Screening, Treatment and (as) Prevention in the Comm...
Hepatitis C Infection – Screening, Treatment and (as) Prevention in the Comm...
 

Recently uploaded

Call Girls in Hyderabad Lavanya 9907093804 Independent Escort Service Hyderabad
Call Girls in Hyderabad Lavanya 9907093804 Independent Escort Service HyderabadCall Girls in Hyderabad Lavanya 9907093804 Independent Escort Service Hyderabad
Call Girls in Hyderabad Lavanya 9907093804 Independent Escort Service Hyderabaddelhimodelshub1
 
Gurgaon iffco chowk 🔝 Call Girls Service 🔝 ( 8264348440 ) unlimited hard sex ...
Gurgaon iffco chowk 🔝 Call Girls Service 🔝 ( 8264348440 ) unlimited hard sex ...Gurgaon iffco chowk 🔝 Call Girls Service 🔝 ( 8264348440 ) unlimited hard sex ...
Gurgaon iffco chowk 🔝 Call Girls Service 🔝 ( 8264348440 ) unlimited hard sex ...soniya singh
 
Local Housewife and effective ☎️ 8250192130 🍉🍓 Sexy Girls VIP Call Girls Chan...
Local Housewife and effective ☎️ 8250192130 🍉🍓 Sexy Girls VIP Call Girls Chan...Local Housewife and effective ☎️ 8250192130 🍉🍓 Sexy Girls VIP Call Girls Chan...
Local Housewife and effective ☎️ 8250192130 🍉🍓 Sexy Girls VIP Call Girls Chan...Russian Call Girls Amritsar
 
indian Call Girl Panchkula ❤️🍑 9907093804 Low Rate Call Girls Ludhiana Tulsi
indian Call Girl Panchkula ❤️🍑 9907093804 Low Rate Call Girls Ludhiana Tulsiindian Call Girl Panchkula ❤️🍑 9907093804 Low Rate Call Girls Ludhiana Tulsi
indian Call Girl Panchkula ❤️🍑 9907093804 Low Rate Call Girls Ludhiana TulsiHigh Profile Call Girls Chandigarh Aarushi
 
Russian Call Girls in Chandigarh Ojaswi ❤️🍑 9907093804 👄🫦 Independent Escort ...
Russian Call Girls in Chandigarh Ojaswi ❤️🍑 9907093804 👄🫦 Independent Escort ...Russian Call Girls in Chandigarh Ojaswi ❤️🍑 9907093804 👄🫦 Independent Escort ...
Russian Call Girls in Chandigarh Ojaswi ❤️🍑 9907093804 👄🫦 Independent Escort ...High Profile Call Girls Chandigarh Aarushi
 
Call Girls Service Chandigarh Grishma ❤️🍑 9907093804 👄🫦 Independent Escort Se...
Call Girls Service Chandigarh Grishma ❤️🍑 9907093804 👄🫦 Independent Escort Se...Call Girls Service Chandigarh Grishma ❤️🍑 9907093804 👄🫦 Independent Escort Se...
Call Girls Service Chandigarh Grishma ❤️🍑 9907093804 👄🫦 Independent Escort Se...High Profile Call Girls Chandigarh Aarushi
 
Call Girls Kukatpally 7001305949 all area service COD available Any Time
Call Girls Kukatpally 7001305949 all area service COD available Any TimeCall Girls Kukatpally 7001305949 all area service COD available Any Time
Call Girls Kukatpally 7001305949 all area service COD available Any Timedelhimodelshub1
 
Russian Escorts Aishbagh Road * 9548273370 Naughty Call Girls Service in Lucknow
Russian Escorts Aishbagh Road * 9548273370 Naughty Call Girls Service in LucknowRussian Escorts Aishbagh Road * 9548273370 Naughty Call Girls Service in Lucknow
Russian Escorts Aishbagh Road * 9548273370 Naughty Call Girls Service in Lucknowgragteena
 
Call Girl Chandigarh Mallika ❤️🍑 9907093804 👄🫦 Independent Escort Service Cha...
Call Girl Chandigarh Mallika ❤️🍑 9907093804 👄🫦 Independent Escort Service Cha...Call Girl Chandigarh Mallika ❤️🍑 9907093804 👄🫦 Independent Escort Service Cha...
Call Girl Chandigarh Mallika ❤️🍑 9907093804 👄🫦 Independent Escort Service Cha...High Profile Call Girls Chandigarh Aarushi
 
Call Girls Secunderabad 7001305949 all area service COD available Any Time
Call Girls Secunderabad 7001305949 all area service COD available Any TimeCall Girls Secunderabad 7001305949 all area service COD available Any Time
Call Girls Secunderabad 7001305949 all area service COD available Any Timedelhimodelshub1
 
Call Girls Hyderabad Krisha 9907093804 Independent Escort Service Hyderabad
Call Girls Hyderabad Krisha 9907093804 Independent Escort Service HyderabadCall Girls Hyderabad Krisha 9907093804 Independent Escort Service Hyderabad
Call Girls Hyderabad Krisha 9907093804 Independent Escort Service Hyderabaddelhimodelshub1
 
College Call Girls Mumbai Alia 9910780858 Independent Escort Service Mumbai
College Call Girls Mumbai Alia 9910780858 Independent Escort Service MumbaiCollege Call Girls Mumbai Alia 9910780858 Independent Escort Service Mumbai
College Call Girls Mumbai Alia 9910780858 Independent Escort Service Mumbaisonalikaur4
 
Russian Escorts Delhi | 9711199171 | all area service available
Russian Escorts Delhi | 9711199171 | all area service availableRussian Escorts Delhi | 9711199171 | all area service available
Russian Escorts Delhi | 9711199171 | all area service availablesandeepkumar69420
 
Gurgaon Sector 90 Call Girls ( 9873940964 ) Book Hot And Sexy Girls In A Few ...
Gurgaon Sector 90 Call Girls ( 9873940964 ) Book Hot And Sexy Girls In A Few ...Gurgaon Sector 90 Call Girls ( 9873940964 ) Book Hot And Sexy Girls In A Few ...
Gurgaon Sector 90 Call Girls ( 9873940964 ) Book Hot And Sexy Girls In A Few ...ggsonu500
 

Recently uploaded (20)

Call Girls in Hyderabad Lavanya 9907093804 Independent Escort Service Hyderabad
Call Girls in Hyderabad Lavanya 9907093804 Independent Escort Service HyderabadCall Girls in Hyderabad Lavanya 9907093804 Independent Escort Service Hyderabad
Call Girls in Hyderabad Lavanya 9907093804 Independent Escort Service Hyderabad
 
Model Call Girl in Subhash Nagar Delhi reach out to us at 🔝9953056974🔝
Model Call Girl in Subhash Nagar Delhi reach out to us at 🔝9953056974🔝Model Call Girl in Subhash Nagar Delhi reach out to us at 🔝9953056974🔝
Model Call Girl in Subhash Nagar Delhi reach out to us at 🔝9953056974🔝
 
Gurgaon iffco chowk 🔝 Call Girls Service 🔝 ( 8264348440 ) unlimited hard sex ...
Gurgaon iffco chowk 🔝 Call Girls Service 🔝 ( 8264348440 ) unlimited hard sex ...Gurgaon iffco chowk 🔝 Call Girls Service 🔝 ( 8264348440 ) unlimited hard sex ...
Gurgaon iffco chowk 🔝 Call Girls Service 🔝 ( 8264348440 ) unlimited hard sex ...
 
Call Girls in Lucknow Esha 🔝 8923113531 🔝 🎶 Independent Escort Service Lucknow
Call Girls in Lucknow Esha 🔝 8923113531  🔝 🎶 Independent Escort Service LucknowCall Girls in Lucknow Esha 🔝 8923113531  🔝 🎶 Independent Escort Service Lucknow
Call Girls in Lucknow Esha 🔝 8923113531 🔝 🎶 Independent Escort Service Lucknow
 
Local Housewife and effective ☎️ 8250192130 🍉🍓 Sexy Girls VIP Call Girls Chan...
Local Housewife and effective ☎️ 8250192130 🍉🍓 Sexy Girls VIP Call Girls Chan...Local Housewife and effective ☎️ 8250192130 🍉🍓 Sexy Girls VIP Call Girls Chan...
Local Housewife and effective ☎️ 8250192130 🍉🍓 Sexy Girls VIP Call Girls Chan...
 
indian Call Girl Panchkula ❤️🍑 9907093804 Low Rate Call Girls Ludhiana Tulsi
indian Call Girl Panchkula ❤️🍑 9907093804 Low Rate Call Girls Ludhiana Tulsiindian Call Girl Panchkula ❤️🍑 9907093804 Low Rate Call Girls Ludhiana Tulsi
indian Call Girl Panchkula ❤️🍑 9907093804 Low Rate Call Girls Ludhiana Tulsi
 
Call Girl Lucknow Gauri 🔝 8923113531 🔝 🎶 Independent Escort Service Lucknow
Call Girl Lucknow Gauri 🔝 8923113531  🔝 🎶 Independent Escort Service LucknowCall Girl Lucknow Gauri 🔝 8923113531  🔝 🎶 Independent Escort Service Lucknow
Call Girl Lucknow Gauri 🔝 8923113531 🔝 🎶 Independent Escort Service Lucknow
 
Russian Call Girls in Chandigarh Ojaswi ❤️🍑 9907093804 👄🫦 Independent Escort ...
Russian Call Girls in Chandigarh Ojaswi ❤️🍑 9907093804 👄🫦 Independent Escort ...Russian Call Girls in Chandigarh Ojaswi ❤️🍑 9907093804 👄🫦 Independent Escort ...
Russian Call Girls in Chandigarh Ojaswi ❤️🍑 9907093804 👄🫦 Independent Escort ...
 
Russian Call Girls in Dehradun Komal 🔝 7001305949 🔝 📍 Independent Escort Serv...
Russian Call Girls in Dehradun Komal 🔝 7001305949 🔝 📍 Independent Escort Serv...Russian Call Girls in Dehradun Komal 🔝 7001305949 🔝 📍 Independent Escort Serv...
Russian Call Girls in Dehradun Komal 🔝 7001305949 🔝 📍 Independent Escort Serv...
 
Call Girls Service Chandigarh Grishma ❤️🍑 9907093804 👄🫦 Independent Escort Se...
Call Girls Service Chandigarh Grishma ❤️🍑 9907093804 👄🫦 Independent Escort Se...Call Girls Service Chandigarh Grishma ❤️🍑 9907093804 👄🫦 Independent Escort Se...
Call Girls Service Chandigarh Grishma ❤️🍑 9907093804 👄🫦 Independent Escort Se...
 
Call Girls Kukatpally 7001305949 all area service COD available Any Time
Call Girls Kukatpally 7001305949 all area service COD available Any TimeCall Girls Kukatpally 7001305949 all area service COD available Any Time
Call Girls Kukatpally 7001305949 all area service COD available Any Time
 
Russian Escorts Aishbagh Road * 9548273370 Naughty Call Girls Service in Lucknow
Russian Escorts Aishbagh Road * 9548273370 Naughty Call Girls Service in LucknowRussian Escorts Aishbagh Road * 9548273370 Naughty Call Girls Service in Lucknow
Russian Escorts Aishbagh Road * 9548273370 Naughty Call Girls Service in Lucknow
 
Call Girl Chandigarh Mallika ❤️🍑 9907093804 👄🫦 Independent Escort Service Cha...
Call Girl Chandigarh Mallika ❤️🍑 9907093804 👄🫦 Independent Escort Service Cha...Call Girl Chandigarh Mallika ❤️🍑 9907093804 👄🫦 Independent Escort Service Cha...
Call Girl Chandigarh Mallika ❤️🍑 9907093804 👄🫦 Independent Escort Service Cha...
 
Call Girls Secunderabad 7001305949 all area service COD available Any Time
Call Girls Secunderabad 7001305949 all area service COD available Any TimeCall Girls Secunderabad 7001305949 all area service COD available Any Time
Call Girls Secunderabad 7001305949 all area service COD available Any Time
 
Call Girls Hyderabad Krisha 9907093804 Independent Escort Service Hyderabad
Call Girls Hyderabad Krisha 9907093804 Independent Escort Service HyderabadCall Girls Hyderabad Krisha 9907093804 Independent Escort Service Hyderabad
Call Girls Hyderabad Krisha 9907093804 Independent Escort Service Hyderabad
 
College Call Girls Mumbai Alia 9910780858 Independent Escort Service Mumbai
College Call Girls Mumbai Alia 9910780858 Independent Escort Service MumbaiCollege Call Girls Mumbai Alia 9910780858 Independent Escort Service Mumbai
College Call Girls Mumbai Alia 9910780858 Independent Escort Service Mumbai
 
College Call Girls Dehradun Kavya 🔝 7001305949 🔝 📍 Independent Escort Service...
College Call Girls Dehradun Kavya 🔝 7001305949 🔝 📍 Independent Escort Service...College Call Girls Dehradun Kavya 🔝 7001305949 🔝 📍 Independent Escort Service...
College Call Girls Dehradun Kavya 🔝 7001305949 🔝 📍 Independent Escort Service...
 
Russian Escorts Delhi | 9711199171 | all area service available
Russian Escorts Delhi | 9711199171 | all area service availableRussian Escorts Delhi | 9711199171 | all area service available
Russian Escorts Delhi | 9711199171 | all area service available
 
Call Girl Guwahati Aashi 👉 7001305949 👈 🔝 Independent Escort Service Guwahati
Call Girl Guwahati Aashi 👉 7001305949 👈 🔝 Independent Escort Service GuwahatiCall Girl Guwahati Aashi 👉 7001305949 👈 🔝 Independent Escort Service Guwahati
Call Girl Guwahati Aashi 👉 7001305949 👈 🔝 Independent Escort Service Guwahati
 
Gurgaon Sector 90 Call Girls ( 9873940964 ) Book Hot And Sexy Girls In A Few ...
Gurgaon Sector 90 Call Girls ( 9873940964 ) Book Hot And Sexy Girls In A Few ...Gurgaon Sector 90 Call Girls ( 9873940964 ) Book Hot And Sexy Girls In A Few ...
Gurgaon Sector 90 Call Girls ( 9873940964 ) Book Hot And Sexy Girls In A Few ...
 

Genomic Medicine in the NICU

  • 1. © The Children's Mercy Hospital, 2014. 11/14 Center for Genomic MedicineCenter for Genomic Medicine Joshua E. Petrikin, MDJoshua E. Petrikin, MD Director of Neonatal GenomicsDirector of Neonatal Genomics Genomic Medicine in the NICUGenomic Medicine in the NICU
  • 2. © The Children's Mercy Hospital, 2014. 03/14 2 © The Children's Mercy Hospital, 2014. 11/14 DisclosuresDisclosures • I have no conflicts of interest to disclose • I will not be discussing off label medication uses
  • 3. © The Children's Mercy Hospital, 2014. 03/14 3 © The Children's Mercy Hospital, 2014. 11/14 OverviewOverview • Discuss past and current genetic testing • Define Genomic Medicine • Speculate on future directions for genomics • Elucidate some ethical considerations in Neonatal genomic testing
  • 4. © The Children's Mercy Hospital, 2014. 03/14 4 © The Children's Mercy Hospital, 2014. 11/14 Genetic TestingGenetic Testing • The analysis of human DNA, RNA, chromosomes, proteins, and certain metabolites in order to detect heritable disease-related genotypes, mutations, phenotypes or karyotypes for clinical purposes. • Prenatal, newborn, and carrier screening included.
  • 5. © The Children's Mercy Hospital, 2014. 03/14 5 © The Children's Mercy Hospital, 2014. 11/14 http://www.indiana.edu/~oso/lessons/Genetics/MyFamily2.html
  • 6. © The Children's Mercy Hospital, 2014. 03/14 6 © The Children's Mercy Hospital, 2014. 11/14 Genetic Testing:Genetic Testing: Chromosome KaryotypeChromosome Karyotype
  • 7. © The Children's Mercy Hospital, 2014. 03/14 7 © The Children's Mercy Hospital, 2014. 11/14 ExampleExample Patient #1 is a 10 year old girl with short stature and a broad neckPatient #1 is a 10 year old girl with short stature and a broad neck
  • 8. © The Children's Mercy Hospital, 2014. 03/14 8 © The Children's Mercy Hospital, 2014. 11/14 Microarrays aka “CHIPS” • Short oligos are attached to a solid support (microarray). • Hybridize with fluorescently labeled PCR products containing SNP of interest. • Can analyze many mutations at once • Currently > 740k SNP per chip
  • 9. © The Children's Mercy Hospital, 2014. 03/14 9 © The Children's Mercy Hospital, 2014. 11/14 Array-CGH (comparative genomic hybridization)
  • 10. © The Children's Mercy Hospital, 2014. 03/14 10 © The Children's Mercy Hospital, 2014. 11/14 Deletion on array Muscular Dystrophy • Since 65-85% of cases are due to deletions, start with deletion testing. • The lab we use for dystrophin deletion testing uses an “exon array” with high density probes spanning entire dystrophin gene. • Case 4 patient has a deletion including exons 44-48 (not shown here). • If no deletion detectable, sequence entire DMD gene (79 exons!).
  • 11. © The Children's Mercy Hospital, 2014. 03/14 11 © The Children's Mercy Hospital, 2014. 11/14 Genomic MedicineGenomic Medicine • A structured approach to disease diagnosis & management that prominently features genome sequence information. • Decoding Genomes to diagnose diseases better and help choose the best treatments
  • 12. © The Children's Mercy Hospital, 2014. 03/14 12 © The Children's Mercy Hospital, 2014. 11/14 Monogenic DiseasesMonogenic Diseases J Clin Invest. 2008;118:1590-1605. doi:10.1172/JCI34772.
  • 13. © The Children's Mercy Hospital, 2014. 03/14 13 © The Children's Mercy Hospital, 2014. 11/14 7,700 monogenic diseases7,700 monogenic diseases • 4,174 causal genes known • Affect 4% of children • Cause 20% of infant deaths • Cause 17% of pediatric hospitalizations • Genome Variants determine phenotype • Genome variants = individual changes in the DNA sequence from “normal” • Proving ground for genomic medicine • 20 year experience with sequence-based diagnosis • 1-gene-at-a-time • Slow (months – years) • Expensive ($2500 - $10,000) • Requires right gene to be nominated
  • 14. © The Children's Mercy Hospital, 2014. 03/14 14 © The Children's Mercy Hospital, 2014. 11/14 Neonatal Intensive CareNeonatal Intensive Care • 4.1 million babies born in US / year • 1 in 20 admitted to NICU • 220,000 (5.4%) NICU admissions/year • 30% due to congenital abnormalities • 19,000 neonatal deaths/year • 6.8/1000 • 22% due to congenital abnormalities • $3,000 - $8,000 per day
  • 15. © The Children's Mercy Hospital, 2014. 03/14 15 © The Children's Mercy Hospital, 2014. 11/14 Neonatal Diseases are UniqueNeonatal Diseases are Unique • Emergencies • Rapid results can guide management • Largely stereotyped presentation • Broad differential diagnosis workups • Considerable genetic heterogeneity • Molecular diagnoses almost never made
  • 16. © The Children's Mercy Hospital, 2014. 03/14 16 © The Children's Mercy Hospital, 2014. 11/14 Neonatal Genomic Medicine NICU $3,000 - $8,000 per day Rapid Genome Sequence • Test for things too rare and/or heterogeneous to be considered • Identification of genotype before phenotype fully manifests • Diagnose or rule out known mutations • Reduce unnecessary tests & empiric therapies • Improve prognostic assessment, genetic counseling • Unique opportunity to intervene before irreversible disease processes manifests with irreversible symptoms
  • 17. © The Children's Mercy Hospital, 2014. 03/14 17 © The Children's Mercy Hospital, 2014. 11/14 Genomic Sequencing – Sanger
  • 18. © The Children's Mercy Hospital, 2014. 03/14 18 © The Children's Mercy Hospital, 2014. 11/14 Human GenomeHuman Genome 3.2 billion base pairs, 6.4 billion nt Equal to typing 60 words/min x 8hrs/day x 50 years 20,000 genes (just 2% of genome) which encode 100,000 proteins 7700 Monogenic diseases
  • 19. © The Children's Mercy Hospital, 2014. 03/14 19 © The Children's Mercy Hospital, 2014. 11/14
  • 20. © The Children's Mercy Hospital, 2014. 03/14 20 © The Children's Mercy Hospital, 2014. 11/14 Primary Analysis – Base CallingPrimary Analysis – Base Calling • In Illumina sequencing, each sequencing cycle produces 4 images, one for each base, where clusters that show that base are lit up • Base calling done by • detecting the coordinates of each cluster • measuring the intensity of the signal at each cluster for each base • determining which base has the strongest signal • strength of call results in a quality score for each base Whiteford N et al. Bioinformatics 2009;25: 2194-2199 http://www. clinchem.or g/content/5 5/4/641/F4.l arge.jpg
  • 21. © The Children's Mercy Hospital, 2014. 03/14 21 © The Children's Mercy Hospital, 2014. 11/14 Shotgun SequencingShotgun Sequencing • Shotgun sequencing techniques rely on breaking long strands of DNA into fragments and then sequencing them individually • NextGen Sequencing is massively parallel, ultra high throughput • HiSeq 2500 run produces 1 trillion base pairs in 8 billion 125 bp reads • Interpreting an individual’s DNA sequence means taking all the pieces and putting them together into some meaningful context
  • 22. © The Children's Mercy Hospital, 2014. 03/14 22 © The Children's Mercy Hospital, 2014. 11/14 Sequence Alignment – Read MappingSequence Alignment – Read Mapping AGCTATTTATGACCATGATTTTTCTTTTTTTATTTTTTCCATATAAGATAAGATGGAGACGGTCTTTTCTTGTGAGTCTGTTTTTCTGTATTCA AGCTATTTATGACCATGATTTTTCTTTTTTTATTTTTTCCATATAAGATA TTTATGACCATGATTTTTCTTTTTTTATTTTTTCCATATAAGATAAGATG GACCATGATTTTTCTTTTTTTATTTTTTCCATNTAAGATAAGATGGAGAC TGATTTTTCTTTTTTTATTTTTTCCATATAAGATAAGATNGAGACGGTCT TTTCTTTTTTTATTTTTTCCATATAAGATCAGATGAAGACGGTCTTTTCTTG CCATATAAGATAAGATGGAGACGGTCTTTTCTTGTGAGTCTGTTTTTCTG TATAAGATAAGATGGAGACGGTCTTTTCTTGTGAGTCTGTTTTTCTGTAT TAAGATAAGATGGAGACGGTCTTTTCTTGTGAGTCTGTTTTTCTGTATTC • Most human sequence analysis is done by mapping reads to the human reference genome • Alignment results are stored in a compact standard file format called Sequence Alignment Map (SAM) or its binary version BAM • Each alignment records: • read position in reference (e.g. chr10:1000-1125) • mismatch between read and reference • strand read aligned to • mapping quality score
  • 23. © The Children's Mercy Hospital, 2014. 03/14 23 © The Children's Mercy Hospital, 2014. 11/14 Alignment Visualization in theAlignment Visualization in the Integrative Genomics Viewer (IGV)Integrative Genomics Viewer (IGV) • Red reads pointing right aligned to the forward strand • Blue reads pointing left aligned to the complement strand
  • 24. © The Children's Mercy Hospital, 2014. 03/14 24 © The Children's Mercy Hospital, 2014. 11/14 SubstitutionsSubstitutions
  • 25. © The Children's Mercy Hospital, 2014. 03/14 25 © The Children's Mercy Hospital, 2014. 11/14 DeletionsDeletions
  • 26. © The Children's Mercy Hospital, 2014. 03/14 26 © The Children's Mercy Hospital, 2014. 11/14 Infant CMH487 Diagnosis! Bioinformatic Filter 5
  • 27. © The Children's Mercy Hospital, 2014. 03/14 27 © The Children's Mercy Hospital, 2014. 11/14 Newborn TestingNewborn Testing • ““If medical or psychosocial benefits of genetic test will not accrue until adulthood, as in case of carrier status or adult-onset diseases, genetic testing should be deferred…” • Guides gene analysis/interpretation • Do not analyze newborns for carrier status or adult conditions or off-target diseases
  • 28. © The Children's Mercy Hospital, 2014. 03/14 28 © The Children's Mercy Hospital, 2014. 11/14 SecondarySecondary Findings • Also called incidental or unanticipated findings • Highly likely, if not inevitable, whenever WGS/WES is performed • Examples include: • finding of a previously unsuspected high risk of future disease • discovery of a disorder in an asymptomatic individual • detection of carrier status
  • 29. © The Children's Mercy Hospital, 2014. 03/14 29 © The Children's Mercy Hospital, 2014. 11/14 Incidental Findings inIncidental Findings in Neonates?Neonates? • Mandate to avoid violating a child’s right to an open future? • Considerations • Parents of critically-ill children “just tell me where to sign” • Feasibility of reporting secondary findings - accuracy, expectations, defining the scope • Impacts: • Test design (SSAGA) • Consent • Communication of results
  • 30. © The Children's Mercy Hospital, 2014. 03/14 30 © The Children's Mercy Hospital, 2014. 11/14 Francis Collins, Director of the NIH,Francis Collins, Director of the NIH, Wall Street Journal, July 8, 2014  "Over the course of the next few decades, the availability of cheap, efficient DNA sequencing technology will lead to a medical landscape in which each baby's genome is sequenced, and that information is used to shape a lifetime of personalized strategies for disease prevention, detection and treatment."
  • 31. © The Children's Mercy Hospital, 2014. 03/14 31 © The Children's Mercy Hospital, 2014. 11/14 Not quite inexpensive enough for generalized newborn screening— but right up there for diagnosis of ill infants in the NICU
  • 32. © The Children's Mercy Hospital, 2014. 03/14 32 © The Children's Mercy Hospital, 2014. 11/14 Adapted from Sir George Poste, circa1999
  • 33. © The Children's Mercy Hospital, 2014. 03/14 33 © The Children's Mercy Hospital, 2014. 11/14 Take Home PointsTake Home Points • Genomic Medicine hold promise, but is not the final answer • Proteinomics, metabolomics, epigenetics • WGS compares most of a patient’s genome against a reference genome • Deletions, insertions, triplet repeats centrimeric anomalies undetected • The focus on care will shift from disease centered to patientcentered
  • 34. © The Children's Mercy Hospital, 2014. 03/14 34 © The Children's Mercy Hospital, 2014. 11/14 Take Home PointsTake Home Points • Whole genome sequencing is not ready for prime time use for newborn screening • Don’t invest in WGS equipment and bioinformatics tools yet • Ethical questions arise as to the use of WGS for NBS • Adult onset disorders • Variants of unknown significance • Paternity
  • 35. © The Children's Mercy Hospital, 2014. 03/14 35 © The Children's Mercy Hospital, 2014. 11/14 Children’s Mercy Hospital Center for Pediatric Genomic Medicine Supported By Clements Foundation Marion Merrell Dow Foundation National Institutes of Health WT Kemper Foundation Patton Trust Director Dr. Stephen Kingsmore

Editor's Notes

  1. Medicine today. Make a Dx, select an Rx, physician-centric Medicine twenty seventeen. Personal genome database – stored probably on your watch or your ring. Symptoms e.g. breathlessness prompt specific, multiplexed finger stick tests e.g. BNP, troponin Multiscale modeling of dx, prognosis, personalized interventions