1) Cela1 protein levels increase 176-fold during lung development from embryonic day 15.5 through 8 weeks postnatal.
2) After pneumonectomy, Cela1 mRNA increases 6-fold, protein increases 3-fold, and Cela1-positive cells increase 2-fold, indicating Cela1 is involved in compensatory lung growth.
3) Cela1 is expressed predominantly in alveolar type II cells during embryonic lung development and predominantly in CD90-positive fibroblasts in the postnatal lung.
Participation of the oviductal s100 calcium binding protein G in the genomic effect of estradiol that accelerates oviductal embryo transport in mated rats
Mariana Ríos1, Alexis Parada-Bustamante1, Luis A Velásquez2,3, Horacio B Croxatto2,3,4 and Pedro A Orihuela2,3*
By Luis Alberto Velasquez Cumplido
Endothelial Cell Mediated Delay of Blood Brain Barrier Recovery Following Tra...Arthur Stem
TBI is the leading cause of death among young adults and children in the developed world, accounting for over 50,000 deaths per year. [12] TBI results in a sleuth of poor health outcomes, including hemorrhaging, seizures, neural edema, neural inflammation, and cognitive and emotional disabilities. All of these outcomes are a direct result of fundamental degradation of the BBB over a time course post TBI. [1] [12] The BBB is an integral structure that forms around the microvascular of the cerebral cavity. Endothelial cells form the basal membrane through which strictly controlled movement of molecules is observed between the extravascular and intravascular space across this basal membrane. This basal membrane is maintained by endothelial cells, having tight junctions between them to make up the pores through which transport of molecules can occur between the brain and microvasculature. These tight junctions are maintained through cross-talk between the endothelial cells and supporting neurons such as astrocytes and pericytes. [2] A multitude of proteins make up the tight junctions between the endothelial cells, including six main scaffolding structures Claudins 1, 3, and 5, ZO-1, Occludins, and Cadherins. [3] VEGF release following trauma induces endothelial cells to release matrix metalloproteinases (MMPs), in particular MMP9, which can catalyze the N-terminal amino acids that compose the tight junction protein ZO-1. [10] [11] MMP9 when in circulation is also known to activate tumor necrosis factor alpha (TNFɑ) which in turn upregulates transcription of MMP9, creating a positive feedback loop. [11] The management of MMP production is three fold, transcription, proenzyme activation, and substrate inhibition. [11] In our study, it is proenzyme activation via TP that is the focus and how that affects the overall transcription levels of the tight junction proteins within the endothelial cells and astrocytes.
Participation of the oviductal s100 calcium binding protein G in the genomic effect of estradiol that accelerates oviductal embryo transport in mated rats
Mariana Ríos1, Alexis Parada-Bustamante1, Luis A Velásquez2,3, Horacio B Croxatto2,3,4 and Pedro A Orihuela2,3*
By Luis Alberto Velasquez Cumplido
Endothelial Cell Mediated Delay of Blood Brain Barrier Recovery Following Tra...Arthur Stem
TBI is the leading cause of death among young adults and children in the developed world, accounting for over 50,000 deaths per year. [12] TBI results in a sleuth of poor health outcomes, including hemorrhaging, seizures, neural edema, neural inflammation, and cognitive and emotional disabilities. All of these outcomes are a direct result of fundamental degradation of the BBB over a time course post TBI. [1] [12] The BBB is an integral structure that forms around the microvascular of the cerebral cavity. Endothelial cells form the basal membrane through which strictly controlled movement of molecules is observed between the extravascular and intravascular space across this basal membrane. This basal membrane is maintained by endothelial cells, having tight junctions between them to make up the pores through which transport of molecules can occur between the brain and microvasculature. These tight junctions are maintained through cross-talk between the endothelial cells and supporting neurons such as astrocytes and pericytes. [2] A multitude of proteins make up the tight junctions between the endothelial cells, including six main scaffolding structures Claudins 1, 3, and 5, ZO-1, Occludins, and Cadherins. [3] VEGF release following trauma induces endothelial cells to release matrix metalloproteinases (MMPs), in particular MMP9, which can catalyze the N-terminal amino acids that compose the tight junction protein ZO-1. [10] [11] MMP9 when in circulation is also known to activate tumor necrosis factor alpha (TNFɑ) which in turn upregulates transcription of MMP9, creating a positive feedback loop. [11] The management of MMP production is three fold, transcription, proenzyme activation, and substrate inhibition. [11] In our study, it is proenzyme activation via TP that is the focus and how that affects the overall transcription levels of the tight junction proteins within the endothelial cells and astrocytes.
Dynamic Teaming and Leading — The New NormalWorkboard Inc.
Most managers see functional and organizational boundaries as barriers, yet to thrive in complex markets, organizations need boundary-spanning collaboration, cross-organizational thinking and dynamic rather than functional leadership. Maximize your organization’s agility and velocity by making dynamic teaming and leading its new normal.
Alpha-1 Antitrypsin (α-1 AT) deficiency is a common genetic disorder that affects 1 in 2,000 individuals in the USA. Additionally, over 20 million people have been identified as carriers for this genetic disorder. In severe cases, α-1 AT deficiency can cause substantial lung and liver damage, which if left untreated could result in death and there are no current available treatments. Alpha-1 protein is produced in the liver, travels in the bloodstream and utilized in the lungs to protect healthy lung tissue from harmful destruction by elastase. A common single amino acid substitution, located at E342K (ATZ) was identified in α-1 AT deficient humans. When this specific mutation occurs two phenotypes can result: 1) ATZ can polymerize in the liver causing cellular toxicity 2) inhibits alpha-1 antitrypsin from inhibiting elastase which can result in lung disease. Currently; little is known about the cellular mechanisms that clear the accumulated proteins in the liver. Therefore, an investigative study utilizing C. elegans model of ATZ was performed in order to help determine the cellular mechanisms that dispose of accumulated proteins. Specifically RNA interference was utilized to knockdown expression of specific genes. This investigation examined genes involved in the heat-shock pathway (HSP), unfolded protein response (UPR), and insulin signaling pathway (IS). Phenotypic analysis including: embryonic lethality, protein aggregation expression, and longevity, was completed after knockdown of genes to determine effect on ATZ accumulation. Currently with our preliminary data suggests that the heat-shack pathway may play a role in ATZ accumulation. Determining the mechanism of protein accumulation in the investigation of C. elegans may lead to possible drug targets and therefore the development of a treatment which may alleviate those diagnosed with this disorder.
mRNA rather than DNA may become the nucleotide framework for new classes of drugs and vaccines. Exciting preclinical results in prophylaxis and initial clinical data in oncology suggest that mRNA technology could be translated into improvements in lung cancer and other diseases.
Bee venom protects kidneys from cancer drug toxicityBee Healthy Farms
The findings strongly suggest that Bee Venom could prevent cisplatin-induced severe side effects in the kidney, at least partly, by modulating the Tregs. Bee Venom has protective effects on cisplatin-induced nephrotoxicity in mice, at least in part, through the regulation of Tregs without a big influence on the antitumor effects of cisplatin.
Yuliya I. Petrova, Barry M. Gumbiner. Role of E-cadherin cell surface activat...Yuliya I. Petrova, PhD
E-cadherin is a tumor suppressor protein and the loss of E-cadherin expression promotes tumor progression and metastasis. However, in many cases cells of epithelial tumors and metastases still express E-cadherin. We have found that E-cadherin exists in different activity states at the cell surface, and we hypothesize loss of cadherin activity regulation, rather than expression, may promote cancer progression.
To study whether adhesion activation can inhibit metastasis, we tested the effects of mAbs that activate E-cadherin at the cell surface. Animals with orthotopic tumors formed by 4T1 cells expressing human E-cadherin were injected either with adhesion-activating mAb or neutral nonactivating E-cadherin-specific mAb. We found that activating Ab treatment significantly reduced the number of 4T1 mammary tumor cells that metastasized to lung after 4 weeks.
We also asked whether naturally occurring missense mutations in the E-cadherin ectodomain known to promote hereditary diffuse gastric cancer (HDGC) in humans specifically affect the regulation of adhesive activity at the cell surface. To examine basic adhesive function several HDGC E-cadherin mutants were expressed in cadherin-free CHO cells. We observed that some mutants exhibited normal adhesion strength while others exhibited substantially reduced adhesion strength, although they still had greater adhesion than the totally inactive W2A cadherin mutant. To test whether the mutant E-cadherins can be activated at the cell surface they were expressed in Colo 205 cells after depletion of endogenous E-cadherin via shRNA. All mutants tested so far showed impaired activation upon outside and/or inside initiation (activating mAb or nocodazole treatment respectively) even though they exhibited basic adhesion functionality in the CHO adhesion assay. One mutant was strongly activated from the outside by the activating mAbs, but could not be activated from the inside by nocodazole or by activating p120-catenin mutations.
These findings show that regulation of E-cadherin activity on cell surface is a mechanism that contributes to cancer progression, in addition to the known mechanism of loss of E-cadherin expression
Notch signaling is essential to maintain skeletal muscle stem cells in quiescence. However, the
precise roles of different Notch receptors are incompletely defined. Here, we demonstrate a
role for Notch3 (N3) in the self-renewal of muscle stem cells. We found that N3 is active in quiescent C2C12 reserve cells (RCs), and N3 over-expression and knockdown studies in C2C12 and
primary satellite cells reveal a role in self-renewal.
IRF5 Promotes the Progression of Hepatocellular Carcinoma and is Regulated by...JohnJulie1
The IRF family of proteins involves in the tumor progression. However, but the functions of IRF5 in the tumorigenesis are largely unknown. Here, IRF5 was found to be up-regulated in hepatocellular carcinoma (HCC). Interfering with IRF5 inhibited the growth and tumorigenic ability of HCC cells.
IRF5 Promotes the Progression of Hepatocellular Carcinoma and is Regulated by...
FASEBJ-2015-277350v1-Varisco
1. P a g e | 1
Stretch Regulates Expression and Binding of Chymotrypsin-like Elastase 1 in the Postnatal Lung
Joshi R1a
*, Liu S1a
*, Brown MD1b
, Young SM2
, Batie M1c
, Kofron JM1d
, Xu Y1e
, Weaver TE1e
, Apsley K1e
,
Varisco BM1a
#
1-Cincinnati Children’s Hospital Medical Center, Cincinnati, Ohio, USA
1a-Division of Critical Care Medicine
1b-Biomedical Research Internship for Minority Students Program
1c-Department of Clinical Engineering
1d-Divsion of Developmental Biology
1e-Division of Pulmonary Biology
2-Ohio State University College of Veterinary Medicine, Columbus, Ohio, USA
*-Co-First Authors
#Corresponding Author
3333 Burnet Avenue
MLC 2005
Cincinnati, OH 45229-3039
brian.varisco@cchmc.org
Phone: 513-803-2485
Fax: 513-803-3311
2. P a g e | 2
Nonstandard Abbreviations
Ac Accessory Lobe
CD45 Cluster of Differentiation Factor 45-Myeloid Cell Marker
CD90 Marker for a subset of non-fibrogenic lung fibroblasts (also termed Thy-1)
Cela1 Chymotrypsin-like Elastase 1
E# Embryonic Day Number
Low Lower Lobe
Mid Middle Lobe
PND postnatal day
PNX Pneumonectomy
Up Upper Lobe
3. P a g e | 3
ABSTRACT
Lung stretch is critical for normal lung development and for compensatory lung growth after pneumonectomy,
but the mechanisms by which strain induces matrix remodeling are unclear. Our prior work demonstrated an
association of chymotrypsin-like elastase 1 (Cela1) with lung elastin remodeling and that strain triggered a near-
instantaneous elastin remodeling response. We sought to determine whether stretch regulates Cela1 expression
and Cela1 binding to lung elastin. In C57BL/6 mice Cela1 protein increased 176-fold during lung
morphogenesis. Post-pneumonectomy, Cela1 mRNA increased 6-fold, protein 3-fold, and Cela1-positive cells
2-fold. Cela1 was expressed predominantly in alveolar type II cells in the embryonic lung and predominantly in
CD90-positive fibroblasts postnatally. During compensatory lung growth, Cela1 expression was induced in non-
proliferative mesenchymal cells. In ex vivo mouse lung sections, stretch increased Cela1 binding to lung tissue
by 46%. Competitive inhibition with soluble elastin completely abrogated this increase. Areas of stretch-
induced elastase activity and Cela1 binding colocalized. The stretch-dependent expression and binding kinetics
of Cela1 indicate an important role in stretch-dependent remodeling of the peripheral lung during development
and regeneration.
KEY WORDS
Matrix Remodeling
Lung Development
Lung Regeneration
Elastin
Mechanical Strain
4. P a g e | 4
INTRODUCTION
Throughout prenatal and postnatal life, lung morphogenesis and repair occur as lung tissues are subjected to the
dynamic expansion and compression of the respiratory cycle. Even before birth, fetal lung stretch is critical for
lung morphogenesis as evidenced by the lung hypoplasia associated with congenital diaphragmatic hernia (1)
and oligohydramnios (2). In congenital diaphragmatic hernia, lung growth can be partially restored by in utero
lung distention using temporary tracheal occlusion (1). Thoracic dystrophies also cause lung hypoplasia (3), and
post-pneumonectomy lung stretch is required to initiate realveolarization (4, 5). Lung growth and
realveolarization occur in humans post-pneumonectomy (6). While stretch is known to play a critical role in
lung morphogenesis, the mechanisms by which stretch orchestrates septation are unclear. Elucidation of these
mechanisms could lead to translational therapies improving gas exchange in diseases of congenital and acquired
distal airspace simplification.
In the mouse pneumonectomy model of lung regeneration, left lung removal results in compensatory growth of
the right lung. Growth occurs predominantly in the accessory lobe, with restoration of lung volume and alveolar
number by six weeks post-surgery (7), providing a useful model for deciphering intra-, inter-, and extracellular
processes in alveolarization. After pneumonectomy, the accessory lobe briefly and incompletely expresses an
embryonic pattern of RNAs with increased matrix-related mRNAs (8). Matrix remodeling is necessary for lung
regeneration (9, 10), but how different subpopulations of epithelial (11), endothelial (4) and mesenchymal (12,
13) cells coordinate matrix synthesis remodeling is unclear. We previously reported that chymotrypsin-like
elastase 1 (Cela1) expression increased postnatally and was temporally and spatially associated with lung elastin
remodeling during lung development (14). Using in vivo and ex vivo models, we showed that lung stretch
triggered elastase activity via non-transcriptional mechanisms (15). There is reason to believe that Cela1
exhibits stretch-dependent proteolytic activity. Using fluorescence recovery after photo bleaching, Jeduason, et
al demonstrated first order kinetic binding of porcine pancreatic elastase to lung elastin fibers with
progressively increasing levels of stretch (16). Cela1 is a major component of porcine pancreatic elastase. Since
lung Cela1 expression increases during periods of increasing lung distention and Cela-family members exhibit
stretch-dependent binding to lung elastin fibers, we sought to test whether Cela1 expression and binding to lung
elastin were indeed stretch dependent and identify the cells expresing it.
MATERIALS AND METHODS
Animal Use and Housing. Animal use was approved by our institution’s animal use and care committee
(IACUC), and animals care, handling, and sacrifice was in accordance with the Guide for the Care and Use of
5. P a g e | 5
Laboratory Animals (NIH, Bethesda, MD, USA). C57BL/6J mice from the Jackson Laboratory (Bar Harbor,
ME, USA) were maintained in a pathogen-free barrier facility with 12 hour light-dark cycles and provided
filtered water and autoclaved chow ad libitum.
Euthanasia and Tissue Preparation. Animals were killed by intraperitoneal injection of ketamine, xylazine, and
acepromazine (100, 6, and 2 mg/kg respectively) and severing the left renal artery. Lung tissues processed for
RNA, protein, flow cytometry, or sectioning as below.
Mouse Surgical Procedures. Left pneumonectomy or sham thoracotomy was performed in 8-10 week old mice
as previously described (10). Left lung wax plombage was created and inserted into weight-matched mice as
previously described (15).
Western Blot. For Cela1 immunoblotting, we utilized an anti-Cela1 antibody developed in our laboratory in
guinea pig at 1:1000 dilution (14) with a donkey anti-guinea pig secondary antibody conjugated to IRDye800
(1:5000 dilution, Licor, Lincoln, NE, USA) . β-actin immunoblotting (1:2000 dilution) was performed with an
AlexaFluor680-conjugated antibody (AbCam, Cambridge, MA, USA). Imaging was performed on an Odyssey
CLx Imager (Licor).
PCR. RNA was extracted from lung homogenate and purified with the RNEasy Mini kit (Qiagen, Germantown,
MD, USA) per manufacturer protocol. After cDNA synthesis, Cela1 mRNA was quantified by TaqMan PCR
using proprietary Cela1 primers (Mm00712898_m1, Applied Biosystems, Carlsbad, CA, USA) and GAPDH
endogenous control kit (Applied Biosystems).
Immunofluorescence. Five μm paraffin embedded lung sections were immunostained with anti-Cela1 antibody
raised in guinea pig (1:1000) and anti-surfactant protein B antibody (Seven Hills Bioreagents, 1:1000) with
appropriate secondary antibodies and imaged on a Nikon 90i widefield microscope.
Flow Cytometry. After euthanasia, lungs or lung lobes were inflated with dispase (BD biosciences, San Jose,
CA, USA) and the trachea was tied with silk suture. The inflated lungs were incubated in dispase for 45 minutes
and then transferred to a 100 cm2
dish with MEM and 10% fetal bovine serum. After teasing the tissue off the
bronchial tree with forceps, the cells were strained through a 70 micron strainer, pelleted, and re-suspended in
red cell lysis buffer (BioLegend, San Diego, CA, USA). Dead cells were excluded with Zombie Red
(Biolegend) per manufacturer protocol. After washing and resuspending in cell staining buffer (BioLegend),
surface antigen staining was performed as outlined in Table 1. For Cela1 staining we labeled anti-Cela1
antibody with a Cy3 conjugation kit (Abd Serotec, Raleigh, NC, USA). After washing and resuspending in cell
permeabilization buffer (BioLegend), intracellular antigen staining was similarly performed. For alpha-smooth
6. P a g e | 6
muscle actin, IRDye680 secondary antibody was used with three washes between primary and secondary
antibody incubation. LipidTox staining was performed with surface antigen staining. For cell proliferation
studies, 1 mg of BrdU (BioLegend) was injected intraperitoneally at the time of surgery. Specimens were
analyzed on a FACSCanto configured with 488, 561, and 633 nm lasers (BD Biosystems, Franklin Lakes, NJ).
After staining, Cells were resuspended in fixation buffer (BioLegend) and stored at 4°C overnight in the dark.
Cells were gated by size with exclusion of dead cells from analysis. Compensation was performed using single-
labeled OneComp Beads (eBiosciences, SanDiego, CA, USA) conjugated to appropriate fluorophore-labeled
isotype antibodies. For each experiment, fluorescent-minus one controls were performed with absence of signal
in the appropriate channel indicating antibody specificity.
Recombinant Protein. Mouse Cela1 without the signal peptide was cloned from a mammalian Cela1 expression
plasmid (Origene, Rockville, MD, USA) using the forward primer
AAATTTGCTAGCATGACCGAGGACGTTCCGGAA and reverse primer
ATATATCTCGAGTCAGTGGTGGTGGTGGTGGTGGTTGGAGGCAATGACATTATTCATCCA. These
primers added a NheI and XhoI restriction sites which were used to clone the Cela1 cDNA into the pET21a(+)
plasmid (Millipore, Billerica, MA, USA) which incorporated a 6-His tag on the c-terminus of the recombinant
protein. DH5α cells (Life Technologies) were used to grow these plasmids, and His-tagged Cela1 was isolated
from transformed BL21(DE3) cells (Life Technologies) and purified using Ni-NTA columns (Qiagen). Purity
was confirmed by Coomassie blue staining and Cela1 Western blot, and enzymatic activity was assessed by
Enzcheck Elastase Assay (Life Technologies). Recombinant Cela1 was then conjugated to AlexaFluor568 using
the APEX labeling kit (Life Technologies).
Ex vivo Lung Sections. After euthanasia, the lungs of 8-12 week old mice were inflated with 37°C 8% bovine
gelatin (Sigma-Aldrich) in PBS, removed, and then placed on ice. The left lung was then embedded in 8%
gelatin with the lateral pleural surface down and 200 µm sections were cut using a Lecia VT1000S vibratome
(Buffalo Grove, IL, USA) keeping the sections in 4°C PBS.
Lung Stretch Device. A Makerbot Z18 3D printer (Makerbot Industries, LLC , Brooklyn, NY, USA) and
Rhinoceros 5 design program (McNeel, Seattle, WA, USA) was used to create a uniaxial stretching device
compatible with a Nikon A1 inverted single photon confocal microscope. Two strips of Tyvek fabric
(McMaster-Carr, Aurora, OH) were attached to spindles and placed 1.5 cm apart on a polysine glass slide. The
strips were kept flat to the slide using stainless steel M3 diameter dowel pins (McMaster-Carr, Aurora, OH,
USA), which were mounted across the slide. These pins enabled the strips to move between the slide and the
pins while maintaining its Z position. Lung sections were then floated on 500 µL of PBS between these two
strips and lowered onto the strips by pipetting the PBS. The lung section was secured to the strips with Gluture
7. P a g e | 7
(Abbott, Chicago, IL, USA) and the gelatin removed by washing five times with 37°C PBS. A shallow well of
vacuum grease was created around the section and over the Tyvek strips. PBS and 10 µg/mL fluorophore-
quenched soluble elastin substrate (Enzcheck Elastase Assay, Life Technologies) and 300 ng/mL fluorophore-
labeled recombinant Cela1 were added and a weighted coverslip was applied. Nikon mount was shimmed so the
entire lung section could be imaged in on 10 µm plane at 10X magnification. Tiled scans of the entire lung
section were imaged with sequential stretching of the lung section or at equivalent time intervals without
stretch. For inhibition experiments, 10 µg/mL soluble bovine elastin (Elastin Products Company, St. Louis,
MO, USA) was added.
Quantative Image Analysis. Lung section images were analyzed using Imaris (Bitplane, South Windsor, CT,
USA). Tissue, elastase, and Cela1 surfaces were created by thresholding of the DAPI, FITC, and TRITC
channels respectively. Signal intensities (voxel x intensity above threshold) of tissue, elastase, and protease
within the tissue surface were used to calculate normalized elastase and Cela1-binding values at each stretch
step. Strain was calculated by measuring the distance between two large structures on each successive image
and calculating change in distance divided by initial distance. Normalized elastase and protease signal intensity
was then plotted against strain. For individual distal airspace measurements, ten distal airspaces per data set
were measured and signal intensities quantified as above with the linear relationship between change in activity
or binding and strain used for comparisons.
Statistical Analysis. SigmaPlot (Systat, San Jose, CA, USA) was used for statistical comparisons. One-way
ANOVA was used to compare data sets with three or more groups with pairwise comparison by the Holm-Sidak
method. For longitudinal data sets, comparisons were made between sequential time points by Student’s t-test
with overall data set comparison made by one-way ANOVA. p-values of less than 0.05 were considered
significant. All error bars represent standard error.
RESULTS
Cela1 Protein Content Increases Throughout Lung Development
We first used Western blot to define the temporal expression pattern of Cela1 in the prenatal and postnatal lung.
In embryonic and postnatal lung, Cela1 expression increased progressively between E15.5 and PN 8 weeks and
did not significantly decrease thereafter (Figure 1A-B). Cela1 increased throughout the canalicular, saccular,
and alveolar stages of lung development and persisted in the adult lung.
To test antibody specificity, we performed a Western blot of recombinant Cela1 protein, adult mouse pancreas
and lung homogenate. Expected 28 kDa bands for both recombinant protein and pancreas were identified, and a
8. P a g e | 8
~65 kDa band was observed for lung homogenate. Incubation with antigenic peptide prior to blotting quenched
the signal of all three samples demonstrating antibody specificity.
Cela1 is Expressed Predominantly in CD90-positive Lung Fibroblasts in the Adult Lung
We previously reported that the majority of Cela1-positive cells in the adult mouse lung were fibroblasts (14);
however, a substantial portion of Cela1-positive cells in that study were vimentin-negative. After size and dead
cell exclusion (Figure 2A), Cela1-positive cells were gated on fluorescence minus one controls (Figure 2B). In
PN 8-12 week old mouse lung 1.5% of cells were Cela1-positive with 49% of these cells being fibroblasts and
18% macrophages. The Cela1-positive population was enriched for macrophages and fibroblasts (Figure 2C-F).
Since different lung fibroblast sub-populations are important in lung development and regeneration, we
analyzed Cela1 and vimentin double-positive cells for the alpha-smooth muscle actin of myofibroblasts and for
the neutral lipid of lipofibroblasts. Cela1-positive lung fibroblasts preferentially contained neutral lipid (Figure
2G-H). Since CD90 (also termed Thy-1) promotes a lipofibroblast phenotype (17), we tested for an association
between Cela1 and CD90. Cela1 was enriched in the CD90-positive lung fibroblast population (Figure 2I-J).
These data show that in the adult mouse lung, Cela1 is preferentially expressed in CD90-positive lung
fibroblasts.
Dynamic Changes in Cela1 Expression in Alveolar Type II Cells and Lung Fibroblasts During Development
Since Cela1 increased during lung development, we queried published single cell mRNA-sequencing data of
E16.5 mouse lung (18) to test whether Cela1 was also expressed in embryonic mouse lung fibroblasts. At
E16.5 Cela1 was expressed in alveolar type II cells and its expression was correlated with resistin like alpha
(Retnla), surfactant protein B (Sftpb), solute carrier family 34 member 2a (Slc34a2), chitinase (Chia), and
lysophaphatidylcholine acyltransferase 1 (Lpcat1) (Figure 3A). Conversely, Sftpb was highly correlated with
Cela1 mRNA. Although Cela1 was expressed in a single myeloid-lineage cell, Cela1 was not expressed in
fibroblasts of E16.5 lung. Immunofluorescence staining of PND-zero lung determined that Cela1 was expressed
in a subset of surfactant-protein B-expressing lung epithelial cells (Figure 3B).
To define the transition between alveolar type II cell and lung fibroblast expression of Cela1, we used flow
cytometry characterize Cela1-positive cells over the course of lung development. The percentage of total lung
cells expressing Cela1 increased from 0.8% at E18.5 to 1.5% in the adult lung (Figure 3C). However, the cell-
type expressing Cela1 changed over the course of lung development from mostly epithelial cells in E18.5 lung
to mostly lung fibroblasts in the adult lung (Figure 3D-E) There was no statistically significant difference in the
Cela1 median fluorescence intensity in these populations. These data demonstrate that alveolar type II cell
Cela1 expression decreases after birth and that Cela1 expression in lung fibroblasts increases postnatally.
9. P a g e | 9
Accessory Lobe Cela1 Expression Increases Post-pneumonectomy
Given the increase in lung Cela1 content during the saccular and alveolar stages of development, we performed
left pneumonectomy in 8 week old mice to test whether Cela1 was associated with compensatory lung growth.
At 24 hours post-pneumonectomy Cela1 protein was increased 3-fold (Figure 4A), but Cela1 expression was
not increased in the upper, middle, or lower lobes (Figure 4B). Accessory lobe Cela1 decreased to baseline
levels by three days post-pneumonectomy (Figure 4C). Quantifying accessory lobe Cela1 mRNA revealed that
Cela1 mRNA increased 6-fold two hours post-pneumonectomy and began decreasing by 24 hours (Figure 4D).
Western blot of upper, middle, and lower lobes during compensatory lung growth revealed no statistically
significant changes. (Figure 4E). A rapid increase in accessory lobe Cela1 expression occurs post-
pneumonectomy.
Increased Cela1 in Lung Fibroblasts Post-pneumonectomy
We performed flow cytometry of the right lung lobes of sham-operated and left pneumonectomy mice at 24
hours. In the pneumonectomy accessory lobes, the percentage of cells that were Cela1-positive more than
doubled to 3.1% (Figure 4F). Although these data do not exclude the possibility of a non-pulmonary source of
Cela1-positive cells, these data support the concept that the post-pneumonectomy increase in Cela1 is related to
induction in previously non-expressing lung cells. To test this hypothesis, we assessed the distribution of Cela1-
positive cells in sham-operated and pneumonectomy mice at 24 hours. There were no significant differences in
the distribution of Cela1-positive cells among different cell types (Figure 4G-H). Since pneumonectomy
transiently re-induces many development-associated RNAs (8), we tested whether Cela1 was expressed in
proliferating accessory lobe cells. However, Cela1-positive cells were preferentially BrdU-negative (Figure 4I).
These data indicate that Cela1 is induced in non-proliferating fibroblasts during post-pneumonectomy
compensatory lung growth.
Stretch Mediates Post-pneumonectomy Increase in Cela1
Compensatory lung growth is influenced by stretch and by increased pulmonary blood flow (4, 5). Since Cela1
increased rapidly post-pneumonectomy and the increases in prenatal and postnatal Cela1 coincided with the
onset of fetal breathing movements and the transition to air breathing, we sought to determine if Cela1
expression was regulated by stretch. Right lung expansion after left pneumonectomy was prevented using wax
lung plombage (Figure 5A). This technique completely prevented post-pneumonectomy right lung expansion
(15), and prevented the post-pneumonectomy increase in accessory lobe Cela1 (Figure 5B). Lung fibroblast
Cela1 expression is mediated by stretch.
10. P a g e | 10
Cela1 Binding to Lung Elastin Increases In Response to Stretch
Lung elastase activity increases in response to stretch (15), and porcine pancreatic elastase binding to lung
elastin fibers increases in proportion to stretch (16). To test whether the same is true for Cela1, we quantified
Cela1 binding and lung elastase activity in ex vivo lung sections with and without stretch. We synthesized
proteolytically active recombinant Cela1 (Figure 6A) and labeled it with fluorophore. Using a stretching device
we fabricated (Figure 6B), ex vivo lung sections were stretched in the presence of Cela1 and with elastin in situ
zymography substrate. Cela1 binding and elastase activity increased with stretch (Figure 6C-D and Videos 1-2).
Binding of Cela1 to lung tissue was increased by strain 3-fold as compared to unstretched lung (Figure 6E).
Elastase activity increased only with stretch (Figure 6F). We tested whether soluble elastin would competitively
inhibit Cela1 binding to lung tissue. Cela1 binding was reduced 2-fold with soluble elastin co-incubation while
elastase activity was unaltered (Figure 6G-H and Video 3). To determine whether Cela1 binding and increasing
lung elastase activity were temporally and spatially associated, we compared the percentages of co-localized
Cela1 and elastase voxels. Stretch increased colocalized voxels and soluble elastin dampened this increase
(Figure 6I). To differentiate signals in central lung structures from distal airspaces, data sets were cropped to
evaluate individual distal airspace units. While stretch-induced elastase activity was not altered by soluble
elastin (Figure 6J), soluble elastin did reduce stretch-dependent Cela1 binding (Figure 6K). These data
demonstrate that stretch induces the binding of Cela1 to lung elastin and that Cela1 to elastin undergoing
stretch-induced remodeling.
DISCUSSION
We have shown that the expression of Cela1 in CD90-positive lung fibroblasts is regulated by stretch and that
Cela1 exhibits stretch-dependent binding kinetics to lung elastin. We previously demonstrated that elastase
activity increases in alveolar walls and not septal tips (15) and that Cela1 positive cell localize with this elastase
activity (19). These data all support an important role for Cela1 in peripheral lung morphogenesis.
We demonstrated that Cela1 expression changes rapidly during development and compensatory lung growth
within and between cell populations. During embryonic lung development, respiratory epithelial cells play
critical roles in lung morphogenesis (20). During alveolarization and post-pneumonectomy compensatory lung
growth, the primary role of the epithelium is less well established while that of fibroblast populations is critical
(12, 13, 17). Cela1 expression shifts from alveolar type II cells in the embryonic lung to CD90-positive lung
fibroblasts postnatally is induced during lung regeneration.
Present findings support an important role for Cela1 in expression and binding to elastin. Various matrix
metalloproteinases and their associated inhibitors regulate alveolarization differently (21-23). Another serine
11. P a g e | 11
protease, neutrophil elastase, is deleterious to lung development (24). Since, proteases in the same family can
have opposite effects on alveolar septation, these effects must be due to differences in expression levels,
substrate specificity, and protease binding site availability. Elastin is preferentially cleaved by Cela-family
members at exon-12 with a high degree of specificity (25, 26). This region of the peptide is likely hidden by
adjacent tropoelastin molecules in the unstretched state but may be exposed in the stretched state (27). We
demonstrated that Cela1 binds to lung elastin in proportion to stretch. The expression pattern, substrate binding
kinetics, and substrate specificity of Cela1 supports for a critical role in lung development and regeneration.
The rapid increase and decrease in accessory lobe Cela1 after pneumonectomy is inconsistent with the day-14
peak of stretch-induced elastase activity reported previously (15). While this could be due to proteases other
than Cela1, previously published microarray demonstrate no significant changes in protease mRNAs at 14 days
post-pneumonectomy (8). Although Cela1 expression is lower at day 14 post-pneumonectomy than at day 1, its
expression is still higher than during alveolarization. This supports the concept that stretch-regulated protease
activity is more important than absolute expression levels.
We found that the molecular weight of lung Cela1 is 35 kDa higher than pancreatic Cela1. Potential molecular
mechanisms explaining this discrepancy include dimerization, alternative splicing, and covalent modification by
an inhibitory protein. Alternative splicing seems unlikely since the lengths of pancreas and lung Cela1 mRNA
are equal. Dimerization would require covalent bond formation since we used reducing conditions for Western
blotting. To date, we have been unsuccessful in identifying covalently bound inhibitory proteins. Understanding
this molecular weight discrepancy will be key to further defining the biology of pulmonary Cela1.
While several confocal microscope-compatible stretching devices are commercially available, none were suited
our experimental needs. 3D printing allowed us to rapidly and inexpensively develop a new stretch device
customized for our needs and microscope specifications. The device enabled tissue stretching optimized for the
10X objective working distance, allowed maintenance of tissue plane during stretching, and prevented tissue
curling. The ease and cost with which each device was fabricated was enabled by the 3D printing platform that
can be electronically transmitted to interested investigators upon request. The other key innovation of this study
was the use of bovine gelatin for lung inflation and sectioning which permitted removal at a lower temperature
than is possible with low melting point agarose.
In summary, we demonstrated the stretch-dependent expression and binding of Cela1 in the developing and
regenerating lung implicating its role stretch-regulated remodeling of peripheral lung elastin. These findings
may lead to novel therapies targeting Cela1 in diseases of reduced lung distention leading to pulmonary
hypoplasia.
12. P a g e | 12
ACKNOWLEDGEMENTS
This work was funded by the Proctor Scholar Program at Cincinnati Children’s Hospital, the Parker B. Francis
Family Foundation, and the Biomedical Research Internship Program for Minority Students at CCHMC.
Monica de Lay of the CCHMC flow cytometry core and Anna K. Perl of the CCHMC Division of Pulmonary
Biology provided advice with cytometry experiments. The CCHMC confocal imaging facility provided
technical support for imaging and image analysis.
FIGURE LEGENDS
Figure 1- Dynamic Changes in Lung Cela1. (A) Lung Cela1 progressively increased during lung development.
(B) Cela1 remained elevated throughout adulthood. (C) Cela1 recombinant protein (RP) and pancreas
homogenate (Pan) from an 8-week old mouse migrated in SDS-PAGE gel at the predicted Cela1 molecular
weight (MW). Lung homogenate from the same mouse had a higher molecular weight. Incubation with the
peptide used to generate the antibody blocked Cela1 signals. Both blots were imaged simultaneously.
Figure 2-Cela1 Is Expressed Predominantly in CD90-Positive Fibroblasts. (A) Lung Cells were gated on
forward scatter (FSC-A) and side scatter (SSC-A) and dead cells were excluded. (B) Cela1-positive cells were
identified on a Cy3 and SSC-A gate. (C) Cells expressing VE-cadherin were defined as endothelial cells (Endo)
and cells expressing CD45 as macrophages (Mac). (D) Cells expressing neither marker were considered
epithelial cells (Epi) if EpCam-positive and fibroblasts (Fibro) as vimentin-positive and negative for all other
markers. (E) The majority of Cela1-positive cells were macrophages and fibroblasts. (F) By cell type, 41% of
macrophages and 4.2% of lung fibroblasts were Cela1-positive. (G) Lung fibroblasts were stained for neutral
lipid with Lipid Tox and for alpha-smooth muscle actin (αSMA). (H) The Cela1-positive fibroblast population
was enriched in lipofibroblasts. (I&J) Cela1-positive lung fibroblasts were enriched for CD90-expression. (K)
Cela1 was expressed at a 3-fold higher rate in CD90-positive fibroblasts than CD90-negative ones.
Figure 3- Developmental Changes in Alveolar Type II Cell and Fibroblast Cela1 Expression. (A) Single cell
mRNA sequencing data of E16.5 mouse identified Cela1 as being highly correlated with alveolar type II cell
genes. (B) Immunofluorescence co-staining of PND0 lung for Cela1 (red) and pro-surfactant protein B (pro-SP-
B, green) showed that Cela1 was expressed in in alveolar type II cells during the saccular stage of lung
development. (C) By flow cytometry, the percentage of lung cells expressing Cela1 gradually increased during
lung development. (D) At E18.5, Cela1-staining was predominantly in epithelial cells, but postnatally staining
in epithelial cells decreased and in fibroblasts increased. (E) The percentage of epithelial cells expressing Cela1
decreased and that of fibroblasts increased during development.
13. P a g e | 13
Figure 4- Increased Cela1 During Compensatory Lung Growth. (A) At 24 hours post-pneumonectomy (PNX,
black bar) accessory lobe Cela1 increased 3-fold compared to sham (gray box) and control (white box). (B)
Cela1 in upper (Up), middle (Mid), and lower (Low) lobes did not increase. (C) Accessory lobe Cela1
decreased to baseline 72 hours post-pneumonectomy. (D) Cela1 mRNA increased within two hours of
pneumonectomy and decreased rapidly thereafter. (E) By Western blot Cela1 was induced selectively in the
accessory lobe. (F) At 24-hours, the percentage of cells expressing Cela1 increased in the accessory lobe. (G) In
the post-pneumonectomy accessory lobe, the distribution of Cela1-positive cells was unaltered. (H)
Pneumonectomy increased the expression of Cela1 in epithelial cell, endothelial cells, and fibroblasts. (I) Cela1-
positive cells were less likely to be BrdU-positive than Cela1-negative cells. X-indicates an insufficient number
of cells for analysis.
Figure 5-Stretch Regulates Post-pneumonectomy Increase in Accessory Lobe Cela1. (A) To prevent post-
pneumonectomy lung stretch, weight matched wax lung plombage was inserted into the left thorax after
pneumonectomy. (B) At 24 hours post-pneumonectomy, insertion of wax lung plombage prevented increased
accessory lobe Cela1 expression.
Figure 6-Binding of Cela1 to Lung Matrix is Stretch-Dependent. (A) We synthesized proteolytically active
Cela1. Elastase activity decreased with serial dilution. (B) To test whether Cela1 binds to lung matrix with
stretch, we developed a 3D-printed confocal microscope-compatible lung stretching device. (C) Lung sections
were incubated with fluorophore-labeled recombinant Cela1 and serially imaged with increasing stretch using
tissue autofluorescence in the DAPI channel to define lung structure. At zero stretch, little Cela1 binding or
elastase activity was detected. Scale bar = 1 mm. (D) Cela1 binding and elastase activity increased with stretch.
(E) Binding of Cela1 to lung tissue increased with strain (closed circles) as compared to the binding measured
at 3 minute intervals without stretch (open circles). (F) As measured by elastin in situ zymography, lung
elastase activity increased with stretch. (G) To determine if Cela1 was binding to lung elastin, soluble elastin
was added as a competitive binding substrate. Soluble elastin decreased binding of Cela1 to lung tissue by half.
(H) Soluble elastin did not reduce endogenous stretch-dependent elastase activity. (I) To test for the association
of Cela1 binding in regions of increased elastase activity, the number of colocalized voxels was determined.
The number of colocalized voxels increased in stretched but not unstretched lung. Soluble elastin reduced the
number of colocalized voxels. (J) At the level of individual distal airspaces, elastase activity increased with
strain. (K) Cela1 binding to individual airspace walls increased with strain and soluble elastin abrogated this
increase.
14. P a g e | 14
REFERENCES
1. Snowise, S., and Johnson, A. (2014) Tracheal occlusion for fetal diaphragmatic hernia. American
journal of perinatology 31, 605-616
2. De Paepe, M. E., Shapiro, S., Hansen, K., and Gundogan, F. (2014) Postmortem lung volume/body
weight standards for term and preterm infants. Pediatr Pulmonol 49, 60-66
3. Sharoni, E., Erez, E., Chorev, G., Dagan, O., and Vidne, B. A. (1998) Chest reconstruction in
asphyxiating thoracic dystrophy. J Pediatr Surg 33, 1578-1581
4. Dane, D. M., Yilmaz, C., Estrera, A. S., and Hsia, C. C. (2013) Separating in vivo mechanical stimuli
for postpneumonectomy compensation: physiological assessment. Journal of applied physiology 114,
99-106
5. Ysasi, A. B., Belle, J. M., Gibney, B. C., Fedulov, A. V., Wagner, W., AkiraTsuda, Konerding, M. A.,
and Mentzer, S. J. (2013) Effect of unilateral diaphragmatic paralysis on postpneumonectomy lung
growth. Am J Physiol Lung Cell Mol Physiol 305, L439-445
6. Butler, J. P., Loring, S. H., Patz, S., Tsuda, A., Yablonskiy, D. A., and Mentzer, S. J. (2012) Evidence
for adult lung growth in humans. N Engl J Med 367, 244-247
7. Wang, W., Nguyen, N. M., Guo, J., and Woods, J. C. (2013) Longitudinal, noninvasive monitoring of
compensatory lung growth in mice after pneumonectomy via (3)He and (1)H magnetic resonance
imaging. Am J Respir Cell Mol Biol 49, 697-703
8. Kho, A. T., Liu, K., Visner, G., Martin, T., and Boudreault, F. (2013) Identification of dedifferentiation
and redevelopment phases during postpneumonectomy lung growth. Am J Physiol Lung Cell Mol
Physiol 305, L542-554
9. Hoffman, A. M., Shifren, A., Mazan, M. R., Gruntman, A. M., Lascola, K. M., Nolen-Walston, R. D.,
Kim, C. F., Tsai, L., Pierce, R. A., Mecham, R. P., and Ingenito, E. P. (2010) Matrix modulation of
compensatory lung regrowth and progenitor cell proliferation in mice. Am J Physiol Lung Cell Mol
Physiol 298, L158-168
10. Liu, S., Cimprich, J., and Varisco, B. M. (2014) Mouse pneumonectomy model of compensatory lung
growth. J Vis Exp
11. Liu, Y., Suresh Kumar, V., Zhang, W., Rehman, J., and Malik, A. B. (2014) Activation of Type II Cells
Into Regenerative Sca-1+ Cells During Alveolar Repair. American Journal of Respiratory Cell and
Molecular Biology
12. Perl, A. K., and Gale, E. (2009) FGF signaling is required for myofibroblast differentiation during
alveolar regeneration. Am J Physiol Lung Cell Mol Physiol 297, L299-308
15. P a g e | 15
13. Chen, L., Acciani, T., Le Cras, T., Lutzko, C., and Perl, A. K. (2012) Dynamic regulation of platelet-
derived growth factor receptor alpha expression in alveolar fibroblasts during realveolarization. Am J
Respir Cell Mol Biol 47, 517-527
14. Liu, S., Young, S. M., and Varisco, B. M. (2014) Dynamic Expression of Chymotrypsin-Like Elastase 1
Over the Course of Murine Lung Development. Am J Physiol Lung Cell Mol Physiol
15. Young, S. M., Liu, S., Joshi, R., Batie, M., Kofron, J. M., Guo, J., Woods, J., and Varisco, B. M. (2014)
Localization and Stretch-Dependence of Lung Elastase Activity in Development and Compensatory
Growth. Journal of applied physiology in press
16. Jesudason, R., Sato, S., Parameswaran, H., Araujo, A. D., Majumdar, A., Allen, P. G., Bartolak-Suki, E.,
and Suki, B. (2010) Mechanical forces regulate elastase activity and binding site availability in lung
elastin. Biophys J 99, 3076-3083
17. Varisco, B. M., Ambalavanan, N., Whitsett, J. A., and Hagood, J. S. (2012) Thy-1 signals through
PPARgamma to promote lipofibroblast differentiation in the developing lung. Am J Respir Cell Mol Biol
46, 765-772
18. Du, Y., Guo, M., Whitsett, J. A., and Xu, Y. (2015) 'LungGENS': a web-based tool for mapping single-
cell gene expression in the developing lung. Thorax
19. Liu, S., Young, S. M., and Varisco, B. M. (2014) Dynamic expression of chymotrypsin-like elastase 1
over the course of murine lung development. Am J Physiol Lung Cell Mol Physiol 306, L1104-1116
20. Morrisey, E. E., and Hogan, B. L. (2010) Preparing for the first breath: genetic and cellular mechanisms
in lung development. Dev Cell 18, 8-23
21. Gill, S. E., Pape, M. C., and Leco, K. J. (2009) Absence of tissue inhibitor of metalloproteinases 3
disrupts alveologenesis in the mouse. Development, growth & differentiation 51, 17-24
22. Ambalavanan, N., Nicola, T., Li, P., Bulger, A., Murphy-Ullrich, J., Oparil, S., and Chen, Y. F. (2008)
Role of matrix metalloproteinase-2 in newborn mouse lungs under hypoxic conditions. Pediatr Res 63,
26-32
23. Atkinson, J. J., Holmbeck, K., Yamada, S., Birkedal-Hansen, H., Parks, W. C., and Senior, R. M. (2005)
Membrane-type 1 matrix metalloproteinase is required for normal alveolar development. Dev Dyn 232,
1079-1090
24. Hilgendorff, A., Parai, K., Ertsey, R., Juliana Rey-Parra, G., Thebaud, B., Tamosiuniene, R., Jain, N.,
Navarro, E. F., Starcher, B. C., Nicolls, M. R., Rabinovitch, M., and Bland, R. D. (2012) Neonatal mice
genetically modified to express the elastase inhibitor elafin are protected against the adverse effects of
mechanical ventilation on lung growth. Am J Physiol Lung Cell Mol Physiol 303, L215-227
16. P a g e | 16
25. Getie, M., Schmelzer, C. E., and Neubert, R. H. (2005) Characterization of peptides resulting from
digestion of human skin elastin with elastase. Proteins 61, 649-657
26. Senior, R. M., Bielefeld, D. R., and Starcher, B. C. (1977) Comparison of the elastolytic effects of
human leukocyte elastase and porcine pancreatic elastase. Advances in experimental medicine and
biology 79, 249-261
27. Baldock, C., Oberhauser, A. F., Ma, L., Lammie, D., Siegler, V., Mithieux, S. M., Tu, Y., Chow, J. Y.,
Suleman, F., Malfois, M., Rogers, S., Guo, L., Irving, T. C., Wess, T. J., and Weiss, A. S. (2011) Shape
of tropoelastin, the highly extensible protein that controls human tissue elasticity. Proc Natl Acad Sci U
S A 108, 4322-4327