Presentació del tema 13 de l'assignatura de biologia de 2n de batxillerat.
Presentació preparada amb el llibre de 2n de Batxillerat Santillana i altres materials.
Presentació del tema 13 de l'assignatura de biologia de 2n de batxillerat.
Presentació preparada amb el llibre de 2n de Batxillerat Santillana i altres materials.
2024 State of Marketing Report – by HubspotMarius Sescu
https://www.hubspot.com/state-of-marketing
· Scaling relationships and proving ROI
· Social media is the place for search, sales, and service
· Authentic influencer partnerships fuel brand growth
· The strongest connections happen via call, click, chat, and camera.
· Time saved with AI leads to more creative work
· Seeking: A single source of truth
· TLDR; Get on social, try AI, and align your systems.
· More human marketing, powered by robots
ChatGPT is a revolutionary addition to the world since its introduction in 2022. A big shift in the sector of information gathering and processing happened because of this chatbot. What is the story of ChatGPT? How is the bot responding to prompts and generating contents? Swipe through these slides prepared by Expeed Software, a web development company regarding the development and technical intricacies of ChatGPT!
Product Design Trends in 2024 | Teenage EngineeringsPixeldarts
The realm of product design is a constantly changing environment where technology and style intersect. Every year introduces fresh challenges and exciting trends that mold the future of this captivating art form. In this piece, we delve into the significant trends set to influence the look and functionality of product design in the year 2024.
How Race, Age and Gender Shape Attitudes Towards Mental HealthThinkNow
Mental health has been in the news quite a bit lately. Dozens of U.S. states are currently suing Meta for contributing to the youth mental health crisis by inserting addictive features into their products, while the U.S. Surgeon General is touring the nation to bring awareness to the growing epidemic of loneliness and isolation. The country has endured periods of low national morale, such as in the 1970s when high inflation and the energy crisis worsened public sentiment following the Vietnam War. The current mood, however, feels different. Gallup recently reported that national mental health is at an all-time low, with few bright spots to lift spirits.
To better understand how Americans are feeling and their attitudes towards mental health in general, ThinkNow conducted a nationally representative quantitative survey of 1,500 respondents and found some interesting differences among ethnic, age and gender groups.
Technology
For example, 52% agree that technology and social media have a negative impact on mental health, but when broken out by race, 61% of Whites felt technology had a negative effect, and only 48% of Hispanics thought it did.
While technology has helped us keep in touch with friends and family in faraway places, it appears to have degraded our ability to connect in person. Staying connected online is a double-edged sword since the same news feed that brings us pictures of the grandkids and fluffy kittens also feeds us news about the wars in Israel and Ukraine, the dysfunction in Washington, the latest mass shooting and the climate crisis.
Hispanics may have a built-in defense against the isolation technology breeds, owing to their large, multigenerational households, strong social support systems, and tendency to use social media to stay connected with relatives abroad.
Age and Gender
When asked how individuals rate their mental health, men rate it higher than women by 11 percentage points, and Baby Boomers rank it highest at 83%, saying it’s good or excellent vs. 57% of Gen Z saying the same.
Gen Z spends the most amount of time on social media, so the notion that social media negatively affects mental health appears to be correlated. Unfortunately, Gen Z is also the generation that’s least comfortable discussing mental health concerns with healthcare professionals. Only 40% of them state they’re comfortable discussing their issues with a professional compared to 60% of Millennials and 65% of Boomers.
Race Affects Attitudes
As seen in previous research conducted by ThinkNow, Asian Americans lag other groups when it comes to awareness of mental health issues. Twenty-four percent of Asian Americans believe that having a mental health issue is a sign of weakness compared to the 16% average for all groups. Asians are also considerably less likely to be aware of mental health services in their communities (42% vs. 55%) and most likely to seek out information on social media (51% vs. 35%).
AI Trends in Creative Operations 2024 by Artwork Flow.pdfmarketingartwork
This article is all about what AI trends will emerge in the field of creative operations in 2024. All the marketers and brand builders should be aware of these trends for their further use and save themselves some time!
A report by thenetworkone and Kurio.
The contributing experts and agencies are (in an alphabetical order): Sylwia Rytel, Social Media Supervisor, 180heartbeats + JUNG v MATT (PL), Sharlene Jenner, Vice President - Director of Engagement Strategy, Abelson Taylor (USA), Alex Casanovas, Digital Director, Atrevia (ES), Dora Beilin, Senior Social Strategist, Barrett Hoffher (USA), Min Seo, Campaign Director, Brand New Agency (KR), Deshé M. Gully, Associate Strategist, Day One Agency (USA), Francesca Trevisan, Strategist, Different (IT), Trevor Crossman, CX and Digital Transformation Director; Olivia Hussey, Strategic Planner; Simi Srinarula, Social Media Manager, The Hallway (AUS), James Hebbert, Managing Director, Hylink (CN / UK), Mundy Álvarez, Planning Director; Pedro Rojas, Social Media Manager; Pancho González, CCO, Inbrax (CH), Oana Oprea, Head of Digital Planning, Jam Session Agency (RO), Amy Bottrill, Social Account Director, Launch (UK), Gaby Arriaga, Founder, Leonardo1452 (MX), Shantesh S Row, Creative Director, Liwa (UAE), Rajesh Mehta, Chief Strategy Officer; Dhruv Gaur, Digital Planning Lead; Leonie Mergulhao, Account Supervisor - Social Media & PR, Medulla (IN), Aurelija Plioplytė, Head of Digital & Social, Not Perfect (LI), Daiana Khaidargaliyeva, Account Manager, Osaka Labs (UK / USA), Stefanie Söhnchen, Vice President Digital, PIABO Communications (DE), Elisabeth Winiartati, Managing Consultant, Head of Global Integrated Communications; Lydia Aprina, Account Manager, Integrated Marketing and Communications; Nita Prabowo, Account Manager, Integrated Marketing and Communications; Okhi, Web Developer, PNTR Group (ID), Kei Obusan, Insights Director; Daffi Ranandi, Insights Manager, Radarr (SG), Gautam Reghunath, Co-founder & CEO, Talented (IN), Donagh Humphreys, Head of Social and Digital Innovation, THINKHOUSE (IRE), Sarah Yim, Strategy Director, Zulu Alpha Kilo (CA).
Trends In Paid Search: Navigating The Digital Landscape In 2024Search Engine Journal
The search marketing landscape is evolving rapidly with new technologies, and professionals, like you, rely on innovative paid search strategies to meet changing demands.
It’s important that you’re ready to implement new strategies in 2024.
Check this out and learn the top trends in paid search advertising that are expected to gain traction, so you can drive higher ROI more efficiently in 2024.
You’ll learn:
- The latest trends in AI and automation, and what this means for an evolving paid search ecosystem.
- New developments in privacy and data regulation.
- Emerging ad formats that are expected to make an impact next year.
Watch Sreekant Lanka from iQuanti and Irina Klein from OneMain Financial as they dive into the future of paid search and explore the trends, strategies, and technologies that will shape the search marketing landscape.
If you’re looking to assess your paid search strategy and design an industry-aligned plan for 2024, then this webinar is for you.
5 Public speaking tips from TED - Visualized summarySpeakerHub
From their humble beginnings in 1984, TED has grown into the world’s most powerful amplifier for speakers and thought-leaders to share their ideas. They have over 2,400 filmed talks (not including the 30,000+ TEDx videos) freely available online, and have hosted over 17,500 events around the world.
With over one billion views in a year, it’s no wonder that so many speakers are looking to TED for ideas on how to share their message more effectively.
The article “5 Public-Speaking Tips TED Gives Its Speakers”, by Carmine Gallo for Forbes, gives speakers five practical ways to connect with their audience, and effectively share their ideas on stage.
Whether you are gearing up to get on a TED stage yourself, or just want to master the skills that so many of their speakers possess, these tips and quotes from Chris Anderson, the TED Talks Curator, will encourage you to make the most impactful impression on your audience.
See the full article and more summaries like this on SpeakerHub here: https://speakerhub.com/blog/5-presentation-tips-ted-gives-its-speakers
See the original article on Forbes here:
http://www.forbes.com/forbes/welcome/?toURL=http://www.forbes.com/sites/carminegallo/2016/05/06/5-public-speaking-tips-ted-gives-its-speakers/&refURL=&referrer=#5c07a8221d9b
ChatGPT and the Future of Work - Clark Boyd Clark Boyd
Everyone is in agreement that ChatGPT (and other generative AI tools) will shape the future of work. Yet there is little consensus on exactly how, when, and to what extent this technology will change our world.
Businesses that extract maximum value from ChatGPT will use it as a collaborative tool for everything from brainstorming to technical maintenance.
For individuals, now is the time to pinpoint the skills the future professional will need to thrive in the AI age.
Check out this presentation to understand what ChatGPT is, how it will shape the future of work, and how you can prepare to take advantage.
A brief introduction to DataScience with explaining of the concepts, algorithms, machine learning, supervised and unsupervised learning, clustering, statistics, data preprocessing, real-world applications etc.
It's part of a Data Science Corner Campaign where I will be discussing the fundamentals of DataScience, AIML, Statistics etc.
Time Management & Productivity - Best PracticesVit Horky
Here's my presentation on by proven best practices how to manage your work time effectively and how to improve your productivity. It includes practical tips and how to use tools such as Slack, Google Apps, Hubspot, Google Calendar, Gmail and others.
The six step guide to practical project managementMindGenius
The six step guide to practical project management
If you think managing projects is too difficult, think again.
We’ve stripped back project management processes to the
basics – to make it quicker and easier, without sacrificing
the vital ingredients for success.
“If you’re looking for some real-world guidance, then The Six Step Guide to Practical Project Management will help.”
Dr Andrew Makar, Tactical Project Management
2024 State of Marketing Report – by HubspotMarius Sescu
https://www.hubspot.com/state-of-marketing
· Scaling relationships and proving ROI
· Social media is the place for search, sales, and service
· Authentic influencer partnerships fuel brand growth
· The strongest connections happen via call, click, chat, and camera.
· Time saved with AI leads to more creative work
· Seeking: A single source of truth
· TLDR; Get on social, try AI, and align your systems.
· More human marketing, powered by robots
ChatGPT is a revolutionary addition to the world since its introduction in 2022. A big shift in the sector of information gathering and processing happened because of this chatbot. What is the story of ChatGPT? How is the bot responding to prompts and generating contents? Swipe through these slides prepared by Expeed Software, a web development company regarding the development and technical intricacies of ChatGPT!
Product Design Trends in 2024 | Teenage EngineeringsPixeldarts
The realm of product design is a constantly changing environment where technology and style intersect. Every year introduces fresh challenges and exciting trends that mold the future of this captivating art form. In this piece, we delve into the significant trends set to influence the look and functionality of product design in the year 2024.
How Race, Age and Gender Shape Attitudes Towards Mental HealthThinkNow
Mental health has been in the news quite a bit lately. Dozens of U.S. states are currently suing Meta for contributing to the youth mental health crisis by inserting addictive features into their products, while the U.S. Surgeon General is touring the nation to bring awareness to the growing epidemic of loneliness and isolation. The country has endured periods of low national morale, such as in the 1970s when high inflation and the energy crisis worsened public sentiment following the Vietnam War. The current mood, however, feels different. Gallup recently reported that national mental health is at an all-time low, with few bright spots to lift spirits.
To better understand how Americans are feeling and their attitudes towards mental health in general, ThinkNow conducted a nationally representative quantitative survey of 1,500 respondents and found some interesting differences among ethnic, age and gender groups.
Technology
For example, 52% agree that technology and social media have a negative impact on mental health, but when broken out by race, 61% of Whites felt technology had a negative effect, and only 48% of Hispanics thought it did.
While technology has helped us keep in touch with friends and family in faraway places, it appears to have degraded our ability to connect in person. Staying connected online is a double-edged sword since the same news feed that brings us pictures of the grandkids and fluffy kittens also feeds us news about the wars in Israel and Ukraine, the dysfunction in Washington, the latest mass shooting and the climate crisis.
Hispanics may have a built-in defense against the isolation technology breeds, owing to their large, multigenerational households, strong social support systems, and tendency to use social media to stay connected with relatives abroad.
Age and Gender
When asked how individuals rate their mental health, men rate it higher than women by 11 percentage points, and Baby Boomers rank it highest at 83%, saying it’s good or excellent vs. 57% of Gen Z saying the same.
Gen Z spends the most amount of time on social media, so the notion that social media negatively affects mental health appears to be correlated. Unfortunately, Gen Z is also the generation that’s least comfortable discussing mental health concerns with healthcare professionals. Only 40% of them state they’re comfortable discussing their issues with a professional compared to 60% of Millennials and 65% of Boomers.
Race Affects Attitudes
As seen in previous research conducted by ThinkNow, Asian Americans lag other groups when it comes to awareness of mental health issues. Twenty-four percent of Asian Americans believe that having a mental health issue is a sign of weakness compared to the 16% average for all groups. Asians are also considerably less likely to be aware of mental health services in their communities (42% vs. 55%) and most likely to seek out information on social media (51% vs. 35%).
AI Trends in Creative Operations 2024 by Artwork Flow.pdfmarketingartwork
This article is all about what AI trends will emerge in the field of creative operations in 2024. All the marketers and brand builders should be aware of these trends for their further use and save themselves some time!
A report by thenetworkone and Kurio.
The contributing experts and agencies are (in an alphabetical order): Sylwia Rytel, Social Media Supervisor, 180heartbeats + JUNG v MATT (PL), Sharlene Jenner, Vice President - Director of Engagement Strategy, Abelson Taylor (USA), Alex Casanovas, Digital Director, Atrevia (ES), Dora Beilin, Senior Social Strategist, Barrett Hoffher (USA), Min Seo, Campaign Director, Brand New Agency (KR), Deshé M. Gully, Associate Strategist, Day One Agency (USA), Francesca Trevisan, Strategist, Different (IT), Trevor Crossman, CX and Digital Transformation Director; Olivia Hussey, Strategic Planner; Simi Srinarula, Social Media Manager, The Hallway (AUS), James Hebbert, Managing Director, Hylink (CN / UK), Mundy Álvarez, Planning Director; Pedro Rojas, Social Media Manager; Pancho González, CCO, Inbrax (CH), Oana Oprea, Head of Digital Planning, Jam Session Agency (RO), Amy Bottrill, Social Account Director, Launch (UK), Gaby Arriaga, Founder, Leonardo1452 (MX), Shantesh S Row, Creative Director, Liwa (UAE), Rajesh Mehta, Chief Strategy Officer; Dhruv Gaur, Digital Planning Lead; Leonie Mergulhao, Account Supervisor - Social Media & PR, Medulla (IN), Aurelija Plioplytė, Head of Digital & Social, Not Perfect (LI), Daiana Khaidargaliyeva, Account Manager, Osaka Labs (UK / USA), Stefanie Söhnchen, Vice President Digital, PIABO Communications (DE), Elisabeth Winiartati, Managing Consultant, Head of Global Integrated Communications; Lydia Aprina, Account Manager, Integrated Marketing and Communications; Nita Prabowo, Account Manager, Integrated Marketing and Communications; Okhi, Web Developer, PNTR Group (ID), Kei Obusan, Insights Director; Daffi Ranandi, Insights Manager, Radarr (SG), Gautam Reghunath, Co-founder & CEO, Talented (IN), Donagh Humphreys, Head of Social and Digital Innovation, THINKHOUSE (IRE), Sarah Yim, Strategy Director, Zulu Alpha Kilo (CA).
Trends In Paid Search: Navigating The Digital Landscape In 2024Search Engine Journal
The search marketing landscape is evolving rapidly with new technologies, and professionals, like you, rely on innovative paid search strategies to meet changing demands.
It’s important that you’re ready to implement new strategies in 2024.
Check this out and learn the top trends in paid search advertising that are expected to gain traction, so you can drive higher ROI more efficiently in 2024.
You’ll learn:
- The latest trends in AI and automation, and what this means for an evolving paid search ecosystem.
- New developments in privacy and data regulation.
- Emerging ad formats that are expected to make an impact next year.
Watch Sreekant Lanka from iQuanti and Irina Klein from OneMain Financial as they dive into the future of paid search and explore the trends, strategies, and technologies that will shape the search marketing landscape.
If you’re looking to assess your paid search strategy and design an industry-aligned plan for 2024, then this webinar is for you.
5 Public speaking tips from TED - Visualized summarySpeakerHub
From their humble beginnings in 1984, TED has grown into the world’s most powerful amplifier for speakers and thought-leaders to share their ideas. They have over 2,400 filmed talks (not including the 30,000+ TEDx videos) freely available online, and have hosted over 17,500 events around the world.
With over one billion views in a year, it’s no wonder that so many speakers are looking to TED for ideas on how to share their message more effectively.
The article “5 Public-Speaking Tips TED Gives Its Speakers”, by Carmine Gallo for Forbes, gives speakers five practical ways to connect with their audience, and effectively share their ideas on stage.
Whether you are gearing up to get on a TED stage yourself, or just want to master the skills that so many of their speakers possess, these tips and quotes from Chris Anderson, the TED Talks Curator, will encourage you to make the most impactful impression on your audience.
See the full article and more summaries like this on SpeakerHub here: https://speakerhub.com/blog/5-presentation-tips-ted-gives-its-speakers
See the original article on Forbes here:
http://www.forbes.com/forbes/welcome/?toURL=http://www.forbes.com/sites/carminegallo/2016/05/06/5-public-speaking-tips-ted-gives-its-speakers/&refURL=&referrer=#5c07a8221d9b
ChatGPT and the Future of Work - Clark Boyd Clark Boyd
Everyone is in agreement that ChatGPT (and other generative AI tools) will shape the future of work. Yet there is little consensus on exactly how, when, and to what extent this technology will change our world.
Businesses that extract maximum value from ChatGPT will use it as a collaborative tool for everything from brainstorming to technical maintenance.
For individuals, now is the time to pinpoint the skills the future professional will need to thrive in the AI age.
Check out this presentation to understand what ChatGPT is, how it will shape the future of work, and how you can prepare to take advantage.
A brief introduction to DataScience with explaining of the concepts, algorithms, machine learning, supervised and unsupervised learning, clustering, statistics, data preprocessing, real-world applications etc.
It's part of a Data Science Corner Campaign where I will be discussing the fundamentals of DataScience, AIML, Statistics etc.
Time Management & Productivity - Best PracticesVit Horky
Here's my presentation on by proven best practices how to manage your work time effectively and how to improve your productivity. It includes practical tips and how to use tools such as Slack, Google Apps, Hubspot, Google Calendar, Gmail and others.
The six step guide to practical project managementMindGenius
The six step guide to practical project management
If you think managing projects is too difficult, think again.
We’ve stripped back project management processes to the
basics – to make it quicker and easier, without sacrificing
the vital ingredients for success.
“If you’re looking for some real-world guidance, then The Six Step Guide to Practical Project Management will help.”
Dr Andrew Makar, Tactical Project Management
Beginners Guide to TikTok for Search - Rachel Pearson - We are Tilt __ Bright...
Com "parlen els gens".Fundació Dr.Robert.2009 Sl
1. GUIÓ
Que és el material genètic?
Com es transmet la informació del nucli a la resta de la
cèl·lula?
Jornades Formatives en MALALTIES MINORITÀRIES Com es tradueix i com s’executa la informació?
Curs 2009-210 El codi genètic es pot alterar?
Què son les mutacions?
Com “parlen” els gens? Quina relació hi ha entre mutació , producte gènic alterat
i malaltia?
Dra.Teresa Pàmpols i Ros L’expressió clínica és molt variable. Per què?
Institut de Bioquímica Clínica. Servei de Bioquímica i Genètica molecular. Com es transmeten les malalties genètiques a la descendència?
Hospital Clínic de Barcelona i Perquè les malalties hereditàries tenen prevalences tan
(tpampols@clinic.ub.es) baixes?
Dins el nucli d’una
De fet, els gens “parlen” bioquímica cèlula hi ha
enmagatzemada la
informació per a la
Com ho fan ? constitució del ser viu
del qual procedeix : el
Que és el material genètic? material genètic
Guanina
Adenina
Timina
Citosina
El material genètic es l’àcid desoxiribonucleic
(ADN)=desoxiribosa + fosfat+ bases nucleotídiques
1
2. 3’
L’ADN es una enciclopedia que enmagatzema tota la A A A
3’
C C T
G
informació mitjançant un senzill alfabet de 4 lletres T T C T
T A
G G C
ATGTTGACCTGATCGAAATGGATCCTCTCTCGACTATAACCAATGATG G enlace de
A
GAAATGGATCATGTTGACCTGATCGATCCTCTCTCGACTTTGACCTGC 5’ base hidrógeno 5’
ATGATGCCTAGCATGTTGACCTGATCGAAATGGATCCTCTCTCGACTA
GGATCCTCTCTCGACTATAACCAATGATGCCTAGCACATGTTGACCTG
CGACTATAACCAATGATGCCTAGCATGTTGACCTGATCGAAATGGATC
Una molècula d’ADN, està constituïda per dues cadenes amb
CTAGCCAATGATGCCTAGCCAATGATGCCTAGCATGATGCCTAGCTTG seqüències de nucleòtids complementaries, generant una doble hèlix
TGGATCCTCTCTCGACTATAACCAATGATGCCTAGATGTTGACCTGAT de aproximadament 10 parelles de nucleòtids per volta de la hèlix.
GGATCCTCTCTCGACTATAACCAATGATGCCTAGCACATGTTGACCTG
CCTGATCGAAATGGATCCTCTCTCGACTATAACCAATGATGCCTAGCA
ATGTTGACCTGATCGAAATGGATCCTCTCTCGACTATAACCAATGATG
CTAGCCAATGATGCCTAGCCAATGATGCCTAGCATGATGCCTAGCTTG
GACTATAACCAATGATGCCTAGCACATGTTCTAGCCAATGATGCACA
TGTTCTAGCCCTAGCCAATGATGCCTAGCATGATGCCTAGCTTGTGATG
Biología Molecular de la Célula B. Alberts, D. Bray, J. Lewis, M. Raff, K. Roberts, JD. Watson. Ed. Omega (1994)
MAGNITUD DEL ADN
oòcit espermatozous
El DNA del nucli d’una cèl·lula reproductora és un doble
filament en espiral de 1 m de longitud que conte 3 x 109
parells de bases
cèl.lula de la pell
Les 3 x 109 parells de bases (lletres) del genoma haploide
El nucli d’una cèl·lula somàtica te dos filaments , el
(d’una cèl·lula germinal) escrites una darrera l’altra
procedent del pare i el procedent de la mare, es a dir 2
ocuparien 200 volums de 1000 pàgines cadascun
metres de DNA
L’ADN está “empaquetat”dins el nucli Quan una cèl·lula es divideix , el material genètic s’ha de
replicar i repartir en les dues cèl·lules filles ( mitosis). Per a
evitar errors l’ADN es reparteix en paquets petits densament
empaquetats (cromosomes)
Fibras de cromatina
Empaquetamiento Grado 6
60% proteína
Cromatina 35% DNA
5% RNA
1879-1872 Arnold y Fleming : Primeres observacions de cromosomes en mitosis
Principios de Bioquímica. Lehninger 1986
2
3. 46 cromosomes
2 metres DNA
µ
5µm
600mg/mL (70% pes)
µ
25µm
Cromosoma Metafàsic
Empaquetament
Cèl·lula somàtica 1.000-10.000
vegades
Nucli en metafase
Principios de Bioquímica. Lehninger 1986
1956 Tjio & Levan : Tenim 46 cromosomas
La informació de la enciclopèdia (l’ADN) està El GEN es la unitat física i funcional de la herència
organitzada en frases (gens) i les frases en paraules i la majoria conté informació per a elaborar una
(codons ) formats per 3 lletres (les 4 bases proteïna
nucleotídiques)
Molts gens tenen un tamany de unes 100.000
ATGTTGACCTGATCGAAATGGATCCTCTCTCGACTATAACCAATGATG
GAAATGGATCATGTTGACCTGATCGATCCTCTCTCGACTTTGACCTGC parells de bases.
ATGATGCCTAGCATGTTGACCTGATCGAAATGGATCCTCTCTCGACTA
GGA TCC TCT CTC GAC TAT AAC CAA TGA TGC CTA GCA CAT GTT GAC
CGA CTA TAA CCA ATG ATG CCT AGC ATG TTG ACC TGA TCG AAA TGG
Hi ha gens molt grans : el gen de la Distrofina te
CTA GCC AAT GAT GCC TAG CCA ATG ATG CCT AGC ATGA TGC CTA ATC 2.4 Mb
CTC TCT CGA CTA TAA CCA ATG ATG CCT AGA TGT TGA CCT GAT
GGATCCTCTCTCGACTATAACCAATGATGCCTAGCACATGTTGACCTG
CCTGATCGAAATGGATCCTCTCTCGACTATAACCAATGATGCCTAGCA ( 1 Megabase = 1.000.000 de parells de bases)
ATGTTGACCTGATCGAAATGGATCCTCTCTCGACTATAACCAATGATG
CTAGCCAATGATGCCTAGCCAATGATGCCTAGCATGATGCCTAGCTTG
GAC TAT AAC CAA TGA TGC CTA GCA CAT GTT CTA GCC AAT GAT GCA CA
El genoma humà te 3.200 Mb
TGT TCT AGC CCT AGC CAA TGA TGC CTA GCA TGA TGC CTA GCT TGT
Només 1,4 % del genoma es codificant
Tenim també un petit genoma mitocondrial: ADN mt 14 d’abril de 2003
Es circular i te 13.6 Kb “Wellcome to the Genomic Age”
S’hereta exclusivament per línia
materna
www.genome.gov
3
4. Nature, 21 Oct. 2004
¡¡ Sorpresa, Sorpresa !!
Només tenim 19.599 gens codificadors de
proteïnes
( de fet son uns 25.000)
www.ncbi.nih.gov/Genbank
www.genome.ucsc.edu
www.ensembl.org
www.ddbj.nih.ac.jp
www.ebi.ac.uk/embl/index.html
Wadsworth Center
Els gens es distribueixen en cada un dels cromosomes Diem locus a la posició fixa d’un gen en un
sempre de la mateixa manera (MAPA) cromosoma
ex. el locus del gen OCA 1 es 11q 1.4-q 2.1
Gen A
Gen B metafase La distancia entre gens es medeix en
Gen C centimorgans
Gen D
Gen E 1 centimorgan = 1.000.000 de parells de bases
Gen F
Gen G
La llista ordenada de loci es denomina mapa
¡Recordeu! Cèl·lules somàtiques: 46 cromosomes, formats per genètic
Desierto génico
gens i proteïnes que es localitzen en el núcli, 23 procedents del
pare amb els 25.000 gens paterns i 23 procedents de la mare
amb els 25.000 gens materns. Al tenyir el nucli en metafase
Diem al.lel a la variant de la secuencia d’ADN en
veiem els cromosomes individualitzats i “bandejats” un determinat locus
La informació continguda en l’ADNdel nucli es
transmet al citoplasma de la cel.lula mitjançant
l’ARN
Com es transmet la informació del
nucli a la resta de la cèl·lula?
i Procés
Transcripció de l’ADN a ARNp(precursor)
Com es tradueix i com s’executa la
informació? “Splicing” a ARNm (missatger)
Traducció a un producte gènic
4
5. L’ARN es un esquelet de ribosa Quan un gen s’ha d’expressar o “encendre” s’obre la doble
hèlix de l’ADN a l’ inici del gen i la RNA polimerasa va
fosfat i 4 bases nucleotídicas ensamblant les bases nucleotídiques complementaries
G C A i U ( en lloc de T) formant un RNA precursor
Es diu procés de transcripció
Intensificador
TRANSCRIPCIÓ
Silen
ciad
or
L’expressió dels gens a nivell transcripcional es complexa i
Represor regulada per factors controladors
In
or
t en
Activador
icad
sif Inclòs un cop transcrit el RNAp hi ha regulació ( per el
ica
do
nsif
r splicing, per a l’exportació del ARNm al citoplasma i per a la
Inte
Activador seva estabilitat)
Activador
L'expressió gènica es la base de la diferenciació cel·lular,
250 40
morphogenèsis i adaptabilitat de l’organisme
30
110 60 BETA H Depèn de mecanismes anomenats epigenètics
30
ALFA
150 E
80 Proteína F Polimerasa
Metilació del ADN
de unión a TATA de ARN Regió
A B
Xifrada
Silenciació de gens
Modificacions d’histones
Bloque TATA
Centre promotor Proteïnes modificadores de la cromatina
R.Tjian “Mecanismo molecular del control génico”. Investigación y Ciencia. Abril 1995
Un gen te introns i exons
l’ADN del gen es transcriu sencer pero nomes es tradueixen els introns
Els mecanismes epigenètics son responsables de la
inactivació al atzar d’un dels cromosomes X en les Intró 1 Intró 2 Intró 3
cèl.lules dels fetus de sexe femení en les primeres etapes P exó 1 exó 2 exó 3
del desenvolupament RNAp
“splicing”
Son malaltíes epigenètiques : Les sídromes de Rett,
Angelman , Prader –Willi i Beckwith-Wiedemann RNAm
traducció
Producte gènic
5
6. CÓDI GENÈTIC
Ampliem el concepte traducció:
AMINOÁCIDS CODONS
A Ala Alanina GCA GCC GCG GCU
Un cop fora del nucli la seqüència de l’ARN m C Cys Cisteína UGC UGU
es llegida per uns agregats moleculars : D Asp Acid aspártic GAC GAU
ribosomes
K Lys Lisina AAA AAG
Cada triplet o codó te el significat d’un
aminoàcid Els aminoàcids es fixen a molècules Y Tyr Tirosina UAC UAU
d’ARN petites de RNAt (transferència)
i es van ensamblant i formant un polipèptid Hi han 20 aminoàcids i 64 combinacions de triplets possibles ,
la majoria d'aminoàcids està especificat per mes d’un codò
Traducció
¡¡¡¡Un polipèptid de 400 aminoacids
es sintetitza en 20 segons!!!!!
Els 4 passos de la formació de proteïnes
Repàs
núcli
ADN intró exó
TRANSCRIPCIÓ
1. Transcripció y traducció 2. Plegament
ARN p
“SPLICING”
RNAm
Producte gènic =
TRADUCCIÓ 3. Modificacions post traducció 4. Interacció proteïna-proteïna
Polipèptid/Proteïna
The Promise of Proteomics.
New York Academy of Sciences. January 31, 2001. www.nyas.org
6
7. ¡Hi ha moltes mes proteïnes que gens !
(25.000 gens / 200.000 proteïnes)
Un gen pot donar lloc a diversos El codi genètic es pot alterar?
“transcrits” o PRODUCTES GÈNICS
(polipéptids/proteínes)
Què son les mutacions?
“Splicing” alternatiu
Quan una cèl·lula entra en divisió s’ha de replicar tot
l’ADN
50 enzims reparadors Errors de
Polimerització :1 en 10 -4
40 enzims correctors Errors de
replicació : 1 en 10 -10
La forquilla de replicació avança a la velocitat de 50 nucleotids / segon
Al duplicar el genoma s’ensamblen 1,2 x 10 10 El doble filament de l’ DNA se ha de desenrotllar y l’helix paterna gira
nucleotids a 50 revolucions/segon (3000 rpm)
“ La celula Viva” .C.de Duve.Biblioteca Scientific American . Labor 1998
Amb una freqüència al voltant de 10-6 es produeixen Les mutacions en una cèl·lula somàtica poden
errors en la replicació de l’ADN ser rellevants per al càncer o envelliment i
només concerneixen a l’individu , però no a la
Mutació = canvi estable i hereditari en la seqüència seva descendència*
primària de nucleòtids de l’ADN que afecta la salut
Les mutacions han d’estar en les cèl·lules
germinals per a tenir impacte en la
Excepcionalment poden ser inestables i el
descendència d’un individu
descobriment de la expansió de triplets ens ha
permès explicar malalties com el Huntington, la Les mutacions poden ser també produïdes per
distròfia miotònica y la síndrome X-fràgil , factors mediambientals ( productes tòxics,
radiacions ionitzants)
* son excepció els càncers familiars
7
8. El terme mutacions s’empra només per als
canvis en l’ADN que afecten la salut
Altres canvis es diuen polimorfismes Els essers humans tenim un genoma 99,9%
contribueixen a la diversitat humana, permeten idèntic
canvis adaptatius i son la base de la evolució El 0,1% del genoma que ens fa diferents pot
Si mateix , polimorfismes en el gen o en altres contenir les causes de que les persones
locus poden modificar el genotip enmalalteixin per agents infecciosos,
exposicions ambientals i comportaments o
Hi ha polimorfismes (SNPs) que combinats estils de vida
amb factors mediambientals confereixen
susceptibilitat a malalties comunes
Magnitud de les mutacions Tipus de mutacions puntuals . Hem dit que els gens son
Mutacions molt grans (millions de parells de bases) frases amb significat formats per paraules de tres lletres
S’altera la morfología i/o número dels cromosomes
Son visibles al microscopio observant el nucli en metafase
ATGCCTACTT ATG CCA TTG ATTCCCAA
( Citogenètica)
Mutaciones de < 2.000-3.000Kb
aa1 aa2 aa3 POLIPEPTID
Visibles emprant sondas moleculars (FISH etc.)
Mutaciones puntuals (delecions, insercions o canvis d’una
única base)
“Visibles” amb els ull de la bioquímica emprant els
recursos recursos de la Genètica bioquímica i la Genètica
XBNMLANFK SAL DEL MAR ALKSFJLKJ
molecular
Tipus de mutacions puntuals Que passa quan trobem un canvi en l’ADN d’un
pacient . Es una mutació o és un polimorfisme?
Vull més SAL DEL MAR seqüència normal
• Sabem que les mutaciones que truncan la proteïna , petitess
insercione/delecions, mutacions que creen un codón “stop” o
Vull més SOL DEL MAR substitució; error de sentit mutacions de “splicing”
“missense”
Vull més SI L DEL MAR substitució; pèrdua de sentit
“nonsense”o absurda* Son causa de la malaltia
Vull més SALD ELM AR deleció; pèrdua de sentit
“frame shift” o amb desplaçamento de motlle*
Vull més SAX LDE LM inserció; pérdua de sentit • Les mutaciones que només cambien un AA
son causa de la malaltia o un polimorfisme?
Canvi en la proteïna
8
9. 1er es mira si la mutación està descrita a la bibliografía,
si no ho està:
• Comparem la nostra proteïna amb la d’altres
espècies (si es conserva el residu o no)
• Mirem la importància del canvi de AA per a la
funció de la proteïna Quina relació hi ha entre mutació , producte gènic
• Ens assegurem que no hem trobat un altre canvi alterat i malaltia?
en el gen
• Estudis de expressió
• Verifiquem si el canvi es troba en 50 individus
de població general ( 100 al.els)
Un exemple, la Fenilcetonuria
Transcripció a ARN Traducción La de tirosina producció
a producte gènic
(polipéptid/proteína) pigments i síntesi de
neurotransmisors
ADN
Producte gènic
de fenilalanina en plasma
Víes/Productes Metabólics Desequilibri amb D’acids fenilpiruvic i
altres aminoàcids fenil làctic
Efecte tòxic sobre el sistema nerviós .
Síntesi de mielina deficient
Olor corporal
La mutació es tradueix en un canvi en el patró del seu producte gènic específic
Fenotipo
La pèrdua de funció altera la homeostàsi fisiològica induint les manifestacions
(Fenoma)
Fenoma)
clíniques i la malaltia
Expressió fenotípica per sistemes anatòmic/funcionals
L’afectació del sistema nerviós és molt frequent perquè
Muscular/Esquelè
gairebe un 80 % dels nostres gens estàn relacionats directa o
indirectament amb el seu funcionament
Sistema
Nerviós
40,0
Ocular
30,0
Craneofacial
Genitourinari
Metabòlic
Pell
Ungles, Immune
Extremitats
Circulatori
MBID 8 20,0
Sang
Endocrí
Cabell
Dents
Respiratori
10,0
0,0
Basat en: MBID 8: Cap.1 pàg. 3-125 (L.Beaudet, Ch.Scriver, N.Sly, D.Valle)
9
10. Un 80% debuta a l’edat pediàtrica
5%
In utero
Edad adulta tardía
>50 años
Es coneixen les
Pubertad - 50 anys
bases metabòliques
>50% i moleculars de
Neonatal - 1 año unes 700 malalties
hereditàries
30%
1 año - pubertad
Jiménez-Sánchez et al. capítol 4 del MMBID 8
El coneixement de les bases
metabòliques , de la fisiopatología i dels L’expressió clínica és molt variable
mecanismes moleculars, incloent el gen ,
i els processos de transcripció i Per què?
traducció son fonamentals per a
dissenyar teràpies
El fenòmen de la heterogeneitat genètica
Las variacions en un gen no afecten sempre de la HETEROGENEITAT NO AL.LÈLICA O DE LOCUS
mateixa manera a la proteïna Mutacions a diferents locus genètics poden donar lloc a la
mateixa malaltía
Les MH presenten una gran heterogeneïtat genètica e.x. gangliosidosis GM2
• Els pacients amb una mateixa malaltia no
son un grupo homogèni HETEROGENEITAT AL.LÈLICA
• Fins i tot amb la mateixa mutació poden ser En un mateix locus es poden donar moltes mutacions
diferents diferents
e.x. Duchenne i Becker
Hurler i Scheie
10
11. β-hexosaminidasa
Exemple de heterogeneitat de locus: Les gangliosidosis GM2 A LA HETEROGENEITAT AL·LÈLICA es molt més
freqüent , gairebé general.
Hexosaminidasa A β
En moltes malalties les mutacions arriben a ser
α “privades” o “propietàries” de cada família.
β Sovint els pacients que diem homozigots són en realitat
“compostos genètics”. Amb la qual cosa l'individu
α Gangliosid estarà produint dos tipus de proteïnes diferents.
activador-GM2
GM2
A tot això cal afegir les següents consideracions que
contribueixen a la variabilitat de presentació clínica en
els pacients amb una mateixa malaltia:
Model de la degradació del gangliosid GM2 per la ß-Hex A estimulada per l’activador.
MMBID 8 pàg 3374 (modificada de W. Fürt i K. Sandhoff. BBA 1126:1, 1992
El fenotip clàssic sever es dona p. ex. quan : Mutació Mutació
suau severa
No es produeix un producte gènic funcional Efecte de mutacions “missense” Neutre Sever
Quan la mutació altera severament la funció de la proteïna Efecte de factors cel.lulars:
Control de qualitat/temperature
PERÒ Funció residual de la proteïna Alta Baixa
Efecte d’altres factors
Sovint hi ha un continuum de expressió mes suau provenint de
mutacions que permeten una funció residual de la proteïna Probabilitat de malaltía clínica Asimptomàtic Malaltia clínica
DINTELL PER A LA MALALTÍA CLÍNICA
J. Inherit. Metab. Dis (2001) 24:189-212
Transcripció a ARN Traducción
a polipéptid/proteína
La funció residual de la proteïna pot ser ADN Factors epigenétics
influenciada per :
Factors ambientals que estressen las vies metabòliques
Aconteixements post-traducció i factors cel·lulars Producte gènic
Procesament
Gens situats en altres locus Post-traducción e Efectes Ambientals
intervenció + gens altres locus
de factors cel.lulars
Víes/Productes Metabólics
El genotip no sempre prediu el fenotip i
una malaltia monogènica es pot
comportar com un trastorn complexe
11
12. Concepte de penetrança
G6PD deficiency
Hemochromatosis
Freqüència amb la que la característica que
controla un gen (fenotip) es fa visible en els
Paper creixent de factors
ambientals i estocàstics
Acute intermittent porphyria
Type I diabetes mellitus
individus que el tenen alterat
α1-Antitrypsin ZZ
Apo E-2/E-2 hyperlipoproteinemia ex. malaltía de Tay-Sachs
Tuberous sclerosis
Marfan Els gens amb penetrança baixa requereixen la
Retinoblastoma Hartnup
Phenylketonuria Familial hypercholesterolemia
interacció amb factors ambientals
Ej. genotip lent NAT2 aumenta el risc de cáncer de
Sickle-cel anemia
Cystic fibrosis bufeta en individus exposats a arilaminas , però es
Huntington disease
Duchenne distrophy inefectiu si no hi ha exposició
0 Tay Sachs
0
Paper creixent dels genotips d’altres loci
Quan un gen juga un paper predominant en la determinació
d’una malaltia , aquesta s’hereta de forma monogènica
o mendeliana (segueix les lleis de Mendel)
20% AD
Com es transmeten les malalties
genètiques a la descendència? 8%
Herència
60% AR 12% XL Herencia
materna
mtDNA
Herencia Autosòmica Recesiva
A a A a
A a A a
A A A a a A a a
1/4
25% No portadors 1/2
50%Portadors 25%Malalts
1/4
(Homocigots)
(Heterocigots)
12
13. HERENCIA AUTOSÒMICA DOMINANT Si en la família del esquema anterior la malaltia fos autosòmica
dominant , estarien clínicament afectats un 75% dels fills
Però és mes comú que només un dels dos progenitors sigui
heterozigot i aleshores estaran afectats un 50% dels fills
Es diu que un caràcter s’hereta en forma dominant
quan els heterozigots presenten clínica
Depèn en gran part, de la tolerància del sistema
biològic a la pertorbació de la proteïna
Herència gonosómica Lligada al X
AX X a AX Y a
A X a X Axxx
X a Y
X AY aX X A a X Y a
A X XA X Y
Nena no portadora Nen no portador Nena portadora Nen malalt
(heterozigota) (hemizigot)
Estaràn afectats 50% dels nens i serán portadoras 50% de les nenes
En una malaltía lligada al X , la mutació també pot
aparèixer per primer cop en el cromosoma X d’un
home
Totes les nenes de la parella portaran un X de la
mare i el X del pare amb la mutació , per tant seran
totes heterozigotes i no serà fins la segona generació
que apareixeran nens afectats
Exemples d’arbres familiars amb els tres tipus d’herència
mendeliana descrits
13
14. HI HA 3 CATEGORÍES DE MALALTIES GENÈTIQUES Com es transmeten a la descendència
HERENCIA HERÈNCIA NO
• TRASTORNS CROMOSÓMICS : Constitucionals i adquirides
MENDELIANA MENDELIANA
Trastorns monogènics
• TRASTORNS MENDELIANS O MONOGÈNICS
Autosòmica Recesiva
Anomalies Cromosomiques
Gonosòmica Lligada al X
• TRASTORNS POLIGÈNICS O MULTIFACTORIALS Trastorns Multifactoriales
Causats per la interacció de múltiples gens i factores ambientals, entre els Autosòmica Dominante
quals hi han algunes de las malalties corrents de la edat adulta com la Alteracions del Genoma
diabetis i les malalties coronaries
Gonosómica Dominant
mitocondrial
lligada al X
El zigot te un sol genoma nuclear heretat del pare i de la mare , però
te diversos genomas mitocondrials (poliplasmia) que hereta només de
la mare i no tots tenen la mutació (heteroplasmia)
Moltes malalties mitocondrials son de transmissió
mendeliana perquè els gens que controlen la S
majoría de les proteïnes mitocondrials son nuclears
Hi ha un grup més petit de proteïnes , controlades O
Poliplasmia y
pel genoma mitocondrial i aleshores les mutacions
heteroplasmia
es transmeten amb el que s’anomena “herència
Z (Zigot)
materna”, perquè el zigot conté només les
mitocondries del òvul matern ja que les del Els teixits reben
espermatozou es perden Segregació mitocondries
normal i mutades
replicativa de manera aleatòria
A B C
Un noi afectat per una malaltia lligada al genoma mitocondrial , no pot
transmetre mai la malaltia a la descendència , en canvi si la que està
afectada es una noia , tots els fills ho estaran
Perquè les malalties hereditàries tenen
prevalences tan baixes?
14
15. Les malalties genètiques pertanyen majoritàriament a
la categoria de malalties rares o de baixa prevalença, La freqüència de una malaltia genètica en la població depèn de:
un 80% fins i tot estan per sota de 1 en 100.000
La tassa de mutacions
El patró d'herència
Desavantatges que confereix la mutació
Successos distorsionadors ( naturals o socials)
www.orpha.net
Però en el cas d’una malaltia recessiva , el gen mutat està present
en els heterozigots sans i amb la mateixa tasa de mutació de 10-6 i
Quan una mutació altera la funció del gen i porta a la mateixa frequencia de l’homozigot de 1 en 1 milió , la
una desavantatge , la mutació tendeix a desaparèixer freqüència del heterozigot al equilibri es 1 en 1000
de la població , però contínuament apareixen noves
Quan la frequencia d’una malaltía es multiplica per 10 o per 100
mutacions en cada generació i s'arriba a un equilibri
en algunes poblacions , pot ser per:
entre mutació que dona lloc a un gen deletèri i
selecció natural que l’elimina de la població. Efecte fundador
Com a promitg , la tassa de mutació per generació i Aventatges pel fet d’esser heterozigot :
gen es molt baixa ap. 10-6 i per un trastorn dominat Anèmia falciforme protecció en front la malaria
letal, la freqüència del gen al equilibri es de 1 en 1
Fibrosis quística protecció en front el tifus i malalties
milió
diarreicas
Fenilcetonuria incidencia de pèrdues fetals
Val la pena remarcar que cadascun de nosaltres portem
de 6 a 8 anomalies genètiques recessives i si alguna
coincideix amb les de la parella podem tenir fills afectats
Tenim uns 25.000 gens i per això es molt difícil coincidir
15