Abstract Background: Traditional Chinese medicine (TCM) syndrome, also named syndrome, are comprehensive and integral analyses of clinical information which helps to guide different individualized treatment prescriptions. Methods: Thirty healthy controls and 80 colorectal cancer (CRC) patients (including 33 Spleen Qi Deficiency syndrome, 23 Dampness Heat syndrome, 17 Blood Stasis syndrome and 7 other syndrome) were enrolled into this study. Human mRNAs were extracted from peripheral blood mononuclear cells. The gene expression for CRC patients with different TCM syndrome was determined by microarray and qRT-PCR. Results: Spleen Qi Deficiency, Dampness Heat and Blood Stasis were the most common syndromes in CRC patients. There is a significant difference was found in mRNA expression levels (especially for PIK3CA, STAT3, SOX9 and KDM5C) among Spleen Qi Deficiency, Dampness Heat and Blood Stasis syndrome groups. The higher mRNA levels of JNK1, TP53, MLH1, MSH6, PMS2, SOCS3, TCF7L2, FAM123B, PSAP, FBXW7, SALL4 and the lower expression of inflammatory cytokine IL-6 were found in Spleen Qi Deficiency group but not other syndrome types. The higher mRNA levels of KRAS, MUC16, EGFR, GRASP65, PIK3CA, MAPK7, CD24, STAT3, SLC11A1, Bcl-2, TXNDC17 and some inflammatory cytokines (IL-6, IL-23, TNF-a, CXCR4) were found in Dampness Heat group but not other syndrome types. Blood Stasis syndrome showed higher expression of SOX9, MLH1, MSH6, KDM5C, PCDH11X, PSAP and SALL4, and lower mRNA levels of PIK3CA, CD24, STAT3, CXCR4, TXNDC17 and TP53. The CRC patients with Dampness Heat syndrome might have a poor prognosis than other syndrome types. Conclusion: The identification of syndrome conditions had different impacts on CRC prognosis, and which might be related with different mRNA expression levels. Some oncogenes and pro-inflammatory cytokines were highly expressed in Dampness Heat group but not other syndrome types, suggesting that the CRC patients with Dampness Heat syndrome might have a poor prognosis. Our results prelimitarily uncovered the molecular basis of syndrome differences in CRC prognosis, a better understanding for TCM treatment of CRC.

1. ARTICLE
TMR | January 2020 | vol. 5 | no. 1 | 44
doi: 10.12032/TMR20190914135
Submit a manuscript: https://www.tmrjournals.com/tmr
Traditional Chinese Medicine
Highlights
The identification of syndrome conditions had different impacts on CRC prognosis, and which may be
related with different mRNA expression levels. Our results prelimitarily uncovered that some oncogenes
and pro-inflammatory cytokines were highly expressed in Dampness Heat group but not other syndrome
types and CRC patients with Dampness Heat syndrome might have a poor prognosis.
Traditionality
TCM syndrome is a kind of pathological profiles that reflect signs and symptoms at a certain stage of a
disease, which is the most essential guidelines for the prescription of Chinese herbal formulae and also an
important classification for CRC TCM therapy. A clear understanding biological basis of TCM syndrome
will help the clinical diagnosis and the treatment for CRC patients hopefully.
P < 0.001
P = 0.314
P = 0.061

2. ARTICLE
TMR | January 2020 | vol. 5 | no. 1 | 45
Submit a manuscript: https://www.tmrjournals.com/tmr
doi: 10.12032/TMR20190914135
Abstract
Background: Traditional Chinese medicine (TCM) syndrome, also named syndrome, are comprehensive and
integral analyses of clinical information which helps to guide different individualized treatment prescriptions.
Methods: Thirty healthy controls and 80 colorectal cancer (CRC) patients (including 33 Spleen Qi Deficiency
syndrome, 23 Dampness Heat syndrome, 17 Blood Stasis syndrome and 7 other syndrome) were enrolled into this
study. Human mRNAs were extracted from peripheral blood mononuclear cells. The gene expression for CRC
patients with different TCM syndrome was determined by microarray and qRT-PCR. Results: Spleen Qi Deficiency,
Dampness Heat and Blood Stasis were the most common syndromes in CRC patients. There is a significant
difference was found in mRNA expression levels (especially for PIK3CA, STAT3, SOX9 and KDM5C) among
Spleen Qi Deficiency, Dampness Heat and Blood Stasis syndrome groups. The higher mRNA levels of JNK1, TP53,
MLH1, MSH6, PMS2, SOCS3, TCF7L2, FAM123B, PSAP, FBXW7, SALL4 and the lower expression of
inflammatory cytokine IL-6 were found in Spleen Qi Deficiency group but not other syndrome types. The higher
mRNA levels of KRAS, MUC16, EGFR, GRASP65, PIK3CA, MAPK7, CD24, STAT3, SLC11A1, Bcl-2, TXNDC17
and some inflammatory cytokines (IL-6, IL-23, TNF-a, CXCR4) were found in Dampness Heat group but not other
syndrome types. Blood Stasis syndrome showed higher expression of SOX9, MLH1, MSH6, KDM5C, PCDH11X,
PSAP and SALL4, and lower mRNA levels of PIK3CA, CD24, STAT3, CXCR4, TXNDC17 and TP53. The CRC
patients with Dampness Heat syndrome might have a poor prognosis than other syndrome types. Conclusion: The
identification of syndrome conditions had different impacts on CRC prognosis, and which might be related with
different mRNA expression levels. Some oncogenes and pro-inflammatory cytokines were highly expressed in
Dampness Heat group but not other syndrome types, suggesting that the CRC patients with Dampness Heat
syndrome might have a poor prognosis. Our results prelimitarily uncovered the molecular basis of syndrome
differences in CRC prognosis, a better understanding for TCM treatment of CRC.
Keywords: Traditional Chinese medicine, Clinical distribution, Molecular profiling, Colorectal cancer, Syndrome
differentiation, Pattern diagnosis.
Acknowledgments:
This research was supported by grants from National Natural Science Foundation of China (grant No. 81874380,
81672932, 81730108 and 81973635), Zhejiang Provincial Natural Science Foundation of China for
Distinguished Young Scholars (grant No. LR18H160001), Zhejiang Province Science and Technology Project
of TCM (grant No. 2019ZZ016), Zhejiang Province Medical Science and Technology Project (grant No.
2017RC007), Talent Project of Zhejiang Association for Science and Technology (grant No. 2017YCGC002),
Key Project of Hangzhou Ministry of Science and Technology (grant No. 20162013A07), Zhejiang Provincial
Project for the Key Discipline of Traditional Chinese Medicine (grant No. 2017-XK-A09), the Open Project
Program of Jiangsu Key Laboratory for Pharmacology and Safety Evaluation of Chinese Materia Medica (No.
JKLPSE201807) and the Project of the Priority Academic Program Development of Jiangsu Higher Education
Institutions (PAPD).
Abbreviations:
CRC, colorectal cancer; TCM, traditional Chinese medicine; CEA, carcinoembryonic antigen; LDH, lactate
dehydrogenase; PBMCs, peripheral blood mononuclear cells.
Competing interests:
The authors declare that there is no conflict of interest. None of the contents of this manuscript has been
previously published or is under consideration elsewhere. All the authors read and approve the final version of
the manuscript prior to submission.
Citation:
Li-Jun Jin, Ying Liu, Ming-Ming Zhang, et al. Clinical distribution and molecular profiling on postoperative
colorectal cancer patients with different traditional Chinese medicine syndromes. Traditional Medicine
Research 2020, 5 (1): 44–52.
Executive Editor: Nuo-Xi Pi.
Submitted: 8 August 2019, Accepted: 10 September 2019, Online: 21 September 2019.

3. ARTICLE
TMR | January 2020 | vol. 5 | no. 1 | 46
doi: 10.12032/TMR20190914135
Submit a manuscript: https://www.tmrjournals.com/tmr
Background
The disease of Jiju was recorded on the ancient book
of Chinese medicine named Zhu Bing Yuan Hou Lun in
Sui Dynasty of ancient China (610 C.E.), with the
characters of abdominal pain, loose stools, abdominal
mass, etc., which is similar to the clinical symptoms of
colorectal cancer (CRC) in Western medicine. Till now
CRC is one of the most common cancer around the
world, although a lot of progress has been made over
the past years [1]. Now, surgical resection is the main
treatment strategy for early CRC patients, however,
approximately 40% patients with stage II or III CRC
may have a recurrence after surgery [2, 3]. Therefore,
identifying efficient prognostic factors and improving
the overall survival of CRC patients are important
issue.
Traditional Chinese medicine (TCM) emphasizes
integration concept of the environment and the human
body. For patient cancer, TCM is one of the most
common complementary and alternative therapy [4, 5].
TCM depends on syndrome differentiation diagnosis,
which includes four diagnostic procedures: observation,
listening, questioning, and pulse analyses. Syndrome is
a kind of pathological profiles that reflect signs and
symptoms at a certain stage of a disease [6]. Therefore,
TCM syndrome is the most essential guidelines for the
prescription of Chinese herbal formulae and also an
important classification for CRC TCM therapy [7]. The
CRC patients should be treated by different herbal
prescription when they are diagnosed with different
syndrome. However, when TCM meets modern
medicine, the molecular basis and the validity of
syndrome is poorly understood. So, a clear
understanding biological basis of TCM syndrome will
help the clinical diagnosis and the treatment for CRC
patients hopefully.
In this study, we hypothesized that the identification
of syndrome conditions had different impacts on CRC
patients, and which might be related with different
mRNA expression levels. To test this hypothesis, thirty
healthy controls and 80 CRC patients broken down
into four types of syndrome. As a result, we showed
that Spleen Qi Deficiency, Dampness Heat and Blood
stasis were the most common syndrome types in CRC.
In the further study, we evaluated the expression of
mRNA among these different TCM syndrome and
demonstrated that the expression levels of PIK3CA,
STAT3, SOX9 and KDM5C were significantly
associated with different syndrome types. For the
molecular basis of different TCM syndrome in CRC,
our results provide a new understanding.
Materials and methods
Literature search for publications on TCM
syndrome in Chinese CRC patients
From January 2000 to June 2019, relevant studies were
found based on searching the databases of PubMed,
Web of Science, EMBASE, MEDLINE, and Cochrane
library database. Meanwhile, we also consulted some
Chinese periodicals, including CNKI (China Academic
Journals), Wanfang and Weipu. The search strategy is
the following: “Zhong Yi” (traditional Chinese
medicine), “syndrome” or “Zheng” (syndrome), and
“Rectal cancer” or “Colon cancer” or “Colorectal
cancer”. More than 600 papers on TCM syndrome in
CRC were initially identified.
Study subjects
This research protocol (2009-0007) was approved by
the medical ethics committee of Jianggan District
People’s Hospital and Sir Run Run Shaw Hospital. A
total of 80 colorectal adenocarcinoma patients were
consecutively recruited in Hangzhou, Zhejiang, China
from January 2009 to July 2017 and healthy volunteers
were used as the control group.
Diagnostic criteria
The diagnoses of all CRC patients were confirmed by
pathology from surgical specimens. Trained
interviewers used a uniform questionnaire to collect
the TCM diagnostic information including name,
gender, age, etc., and known risk factors for CRC.
According the previous report, the standard criteria for
the classification of CRC syndrome was performed [8].
CRC patients were divided into four main syndrome
types: Spleen Qi Deficiency syndrome, Dampness
Heat syndrome, Blood Stasis syndrome, and other
syndromes.
a. Spleen Qi Deficiency syndrome: its clinical
symptom is similar to that of cancer related
fatigue and the digestion process is perturbed,
making the person usually feel tired, are low in
spirit and reluctant to talk as well as causing
abdominal discomfort and loose stool [9–10].
b. Dampness Heat syndrome: it is similar to strong
inflammation response and flat in Western
medicine. So, these patients usually have heavy
body weight, lack of appetite, thirsty but little/no
desire to drink, brown yellowish urine, loose
stools, etc. [11].
c. Blood Stasis syndrome: it is similar to
hypercoagulable state of blood and is considered
to be related with hemorheological properties
changing. Usually, these patients have tingling
pain, cyanosis or purple, dry stool (of skin, lips,
nails, and/or tongue) with stasis maculae or spots
[12].
Inclusion criteria
All CRC patients meet Western medicine and TCM
criteria and the following characteristics: (a) Han
(Chinese main ethnic group) Chinese ethnicity, (b)

4. ARTICLE
Submit a manuscript: https://www.tmrjournals.com/tmr TMR | January 2020 | vol. 5 | no. 1 | 47
doi: 10.12032/TMR20190914135
histopathologically diagnosed with primary CRC, (c)
aged between 18 and 80 years, (d) had no antitumor
therapy before recruitment, including radiotherapy and
chemotherapy, and (e) did not have severe heart failure,
pulmonary insufficiency, or kidney disease.
Exclusion criteria
Patients with appendix tumor, jejunum tumor,
colorectal adenoma, E. stromal tumor, large intestine
leiomyosarcoma, large intestine malignant melanoma
and cases without pathological diagnosis and
completed data were excluded.
CRC sample preparation
CRC serum samples were obtained from patients who
had undergone a surgical procedure at the Affiliated
Hospital of Hangzhou Normal University (Hangzhou,
China). The written informed consent was obtained
from all patients and all protocols regarding the use of
patient samples in this study were approved by the
Ethics Committee of Hangzhou Normal University.
Serum samples were stored at -80 °
C. All experiments
were approved by the guidelines of the Hangzhou
Normal University and performed in accordance with
the Code of Ethics of the World Medical Association
(Declaration of Helsinki). The method of
Ficoll-Hypaque density gradient centrifugation was
used to separate the peripheral blood mononuclear
cells (PBMCs) from the peripheral venous blood of all
patients [13]. Total human RNA (100 ng), extracted
from PBMCs using Trizol Reagent (Invitrogen, CA,
USA), was used as inputs for sample labeling and
hybridization preparation in accordance with the
manufacturer’s protocol (Agilent Technologies, Santa
Clara, CA). Serum levels of carcinoembryonic antigen
(CEA) and lactate dehydrogenase (LDH) were
detected in hospital laboratory of Hangzhou Normal
University. Microarray was used to detect mRNA
expression profile and qRT-PCR was used to determine
mRNA fold change [14].
Gene expression profiling and data processing
According to the protocol for manufacturer, gene
expression profiling was performed by LC-Bio
Technology Co., Ltd. (Hangzhou, Zhejiang, China) [15,
16] and ComBat was used to adjust possible batch
effects [17]. All preprocessing steps were carried out in
the statistical software R 3.1.0 with the lumi and sva
packages [18, 19]. Libraries were prepared using the
NebNext Ultra II Directional RNA library prep kit for
Illumina (NEB #E7760) and NEBNext Multiplex
Oligos for Illumina (E7355). NextSeq500 instrument
was used to sequence all samples with single-end 75bp
reads to a depth of 30-50M reads/sample. Then,
differentially expressed mRNAs were identified using
the t-test with the cut-off criteria of P < 0.05 and
fold-change > 2 or < 0.5.
qRT-PCR
According to the manufacturer’s instructions, total
RNA was reversely transcribed into cDNA via using
the SuperScript@
III Reverse Transcriptase Kit
(Invitrogen, CA, USA). Quantitative real-time PCR
was performed using SYBR Green dye (Ambion,
Carlsbad, CA, USA) on an Applied Biosystems 7500
Sequence Detection System (Applied Biosystems,
Foster City, CA). The thermal cycling conditions were
as follows: an initial step at 95°
C for 15 s followed by
40 cycles of 95°
C for 5 s and then 60°
C for 30 s. Each
experiment was performed in a final 20 μl of reaction
volume containing 2 μl of cDNA, 0.8 μl of forward
primer and reverse primer at the concentration of 10
μM for each one, 10 μl of SYBR®
Prime Ex Taq™ II
(2×), 0.4 μl of ROX Reference Dye or Dye II (50×)
and 6 μl of H2O. All of the reactions were run in
triplicate. The fixed threshold settings were used to
determine the cycle threshold (CT) data and a
comparative CT method was used to compare each
condition to the control reactions. Relative gene
expression levels were normalized to the internal
control GAPDH. The primers for quantitative real time
PCR (qRT-PCR) analysis were as follows:
PIK3CA-F 5’- GGTGAAAGACGATGGACAACTGT
-3’
PIK3CA-R 5’- TGTAACACATCTCCTGAAACCTC
TC -3’
STAT3-F 5’- CAGAGCCCCATTTTCTGGTA -3’
STAT3-R 5’- AGGACAGGGAGTGGTGTTTG -3’
SOX9-F 5’- AAGCTCTGGAGACTTCTGAACG -3’
SOX9-R 5’- CGTTCTTCACCGACTTCCTCC -3’
KDM5C-F 5’- CGGCAGTACCTGCGGTATC -3’
KDM5C-R 5’- TCAGTTCTTCAAGGCTGCG -3’
GAPDH-F 5’- CTATAAATTGAGCCCGCAGC -3’
GAPDH-R 5’- GACCAAATCCGTTGACTCCG -3’
Statistical analyses
The Chi-square and Fisher's exact tests were used to
evaluate the correlation coefficient of two factors. The
Kaplan-Meier method was used to compare the
survival of patients with colorectal cancer with
different syndrome and the logrank test was used to
test the differences between the survival curves. The
analysis of variance was used to examine the
difference among gene expression levels. All data
analysis was conducted with GraphPad Prism Software
Version 6 (GraphPad, San Diego, CA) and all data are
showed as mean ± Std. P < 0.05 was defined as
statistically significant.
Results
Investigation of TCM syndrome in Chinese
colorectal cancer patients
From January 2000 to June 2019, relevant studies were
found by searching various English and Chinese
databases. More than 600 papers on TCM syndrome in

5. ARTICLE
TMR | January 2020 | vol. 5 | no. 1 | 48
doi: 10.12032/TMR20190914135
Submit a manuscript: https://www.tmrjournals.com/tmr
CRC were initially identified. Summary analysis from
these publications indicated the main deficiency
syndrome for CRC were Spleen Qi Deficiency,
Weakness of Spleen and Stomach, Yin Deficiency of
Liver and Kidney, Deficiency of both Qi and Blood,
and Yang Deficiency of Spleen and Kidney (Figure
1A), which accounted for 90.8% of the total. The main
excessive syndrome for CRC were Dampness Heat,
Blood Stasis, and Stagnation of Qi, which accounted
for 96.81% of the total (Figure 1B).
Characteristics and syndrome distribution of the
study subjects
A total of 80 CRC patients were included in the study.
The most common syndrome in CRC are Spleen Qi
Deficiency (41.25% of studies), Dampness Heat
(28.75%) and Blood Stasis (21.25%) (Figure 2A).
Gender, age, tumor stage, the expression level of CEA
and LDH, and syndrome distribution of subjects are
shown in Table 1. The CRC patients with Dampness
Heat syndrome has a higher CEA and LDH expression
than those patients with Spleen Qi Deficiency and
Blood Stasis subtype (P < 0.05). However, there is no
significant difference among gender proportion, age,
drinking, diet habit, individual disease history and
tumor stage (P > 0.05). In further study, we evaluated
whether different syndrome subtypes had different
impact on the prognosis of CRC patients. As a result,
the CRC patients with Dampness Heat syndrome are
found to have a poor prognosis (Figure 2B). Altogether,
our study demonstrated a correlation between
syndrome types and the expression level of CEA and
LDH as well as prognosis in CRC patient.
Analysis of gene expression profiles in the three
groups of CRC patients
To determine the gene expression of CRC patients
with different TCM syndrome, we first detected
mRNA expression of three blood samples of patients
with CRC from the Spleen Qi Deficiency, Dampness
Heat, Blood Stasis, and control groups by gene
expression array. As shown in Figure 3A, we found
that there is a significantly different mRNA expression
among the Spleen Qi Deficiency, Dampness Heat,
Blood Stasis, and control groups. The higher mRNA
levels of JNK1, TP53, MLH1, MSH6, PMS2, SOCS3,
TCF7L2, FAM123B, PSAP, FBXW7, SALL4 and the
lower expression of inflammatory cytokine IL-6 are
found in Spleen Qi Deficiency groups but not other
syndrome types. The higher mRNA levels of KRAS,
MUC16, EGFR, GRASP65, PIK3CA, MAPK7, CD24,
STAT3, SLC11A1, Bcl-2, TXNDC17 and some
inflammatory cytokines (IL-6, IL-23, TNF-a, CXCR4)
are found in Dampness Heat groups but not other
syndrome types. Meanwhile, the lower mRNA levels
of JNK1, TP53, SOX9, MLH1, MLH3, MSH6, PMS2,
KDM5C, SOCS3, PCDH11X, TCF7L2, FAM123B,
PSAP, FBXW7 and SALL4 are shown in Dampness
Heat groups but not other syndrome types. Compared
with Dampness Heat groups, Blood Stasis syndrome
shows higher expression of SOX9, MLH1, MSH6,
KDM5C, PCDH11X, PSAP and SALL4, and lower
mRNA levels of PIK3CA, CD24, STAT3, CXCR4,
TXNDC17 and TP53. We also examined the
expression of PIK3CA, STAT3, SOX9 and KDM5C by
qRT-PCR. As a result, we demonstrate that the
Dampness Heat group expresses the highest levels of
PIK3CA and STAT3 and the lowest levels of SOX9 and
KDM5C (Figure 3B). Therefore, different TCM
syndrome showed different mRNA expression level
and the higher expression of some oncogenes (KRAS,
MUC16, EGFR, GRASP65, PIK3CA, STAT3, Bcl-2,
TXNDC17) and pro-inflammatory cytokines (IL-6,
IL-23, TNF-a, CXCR4) contributed to Dampness Heat
syndrome types, which indicated that the molecular
basis of Dampness Heat syndrome in CRC might be
different from other syndrome types and the CRC
patients with Dampness Heat syndrome might have a
poor prognosis.
Figure 1 Summary analysis of TCM syndrome from annual publications. (A) Deficiency syndrome description;
(B) Excessive syndrome description. TCM, Traditional Chinese medicine.

6. ARTICLE
Submit a manuscript: https://www.tmrjournals.com/tmr TMR | January 2020 | vol. 5 | no. 1 | 49
doi: 10.12032/TMR20190914135
Table 1 Correlation between clinicpathological background and different traditional Chinese medicine
syndromes in 73 cases of CRC patients
Different syndromes of CRC
Spleen Qi
Deficiency
(n = 33)
Dampness Heat
(n = 23)
Blood Stasis
(n = 17)
P-value
Gender
Male 18 15 10 0.727
Female 15 8 7
Age
> 60 15 11 7 0.915
≤ 60 18 12 10
Smoking
No 23 17 14 0.627
Yes 10 6 3
Drinking
No 20 13 11 0.871
Yes 13 10 6
High fat diet 0.855
No 11 8 7
Yes 22 15 10
Individual disease history 0.915
No 29 21 15
Yes 4 2 2
Stage
III 14 9 6 0.885
IV 19 14 11
CEA
> 10 µg/mL 12 16 5 0.016
≤ 10 µ
g/mL 21 7 12
LDH
> 300 U/L 6 20 4 < 0.001
≤ 300 U/L 27 3 13
CRC, colorectal cancer; CEA, carcinoembryonic antigen; LDH, lactate dehydrogenase.
P < 0.001
P = 0.314
P = 0.061
Figure 2 Syndrome distribution and prognosis of CRC patients. (A) Clinical distributions of TCM syndrome in
CRC; (B) The prognosis of CRC patients with different syndrome types. SQD: Spleen Qi Deficiency; DH: Dampness
Heat; BS: Blood Stasis.
Discussion
TCM is widely used to improve the efficacy of
chemotherapy and relieve the clinical symptom of
China. In TCM theory, Chinese medicine is
prescribed according to syndrome [20]. Syndrome
differentiation has been considered to guide the
choice of individualized treatment with TCM herbal

7. ARTICLE
TMR | January 2020 | vol. 5 | no. 1 | 50
doi: 10.12032/TMR20190914135
Submit a manuscript: https://www.tmrjournals.com/tmr
P < 0.001
P < 0.001
P < 0.001
P < 0.001
Figure 3 The molecular basis of TCM syndrome in CRC patients. (A) mRNA expression profiles of blood
samples of CRC from the Spleen Qi Deficiency, Dampness Heat, Blood Stasis, and control groups are detected by
gene expression array; (B) mRNA expression levels of PIK3CA, STAT3, SOX9 and KDM5C are confirmed by
qRT-PCR. a, For PIK3CA, compare with other syndrome, P < 0.001; b, For STAT3, compared with other syndrome,
P < 0.001; c, For SOX9, compared with other syndrome, P = 0.001; d, For KDM5C, compared with other syndrome,
P < 0.001.
formulae since the ancient time of China [21–23].
Therefore, the classical TCM therapeutic principle,
“same disease treated by different therapies” or
“different diseases treated by same therapy”, is usually
adopted in cancer treatments [20]. However, it is
difficult to cover the scientific basis of the complexity
of syndrome, which limits the widespread application
of TCM in the world [6, 24–26]. Therefore,
understanding the potential molecular mechanisms
underlying syndrome in CRC is urgently needed.
It is known that cancer is often influenced by
changes from the genes that control the body’s
phenotypes and gene expression profiles are tightly
correlated with carcinogenesis and cancer development
[27–29]. A large number of studies have investigated
the relationship between molecular basis and TCM
syndromes [30, 31]. Dai, et al. found the existence of
TCM syndrome could influence the tumor growth in
pancreatic cancer, which might be mediated by the
expression of chemokines CCR5/CCL5/CCL4 [6]. Tao,
et al. and Hu, et al. showed that serum and plasma
biomarkers could be a potential screening tool for the
diagnosis and stratification of CRC patients with
different syndrome differentiation [32, 33]. Wang and
her colleagues identified that the emergence of
syndrome conditions before or after tumor occurrence
had significant different impacts on pancreatic cancer
development. In the further study, they declared that
tumor-associated macrophage infiltration and
inflammatory cytokines including IL-6, IL-10, and
p-STAT3 contributed to these differences [34].
However, the studies about the relationships between
CRC syndrome and genetic susceptibility are few.
In the present study, we investigated the clinical
distribution of TCM syndrome in CRC patients and
found Spleen Qi Deficiency, Dampness Heat and
Blood Stasis were the most common syndrome types
in CRC. Next, we analyzed the clinicopathological
characteristics of CRC patients with different TCM
syndrome. We showed that the Dampness Heat subtype
in CRC had a significantly higher CEA and LDH
expression, compared with Spleen Qi Deficiency and
Blood Stasis group. However, there was no significant
differences among gender proportion, age and tumor
stage. In further study, we evaluated the impact of
different syndrome types on CRC prognosis and found
CRC patients with Dampness Heat syndrome had a
poor survival. To further determine the possible

8. ARTICLE
Submit a manuscript: https://www.tmrjournals.com/tmr TMR | January 2020 | vol. 5 | no. 1 | 51
doi: 10.12032/TMR20190914135
molecular mechanisms underlying different TCM
syndrome, gene expression array was used to detect
mRNA expression of blood samples of CRC from the
Spleen Qi Deficiency, Heat Dampness, Blood Stasis,
and control groups. Interestingly, some oncogenes
(KRAS, MUC16, EGFR, GRASP65, PIK3CA, STAT3,
Bcl-2, TXNDC17) and inflammatory cytokines (IL-6,
IL-23, TNF-a, CXCR4) were found higher expression
in Dampness Heat groups but not other syndrome
types. EGFR inhibitors were reported to significantly
inhibit LPS-induced IL-1β, IL-6, and TNF-α
production via NF-κB inactivation [35]. ARID1A and
PIK3CA mutations were demonstrated to cooperate to
promote tumor growth through sustained IL-6
inflammatory cytokine signaling [36]. Therefore, our
results indicated the CRC patients with Dampness Heat
syndrome might have a poor prognosis. However, we
only examined three blood samples for each syndrome
group, large-scale and multicenter collaboration will be
necessary in the future.
Conclusion
Therefore, these results indicated that the gene
expression profiling approach could be a potential
approach for the diagnosis and stratification of CRC
patients with different syndrome differentiation, which
was also demonstrated by qRT-PCR. In summary, our
results provide insights into the potential utility and
prognosis of TCM syndrome and may hopefully
improve understanding of the molecular basis of TCM
syndrome in CRC.
References
1. Siegel RL, Miller KD, Jemal A. Cancer statistics,
2019. CA Cancer J Clin 2019, 69: 7–34.
2. Hong Y, Liew SC, Thean LF, et al. Human
colorectal cancer initiation is bidirectional, and
cell growth, metabolic genes and transporter
genes are early drivers of tumorigenesis. Cancer
Lett 2018, 431: 213–218.
3. Yang X, Xu ZJ, Chen X, et al. Clinical value of
preoperative methylated septin 9 in Chinese
colorectal cancer patients. World J Gastroenterol
2019, 25: 2099–2109.
4. Ling CQ, Yue XQ, Ling C. Three advantages of
using traditional Chinese medicine to prevent and
treat tumor. J Integr Med 2014, 12: 331–335.
5. McCulloch M, See C, Shu XJ, et al.
Astragalus-based Chinese herbs and
platinum-based chemotherapy for advanced
non-small-cell lung cancer: meta-analysis of
randomized trials. J Clin Oncol 2006, 24:
419–430.
6. Dai HY, Wang P, Feng LY, et al. The molecular
mechanisms of traditional Chinese medicine
ZHENG syndromes on pancreatic tumor growth.
Integr Cancer Ther 2010, 9: 291–297.
7. Su SB, Lu A, Li S, et al. Evidence-Based ZHENG:
A Traditional Chinese Medicine Syndrome. Evid
Based Complement Alternat Med 2012, 2012:
246538.
8. Cheng CW, Kwok AO, Bian ZX, et al. The
Quintessence of Traditional Chinese Medicine:
Syndrome and Its Distribution among Advanced
Cancer Patients with Constipation. Evid Based
Complement Alternat Med 2012, 2012: 739642.
9. Hou FG, Cen Y, Guan J, et al. Quantified
diagnositic standard for large intestinal cancer of
Spleen Qi Deficiency syndrome. J Chin Integr
Med 2009, 7: 814–818. (Chinese)
10. Yang L, Li TT, Chu YT, et al. Traditional
Chinese medical comprehensive therapy for
cancer-related fatigue. Chin J Integr Med 2016,
22: 67–72.
11. Yao W, Yang C, Wen Y, et al. Treatment effects
and mechanisms of Yujin Powder on rat model of
large intestine Dampness Heat syndrome. J
Ethnopharmacol 2017, 202: 265–280.
12. Hsu PC, Huang YC, Chiang JY, et al. The
association between arterial stiffness and tongue
manifestations of blood stasis in patients with
type 2 diabetes. BMC Complement Altern Med
2016, 16: 324.
13. Vasanthkumar T, Hanumanthappa M,
Lakshminarayana R. Curcumin and capsaicin
modulates LPS induced expression of COX-2,
IL-6 and TGF-β in human peripheral blood
mononuclear cells. Cytotechnology 2019: 1–14.
14. Sui X, Guo Y, Ni W, et al. Molecular profiling
analysis for colorectal cancer patients with Pi-Xu
or Shi-Re syndrome. Integr Med Res 2019, 8:
21–25.
15. Eberwine J, Yeh H, Miyashiro K, et al. Analysis
of gene expression in single live neurons. Proc
Natl Acad Sci U S A 1992, 89: 3010-3014.
16. Wu J, Wang C, Zhu X, Chen J. Sequence analysis
of double-strand RNA6 and RNA9 from the
fungus Sclerotium hydrophilum. Arch Virol 2017,
162: 2913–2917.
17. Johnson WE, Li C, Rabinovic A. Adjusting batch
effects in microarray expression data using
empirical Bayes methods. Biostatistics 2007, 8:
118–127.
18. Du P, Kibbe WA, Lin SM. lumi: a pipeline for
processing Illumina microarray. Bioinformatics
2008, 24: 1547–1548.
19. Parker HS, Leek JT, Favorov AV, et al. Preserving
biological heterogeneity with a permuted
surrogate variable analysis for genomics batch
correction. Bioinformatics 2014, 30: 2757–2763.
20. Ji Q, Luo YQ, Wang WH, et al. Research
advances in traditional Chinese medicine
syndromes in cancer patients. J Integr Med 2016,
14: 12–21.

9. ARTICLE
TMR | January 2020 | vol. 5 | no. 1 | 52
doi: 10.12032/TMR20190914135
Submit a manuscript: https://www.tmrjournals.com/tmr
21. Guo Y, Zou Y, Xu YF, et al. Study on Chinese
medicine syndrome of colorectal carcinoma in
perioperative period. Chin J Integr Med 2015, 21:
183–187.
22. Chen P, Ni W, Xie T, et al. Meta-Analysis of
5-Fluorouracil-Based Chemotherapy Combined
With Traditional Chinese Medicines for
Colorectal Cancer Treatment. Integr Cancer Ther
2019, 18: 1534735419828824.
23. Zhai B, Zhang N, Han X, et al. Molecular targets
of β-elemene, a herbal extract used in traditional
Chinese medicine, and its potential role in cancer
therapy: A review. Biomed Pharmacother 2019,
114: 108812.
24. Chen S, Zhang Z, Zhang X, et al. TCM therapies
combined with chemotherapy for preventing
recurrence and metastasis in postoperative II to
IIIA NSCLC: A protocol for a systematic review
and meta-analysis. Medicine (Baltimore) 2019, 98:
e14724.
25. Zhao M, Chen Y, Wang C, et al. Systems
Pharmacology Dissection of Multi-Scale
Mechanisms of Action of Huo-Xiang-Zheng-Qi
Formula for the Treatment of Gastrointestinal
Diseases. Front Pharmacol 2019, 9: 1448.
26. Ma L, Zheng X, Yang Y, et al. Epigenetic
differences of chronic hepatitis B in different
TCM syndromes: Protocol for a case-control,
non-interventional, observational clinical study.
Medicine (Baltimore) 2018, 97: e12452.
27. Chen Z, Chen LY, Wang P, et al. Tumor
Microenvironment Varies under Different TCM
ZHENG Models and Correlates with Treatment
Response to Herbal Medicine. Evid Based
Complement Alternat Med 2012, 2012: 635702.
28. Yan Y, Gong Z, Xu Z. Vitamin D supplementation
and colorectal cancer prognosis. Med Oncol 2019,
36: 69.
29. Carlini MJ, Recouvreux MS, Simian M, et al.
Gene expression profile and cancer-associated
pathways linked to progesterone receptor isoform
a (PRA) predominance in transgenic mouse
mammary glands. BMC Cancer 2018, 18: 682.
30. Chen G, Gao J, He H, et al. Identification of
differentially expressed non-coding RNAs and
mRNAs involved in Qi stagnation and blood
stasis syndrome. Exp Ther Med 2018, 17:
1206–1223.
31. Cheng XR, Cui XL, Zheng Y, et al. A Co-Module
Regulated by Therapeutic Drugs in a Molecular
Subnetwork of Alzheimer's Disease Identified on
the Basis of Traditional Chinese Medicine and
SAMP8 Mice. Curr Alzheimer Res 2015, 12:
870–885.
32. Tao F, Lu P, Xu C, et al. Metabolomics Analysis
for Defining Serum Biochemical Markers in
Colorectal Cancer Patients with Qi Deficiency
Syndrome or Yin Deficiency Syndrome. Evid
Based Complement Alternat Med 2017, 2017:
7382752.
33. Hu XQ, Wei B, Song YN, et al. Plasma metabolic
profiling on postoperative colorectal cancer
patients with different traditional Chinese
medicine syndromes. Complement Ther Med
2018, 36: 14–19.
34. Wang FJ, Wang P, Chen LY, et al. TAM
Infiltration Differences in "Tumor-First" and "
ZHENG-First" Models and the Underlying
Inflammatory Molecular Mechanism in
Pancreatic Cancer. Integr Cancer Ther 2018, 17:
707–716.
35. Elkamhawy A, Hassan AHE, Paik S, et al. EGFR
inhibitors from cancer to inflammation:
Discovery of 4-fluoro-N-(4-(3-(trifluoromethyl)
phenoxy)pyrimidin-5-yl)benzamide as a novel
anti-inflammatory EGFR inhibitor. Bioorg Chem
2019, 86: 112–118.
36. Chandler RL, Damrauer JS, Raab JR, et al.
Coexistent ARID1A-PIK3CA mutations promote
ovarian clear-cell tumorigenesis through
pro-tumorigenic inflammatory cytokine signalling.
Nat Commun 2015, 6: 6118.