SlideShare a Scribd company logo
1 of 46
Download to read offline
Primer Designing
BY- Sanju sah
Primer designing:
• Primer
• Purpose????
A. Detection-Gene of interest, Gene expression ( mRNA), Microbial
agents detection, Mutation Detection, Allelic discrimination
B. Cloning
• Single insert cloning
• Multiple insert cloning (cassette construction)
• Site directed mutagenesis
Online tools:
•http://www.basic.northwestern.edu/biotools/oligocalc.html
•https://sg.idtdna.com/calc/analyzer
•http://www.ncbi.nlm.nih.gov/
•http://blast.ncbi.nlm.nih.gov/Blast.cgi
•http://reverse-complement.com/
•http://nc2.neb.com/NEBcutter2/
Primer Designing
ATCATGGATCCTGTCATACTAGTGTCATAGGTTACTTTCAGCC
Folding
BLAST
GC%= 45/42 Tm= 49.7/66.4 bp= 20/43
Stability of secondary structure=dG= 0.80,Tm= 25.8
Self dimer= -10.76
Heterodimer= -7.79
Restriction sites= BamHI andSpeI
BLAST= √
Homodimer
Heterodimer
Primer designing for detection
(for amplification only)
Forward Primer
Randomly selected nucleotide stretch for forward primer
Reverse Primer Designing
Forward Primer
Randomly selected nucleotide stretch for reverse primer
Reverse Primer
Rejected Select another region
Reverse primer
Forward primer
Reverse primer
Select another region Rejected
FW-5’GAGTTGGGATCGTTTGTTG 3’
RV-5’ CGATCGTTGGAACATCTTC 3’

More Related Content

More from St. Xavier's college, maitighar,Kathmandu

More from St. Xavier's college, maitighar,Kathmandu (20)

Mammals stomach and dentition
Mammals stomach and dentitionMammals stomach and dentition
Mammals stomach and dentition
 
Origin and Evolution of Mammals
Origin and Evolution of MammalsOrigin and Evolution of Mammals
Origin and Evolution of Mammals
 
Draco volans
Draco volansDraco volans
Draco volans
 
Digestive system of vertebrates
Digestive system of vertebratesDigestive system of vertebrates
Digestive system of vertebrates
 
Common peafowl
Common peafowlCommon peafowl
Common peafowl
 
Brain of vertebrates
Brain of vertebratesBrain of vertebrates
Brain of vertebrates
 
Integument
IntegumentIntegument
Integument
 
Water
WaterWater
Water
 
Translation
TranslationTranslation
Translation
 
The structure of dna and genome ogranization
The structure of dna and genome ogranization The structure of dna and genome ogranization
The structure of dna and genome ogranization
 
Plasmodium
PlasmodiumPlasmodium
Plasmodium
 
Comparative study of vertebrates
Comparative  study of vertebratesComparative  study of vertebrates
Comparative study of vertebrates
 
The nucleic acids
The nucleic acidsThe nucleic acids
The nucleic acids
 
Honey bee
Honey beeHoney bee
Honey bee
 
Genetic engineering of humans
Genetic engineering of humansGenetic engineering of humans
Genetic engineering of humans
 
Hazards of genetic engineering
Hazards of genetic engineeringHazards of genetic engineering
Hazards of genetic engineering
 
Azotobacter spp.
Azotobacter spp.Azotobacter spp.
Azotobacter spp.
 
Biological membrane
Biological membraneBiological membrane
Biological membrane
 
Atomic radius
Atomic radiusAtomic radius
Atomic radius
 
1. vectors b sc microbiology 2yrs
1. vectors b sc microbiology  2yrs1. vectors b sc microbiology  2yrs
1. vectors b sc microbiology 2yrs
 

Recently uploaded

(Low Rate RASHMI ) Rate Of Call Girls Jaipur ❣ 8445551418 ❣ Elite Models & Ce...
(Low Rate RASHMI ) Rate Of Call Girls Jaipur ❣ 8445551418 ❣ Elite Models & Ce...(Low Rate RASHMI ) Rate Of Call Girls Jaipur ❣ 8445551418 ❣ Elite Models & Ce...
(Low Rate RASHMI ) Rate Of Call Girls Jaipur ❣ 8445551418 ❣ Elite Models & Ce...parulsinha
 
Call Girls Aurangabad Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Aurangabad Just Call 8250077686 Top Class Call Girl Service AvailableCall Girls Aurangabad Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Aurangabad Just Call 8250077686 Top Class Call Girl Service AvailableDipal Arora
 
Top Rated Bangalore Call Girls Mg Road ⟟ 9332606886 ⟟ Call Me For Genuine S...
Top Rated Bangalore Call Girls Mg Road ⟟   9332606886 ⟟ Call Me For Genuine S...Top Rated Bangalore Call Girls Mg Road ⟟   9332606886 ⟟ Call Me For Genuine S...
Top Rated Bangalore Call Girls Mg Road ⟟ 9332606886 ⟟ Call Me For Genuine S...narwatsonia7
 
Russian Escorts Girls Nehru Place ZINATHI 🔝9711199012 ☪ 24/7 Call Girls Delhi
Russian Escorts Girls  Nehru Place ZINATHI 🔝9711199012 ☪ 24/7 Call Girls DelhiRussian Escorts Girls  Nehru Place ZINATHI 🔝9711199012 ☪ 24/7 Call Girls Delhi
Russian Escorts Girls Nehru Place ZINATHI 🔝9711199012 ☪ 24/7 Call Girls DelhiAlinaDevecerski
 
Call Girls Bhubaneswar Just Call 9907093804 Top Class Call Girl Service Avail...
Call Girls Bhubaneswar Just Call 9907093804 Top Class Call Girl Service Avail...Call Girls Bhubaneswar Just Call 9907093804 Top Class Call Girl Service Avail...
Call Girls Bhubaneswar Just Call 9907093804 Top Class Call Girl Service Avail...Dipal Arora
 
Call Girls Horamavu WhatsApp Number 7001035870 Meeting With Bangalore Escorts
Call Girls Horamavu WhatsApp Number 7001035870 Meeting With Bangalore EscortsCall Girls Horamavu WhatsApp Number 7001035870 Meeting With Bangalore Escorts
Call Girls Horamavu WhatsApp Number 7001035870 Meeting With Bangalore Escortsvidya singh
 
Call Girls Coimbatore Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Coimbatore Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Coimbatore Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Coimbatore Just Call 9907093804 Top Class Call Girl Service AvailableDipal Arora
 
Call Girls Siliguri Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Siliguri Just Call 8250077686 Top Class Call Girl Service AvailableCall Girls Siliguri Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Siliguri Just Call 8250077686 Top Class Call Girl Service AvailableDipal Arora
 
Call Girls Kochi Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Kochi Just Call 8250077686 Top Class Call Girl Service AvailableCall Girls Kochi Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Kochi Just Call 8250077686 Top Class Call Girl Service AvailableDipal Arora
 
(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...
(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...
(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...Taniya Sharma
 
Call Girls Visakhapatnam Just Call 9907093804 Top Class Call Girl Service Ava...
Call Girls Visakhapatnam Just Call 9907093804 Top Class Call Girl Service Ava...Call Girls Visakhapatnam Just Call 9907093804 Top Class Call Girl Service Ava...
Call Girls Visakhapatnam Just Call 9907093804 Top Class Call Girl Service Ava...Dipal Arora
 
(Rocky) Jaipur Call Girl - 09521753030 Escorts Service 50% Off with Cash ON D...
(Rocky) Jaipur Call Girl - 09521753030 Escorts Service 50% Off with Cash ON D...(Rocky) Jaipur Call Girl - 09521753030 Escorts Service 50% Off with Cash ON D...
(Rocky) Jaipur Call Girl - 09521753030 Escorts Service 50% Off with Cash ON D...indiancallgirl4rent
 
Call Girls Bangalore Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Bangalore Just Call 8250077686 Top Class Call Girl Service AvailableCall Girls Bangalore Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Bangalore Just Call 8250077686 Top Class Call Girl Service AvailableDipal Arora
 
Call Girls Tirupati Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Tirupati Just Call 8250077686 Top Class Call Girl Service AvailableCall Girls Tirupati Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Tirupati Just Call 8250077686 Top Class Call Girl Service AvailableDipal Arora
 
♛VVIP Hyderabad Call Girls Chintalkunta🖕7001035870🖕Riya Kappor Top Call Girl ...
♛VVIP Hyderabad Call Girls Chintalkunta🖕7001035870🖕Riya Kappor Top Call Girl ...♛VVIP Hyderabad Call Girls Chintalkunta🖕7001035870🖕Riya Kappor Top Call Girl ...
♛VVIP Hyderabad Call Girls Chintalkunta🖕7001035870🖕Riya Kappor Top Call Girl ...astropune
 
Call Girls Ooty Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Ooty Just Call 8250077686 Top Class Call Girl Service AvailableCall Girls Ooty Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Ooty Just Call 8250077686 Top Class Call Girl Service AvailableDipal Arora
 
Top Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any Time
Top Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any TimeTop Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any Time
Top Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any TimeCall Girls Delhi
 
College Call Girls in Haridwar 9667172968 Short 4000 Night 10000 Best call gi...
College Call Girls in Haridwar 9667172968 Short 4000 Night 10000 Best call gi...College Call Girls in Haridwar 9667172968 Short 4000 Night 10000 Best call gi...
College Call Girls in Haridwar 9667172968 Short 4000 Night 10000 Best call gi...perfect solution
 
Lucknow Call girls - 8800925952 - 24x7 service with hotel room
Lucknow Call girls - 8800925952 - 24x7 service with hotel roomLucknow Call girls - 8800925952 - 24x7 service with hotel room
Lucknow Call girls - 8800925952 - 24x7 service with hotel roomdiscovermytutordmt
 
The Most Attractive Hyderabad Call Girls Kothapet 𖠋 6297143586 𖠋 Will You Mis...
The Most Attractive Hyderabad Call Girls Kothapet 𖠋 6297143586 𖠋 Will You Mis...The Most Attractive Hyderabad Call Girls Kothapet 𖠋 6297143586 𖠋 Will You Mis...
The Most Attractive Hyderabad Call Girls Kothapet 𖠋 6297143586 𖠋 Will You Mis...chandars293
 

Recently uploaded (20)

(Low Rate RASHMI ) Rate Of Call Girls Jaipur ❣ 8445551418 ❣ Elite Models & Ce...
(Low Rate RASHMI ) Rate Of Call Girls Jaipur ❣ 8445551418 ❣ Elite Models & Ce...(Low Rate RASHMI ) Rate Of Call Girls Jaipur ❣ 8445551418 ❣ Elite Models & Ce...
(Low Rate RASHMI ) Rate Of Call Girls Jaipur ❣ 8445551418 ❣ Elite Models & Ce...
 
Call Girls Aurangabad Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Aurangabad Just Call 8250077686 Top Class Call Girl Service AvailableCall Girls Aurangabad Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Aurangabad Just Call 8250077686 Top Class Call Girl Service Available
 
Top Rated Bangalore Call Girls Mg Road ⟟ 9332606886 ⟟ Call Me For Genuine S...
Top Rated Bangalore Call Girls Mg Road ⟟   9332606886 ⟟ Call Me For Genuine S...Top Rated Bangalore Call Girls Mg Road ⟟   9332606886 ⟟ Call Me For Genuine S...
Top Rated Bangalore Call Girls Mg Road ⟟ 9332606886 ⟟ Call Me For Genuine S...
 
Russian Escorts Girls Nehru Place ZINATHI 🔝9711199012 ☪ 24/7 Call Girls Delhi
Russian Escorts Girls  Nehru Place ZINATHI 🔝9711199012 ☪ 24/7 Call Girls DelhiRussian Escorts Girls  Nehru Place ZINATHI 🔝9711199012 ☪ 24/7 Call Girls Delhi
Russian Escorts Girls Nehru Place ZINATHI 🔝9711199012 ☪ 24/7 Call Girls Delhi
 
Call Girls Bhubaneswar Just Call 9907093804 Top Class Call Girl Service Avail...
Call Girls Bhubaneswar Just Call 9907093804 Top Class Call Girl Service Avail...Call Girls Bhubaneswar Just Call 9907093804 Top Class Call Girl Service Avail...
Call Girls Bhubaneswar Just Call 9907093804 Top Class Call Girl Service Avail...
 
Call Girls Horamavu WhatsApp Number 7001035870 Meeting With Bangalore Escorts
Call Girls Horamavu WhatsApp Number 7001035870 Meeting With Bangalore EscortsCall Girls Horamavu WhatsApp Number 7001035870 Meeting With Bangalore Escorts
Call Girls Horamavu WhatsApp Number 7001035870 Meeting With Bangalore Escorts
 
Call Girls Coimbatore Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Coimbatore Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Coimbatore Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Coimbatore Just Call 9907093804 Top Class Call Girl Service Available
 
Call Girls Siliguri Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Siliguri Just Call 8250077686 Top Class Call Girl Service AvailableCall Girls Siliguri Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Siliguri Just Call 8250077686 Top Class Call Girl Service Available
 
Call Girls Kochi Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Kochi Just Call 8250077686 Top Class Call Girl Service AvailableCall Girls Kochi Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Kochi Just Call 8250077686 Top Class Call Girl Service Available
 
(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...
(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...
(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...
 
Call Girls Visakhapatnam Just Call 9907093804 Top Class Call Girl Service Ava...
Call Girls Visakhapatnam Just Call 9907093804 Top Class Call Girl Service Ava...Call Girls Visakhapatnam Just Call 9907093804 Top Class Call Girl Service Ava...
Call Girls Visakhapatnam Just Call 9907093804 Top Class Call Girl Service Ava...
 
(Rocky) Jaipur Call Girl - 09521753030 Escorts Service 50% Off with Cash ON D...
(Rocky) Jaipur Call Girl - 09521753030 Escorts Service 50% Off with Cash ON D...(Rocky) Jaipur Call Girl - 09521753030 Escorts Service 50% Off with Cash ON D...
(Rocky) Jaipur Call Girl - 09521753030 Escorts Service 50% Off with Cash ON D...
 
Call Girls Bangalore Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Bangalore Just Call 8250077686 Top Class Call Girl Service AvailableCall Girls Bangalore Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Bangalore Just Call 8250077686 Top Class Call Girl Service Available
 
Call Girls Tirupati Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Tirupati Just Call 8250077686 Top Class Call Girl Service AvailableCall Girls Tirupati Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Tirupati Just Call 8250077686 Top Class Call Girl Service Available
 
♛VVIP Hyderabad Call Girls Chintalkunta🖕7001035870🖕Riya Kappor Top Call Girl ...
♛VVIP Hyderabad Call Girls Chintalkunta🖕7001035870🖕Riya Kappor Top Call Girl ...♛VVIP Hyderabad Call Girls Chintalkunta🖕7001035870🖕Riya Kappor Top Call Girl ...
♛VVIP Hyderabad Call Girls Chintalkunta🖕7001035870🖕Riya Kappor Top Call Girl ...
 
Call Girls Ooty Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Ooty Just Call 8250077686 Top Class Call Girl Service AvailableCall Girls Ooty Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Ooty Just Call 8250077686 Top Class Call Girl Service Available
 
Top Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any Time
Top Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any TimeTop Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any Time
Top Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any Time
 
College Call Girls in Haridwar 9667172968 Short 4000 Night 10000 Best call gi...
College Call Girls in Haridwar 9667172968 Short 4000 Night 10000 Best call gi...College Call Girls in Haridwar 9667172968 Short 4000 Night 10000 Best call gi...
College Call Girls in Haridwar 9667172968 Short 4000 Night 10000 Best call gi...
 
Lucknow Call girls - 8800925952 - 24x7 service with hotel room
Lucknow Call girls - 8800925952 - 24x7 service with hotel roomLucknow Call girls - 8800925952 - 24x7 service with hotel room
Lucknow Call girls - 8800925952 - 24x7 service with hotel room
 
The Most Attractive Hyderabad Call Girls Kothapet 𖠋 6297143586 𖠋 Will You Mis...
The Most Attractive Hyderabad Call Girls Kothapet 𖠋 6297143586 𖠋 Will You Mis...The Most Attractive Hyderabad Call Girls Kothapet 𖠋 6297143586 𖠋 Will You Mis...
The Most Attractive Hyderabad Call Girls Kothapet 𖠋 6297143586 𖠋 Will You Mis...
 

Primer designing presentation by sanju sah