SlideShare a Scribd company logo
1 of 3
Download to read offline
1	
Protocol:	Real-time	RT-PCR	assays	for	the	detection	of	SARS-CoV-2		
Institut	Pasteur,	Paris	
	
This	protocol	describes	procedures	for	the	detection	of	SARS-CoV-2	for	two	RdRp	targets	(IP2	and	IP4).	
	
Based	on	the	first	sequences	of	SARS-CoV-2	made	available	on	the	GISAID	database	on	January	11,	
2020,	primers	and	probes	(nCoV_IP2	and	nCoV_IP4)	were	designed	to	target	the	RdRp	gene	spanning	
nt	12621-12727	and	14010-14116	(positions	according	SARS-CoV,	NC_004718).	
As	a	confirmatory	assay,	we	used	the	E	gene	assay	from	the	Charité	protocol1
	
	
Material		
Kits:	
	
Kit	Extraction	NucleoSpin	Dx	Virus	 Ref:	Macherey	Nagel	740895.50		
SuperScript™	III	Platinum®	One-Step	Quantitative	RT-PCR	System	 Ref:	Invitrogen	1732-020	
	
Primers	and	probes	
Name	 Sequences	(5'-3')	
Length	
(bases)	
PCR	
product	size	
Ref.	
RdRp	gene	/	nCoV_IP2	 	 	 	 	
nCoV_IP2-12669Fw	 ATGAGCTTAGTCCTGTTG	 17	
108	bp	 1	nCoV_IP2-12759Rv	 CTCCCTTTGTTGTGTTGT	 18	
nCoV_IP2-12696bProbe(+)	 AGATGTCTTGTGCTGCCGGTA	[5']Hex	[3']BHQ-1	 21	
	 	 	 	 	
RdRp	gene	/	nCoV_IP4	 	 	 	 	
nCoV_IP4-14059Fw	 GGTAACTGGTATGATTTCG	 19	
107	bp	 1	nCoV_IP4-14146Rv	 CTGGTCAAGGTTAATATAGG	 20	
nCoV_IP4-14084Probe(+)	 TCATACAAACCACGCCAGG	[5']Fam	[3']BHQ-1	 19	
	 	 	 	 	
E	gene	/	E_Sarbeco	
	(CoVE)	
	 	 	 	
E_Sarbeco_F1	 ACAGGTACGTTAATAGTTAATAGCGT	
	
18	
125	bp	 2	E_Sarbeco_R2	 ATATTGCAGCAGTACGCACACA	
	
20	
E_Sarbeco_P1	 ACACTAGCCATCCTTACTGCGCTTCG	[5']Fam	[3']BHQ-1	 20	
1/	National	Reference	Center	for	Respiratory	Viruses,	Institut	Pasteur,	Paris.	
2/	Corman	et	al.	Eurosurveillance
1
	
	
	
Primer	 sets	 nCoV_IP2	 and	 nCoV_IP4	 can	 be	 multiplexed.	 Both	 reaction	 mixtures	 are	 described	
below.	
	
PCR	amplification	regions	(positions	according	to	SARS-CoV,	NC_004718)	
	
nCoV_IP2	/	12621-12727	 E	gene	/	26141-26253	
nCoV_IP4	/	14010-14116		 	
	
NUCLEIC	ACID	EXTRACTION		
	
RNA	is	extracted	from	specimens	using	the	NucleoSpin	Dx	Virus	(Macherey	Nagel	ref.	740895.50).	
RNA	 extracted	from	100	µl	of	original	sample,	is	eluted	in	100	µl	of	elution	buffer.	
IULA - Laboratorio Analisi Cliniche
Tampone per Covid19 Ricerca Molecolare in PCR
REAL TIME - Protocollo Ufficiale
per maggiori informazioni https://www.laboratorioiula.com
2	
	
MIX	PREPARATION	FOR	ALL	SEPARATE	PRIMER/PROBE	COMBINATIONS	
	
All	primers	and	probes	described	below	were	validated	under	the	following	conditions.	
	
RT-PCR	Mix	kit:	
• Invitrogen	Superscript™	III	Platinum®	One-Step	qRT-PCR	system	(ref:	11732-088)	
	
Real-time	PCR	equipment:	
• LightCycler	480	(96)	
	
Adjustments	may	be	required	for	the	use	of	other	kits	or	other	real-time	PCR	instruments.	 All	
Assays	 used	 the	 same	 conditions.	 Primer	 and	 probe	 sequences,	 as	 well	 as	 optimized	
concentrations	are	shown	in	table	below.	A	25µl	reaction	was	set	up	containing	5µl	of	RNA.	
	
Simplex	Mix	 Vol	(µl)	 [final]	
H2O	PPI	 3.60	 	
Reaction	mix	2X	 12.50	 3	mM	Mg	
MgSO4	(50mM)	 0.40	 0.8	mM	Mg	
Forward	Primer	(10µM)	 1.00	 0.4	µM	
Reverse	Primer	(10µM)	 1.00	 0.4	µM	
Probe	(10µM)	 0.50	 0.2	µM	
SuperscriptIII	RT/Platinum	Taq	Mix	 1.00	 	
Final	Volume	 20.00	 	
	
	
Multiplex	Mix	(nCoV_IP2&IP4)	 Vol	(µl)	 [final]	
H2O	PPI	 1.3	 	
Reaction	mix	2X	 12.50	 3	mM	Mg	
MgSO4	(50mM)	 0.40	 0.8	mM	Mg	
Forward	Primer	(10µM)	 1.00	 0.4	µM	
Reverse	Primer	(10µM)	 1.00	 0.4	µM	
Forward	Primer	(10µM)	 1.00	 0.4	µM	
Reverse	Primer	(10µM)	 1.00	 0.4	µM	
Probe	(10µM)	 0.4	 0.16	µM	
Probe	(10µM)	 0.4	 0.16	µM	
SuperscriptIII	RT/Platinum	Taq	Mix	 1.00	 	
Final	Volume	 20.00	 	
	
CONTROLS		
Each	real-time	RT-PCR	assay	includes	in	addition	of	unknown	samples:	
• Two	 negative	 samples	 bracketing	 unknown	 samples	 during	 RNA	 extraction	 (negative	
extraction	 controls)	
• Positive	 controls	 (in	 duplicate);	 when	 using	 in	 vitro	 synthesized	 transcripts	 as	 controls	
include	 five	 quantification	 positive	 controls	 (in	 duplicate)	 including	 105
,	 104	
and	 103	
copies	genome	equivalent	(ge)	of	 in	vitro	 synthesized	RNA	transcripts.	
• One	negative	amplification	control.	
	
AMPLIFICATION	CYCLES	(LIGHTCYCLER	SYSTEM)	
	
Reverse	transcription	 55°C	 20	min	 x1	 	
Denaturation	 95°C	 3	min	 x1	 	
Amplification	
95°C	 15	sec	
x50	 Acquisition	
58°C	 30	sec	
Cooling	 40°C	 30	sec	 x1
3	
	
SENSITIVITY		
For	the	nCoV_IP	and	E_Sarbeco	real-time	RT-PCR	
Sensitivity,	in	terms	of	95%	hit	rate	is	about	100	copies	of	RNA	genome	equivalent	per	reaction	
(this	 amount	of	target	sequences	is	always	detected),	the	probability	to	detect	lower	amounts	of	
virus	 decreases,	but	samples	containing	10	copies	could	be	detected	with	multiplex	assay.	
	
	
Multiplex	
(Ct	values)	
Simplex	
(Ct	values)	
RNA	copies	
Of		
transcript	
nCoV_IP2	 nCoV_IP4	 E_Sarbeco	
1,00E+07	 21,67	 21,97	 24,72	
1,00E+06	 24,97	 25,12	 28,19	
1,00E+05	 28,00	 27,88	 30,96	
1,00E+04	 31,84	 30,51	 33,33	
	
Ct	values	may	vary	from	instrument	to	instrument	by	up	to	2	cycles,	while	the	interval	between	two	
dilutions	steps	is	constant	(∆Ct).	
	
SPECIFICITY		
Cross-reactivity	with	other	respiratory	viruses	was	tested	with	specimens	known	to	be	positive	for	
a	panel	of	respiratory	viruses	(influenza	A(H1N1)pdm09,	A(H3N2),	B-Victoria,	B-Yamagata;	influenza	
C;	 RSV	 A,	 B;	 hBoV;	 hPIV;	hMPV;	HRV/enterovirus;	adenovirus;	hCoV	(HKU1,	OC43,	229E	and	NL63);	
MERS-CoV.	None	of	the	tested	viruses	showed	reactivity	with	PCR2	and	PCR4.	
	
POSITIVE	CONTROL	FOR	SARS-CoV-2	REAL-TIME	RT-PCR		
One	specific	control	has	been	designated.	
	
Positive	 control	 for	 real-time	 RT-PCR	 is	 an	 in	 vitro	 transcribed	 RNA	 derived	 from	 strain	
BetaCoV_Wuhan_WIV04_2019	(EPI_ISL_402124).	The	transcript	contains	the	amplification	regions	of	
the	RdRp	and	E	gene	as	positive	 strand.	Each	microtube	contains	 1011	
copies	of	 target	 sequences	
diluted	in	yeast	tRNA,	and	 lyophilised.	
	
Reconstitution	of	transcribed	RNA	
Add	100	µl	of	RNase/DNAse-free	H2O	to	obtain	a	solution	at	a	concentration	of	109	
copies/µl.	Store	
at	-80°C.	 Dilute	to	prepare	a	master	bank	at	2x106	
copies/µl.	Store	at	-80°C.	
From	 this	 prepare	 a	 working	 bank	 of	 reagent	 at	 2x104	
copies/µl	 in	 order	 to	 avoid	 freeze/thaw	
cycles.	 Working	tubes	may	be	stored	at	-20°C	for	less	than	one	week.	
	
Positive	controls	are	available	upon	request	(grippe@pasteur.fr)		
	
Aknowledgements	
We	gratefully	acknowledge	the	Authors,	the	Originating	and	Submitting	Laboratories	for	their	sequence	
and	metadata	shared	through	GISAID	(EPI_ISL_402119;	EPI_ISL_402121;	EPI_ISL_402120;	
EPI_ISL_402123;	EPI_ISL_402124;	EPI_ISL_402125).	
	
Reference	
	
1- Corman	VM,	Landt	O,	Kaiser	M,	et	al.	Detection	of	2019	novel	coronavirus	(2019-nCoV)	by	real-time	
RT-PCR.	Euro	Surveill	2020;25.

More Related Content

What's hot

PCR Array Data Analysis Tutorial: qPCR Technology Webinar Series Part 3
PCR Array Data Analysis Tutorial: qPCR Technology Webinar Series Part 3PCR Array Data Analysis Tutorial: qPCR Technology Webinar Series Part 3
PCR Array Data Analysis Tutorial: qPCR Technology Webinar Series Part 3QIAGEN
 
Corona update 11 :: TESTING FOR CORONA VIRUS
Corona update 11 :: TESTING FOR CORONA VIRUSCorona update 11 :: TESTING FOR CORONA VIRUS
Corona update 11 :: TESTING FOR CORONA VIRUSNARENDRA MALHOTRA
 
A Fully Automated POCKIT Central PCR System for Evaluation of the Infectious ...
A Fully Automated POCKIT Central PCR System for Evaluation of the Infectious ...A Fully Automated POCKIT Central PCR System for Evaluation of the Infectious ...
A Fully Automated POCKIT Central PCR System for Evaluation of the Infectious ...Simon Chung - genereach
 
Quality Control of RNA Samples - For Gene-Expression Results you Can Rely on
Quality Control of RNA Samples - For Gene-Expression Results you Can Rely onQuality Control of RNA Samples - For Gene-Expression Results you Can Rely on
Quality Control of RNA Samples - For Gene-Expression Results you Can Rely onQIAGEN
 
A Field-Deployable Insulated Isothermal PCR-Based System for Rapid and Sensit...
A Field-Deployable Insulated Isothermal PCR-Based System for Rapid and Sensit...A Field-Deployable Insulated Isothermal PCR-Based System for Rapid and Sensit...
A Field-Deployable Insulated Isothermal PCR-Based System for Rapid and Sensit...Simon Chung - genereach
 
Research Paper Presentation: Sensitivity Evaluation of 2019 Novel Coronavirus...
Research Paper Presentation: Sensitivity Evaluation of 2019 Novel Coronavirus...Research Paper Presentation: Sensitivity Evaluation of 2019 Novel Coronavirus...
Research Paper Presentation: Sensitivity Evaluation of 2019 Novel Coronavirus...Shaista Jabeen
 
Nucleic Acid Quantification from FFPE Samples – Are You Doing it Right?
Nucleic Acid Quantification from FFPE Samples – Are You Doing it Right?Nucleic Acid Quantification from FFPE Samples – Are You Doing it Right?
Nucleic Acid Quantification from FFPE Samples – Are You Doing it Right?QIAGEN
 
RotorGene Q A Rapid, Automatable real-time PCR Instrument for Genotyping and...
RotorGene Q  A Rapid, Automatable real-time PCR Instrument for Genotyping and...RotorGene Q  A Rapid, Automatable real-time PCR Instrument for Genotyping and...
RotorGene Q A Rapid, Automatable real-time PCR Instrument for Genotyping and...QIAGEN
 
1073956 wp rt2_profilerarrays_1012
1073956 wp rt2_profilerarrays_10121073956 wp rt2_profilerarrays_1012
1073956 wp rt2_profilerarrays_1012Elsa von Licy
 
Reproducibility, Quality Control and Importance of Automation
Reproducibility, Quality Control and Importance of AutomationReproducibility, Quality Control and Importance of Automation
Reproducibility, Quality Control and Importance of AutomationQIAGEN
 
Rapid antigen test when and how
Rapid antigen test when and howRapid antigen test when and how
Rapid antigen test when and howPathKind Labs
 
A Fully Automated Sample-to-result PCR System for Detecting Infectious Diseases
A Fully Automated Sample-to-result PCR System for Detecting Infectious DiseasesA Fully Automated Sample-to-result PCR System for Detecting Infectious Diseases
A Fully Automated Sample-to-result PCR System for Detecting Infectious DiseasesSimon Chung - genereach
 
QIAGEN LNA Tools - Experience truly exceptional RNA Research
QIAGEN LNA Tools - Experience truly exceptional RNA ResearchQIAGEN LNA Tools - Experience truly exceptional RNA Research
QIAGEN LNA Tools - Experience truly exceptional RNA ResearchQIAGEN
 
Advanced Real-Time PCR Array Technology – Coding and Noncoding RNA Expression...
Advanced Real-Time PCR Array Technology – Coding and Noncoding RNA Expression...Advanced Real-Time PCR Array Technology – Coding and Noncoding RNA Expression...
Advanced Real-Time PCR Array Technology – Coding and Noncoding RNA Expression...QIAGEN
 
Critical Factors for Successful Real-Time PCR: Multiplex PCR
Critical Factors for Successful Real-Time PCR: Multiplex PCRCritical Factors for Successful Real-Time PCR: Multiplex PCR
Critical Factors for Successful Real-Time PCR: Multiplex PCRQIAGEN
 
RNA Quality Control - Comparing Different RNA Quality Indicators
RNA Quality Control - Comparing Different RNA Quality IndicatorsRNA Quality Control - Comparing Different RNA Quality Indicators
RNA Quality Control - Comparing Different RNA Quality IndicatorsQIAGEN
 
10 Tips to maximize your Real Time PCR Success - Download the Technical Note
10 Tips to maximize your Real Time PCR Success - Download the Technical Note10 Tips to maximize your Real Time PCR Success - Download the Technical Note
10 Tips to maximize your Real Time PCR Success - Download the Technical NoteQIAGEN
 
New Progress in Pyrosequencing for DNA Methylation
New Progress in Pyrosequencing for DNA MethylationNew Progress in Pyrosequencing for DNA Methylation
New Progress in Pyrosequencing for DNA MethylationQIAGEN
 

What's hot (20)

PCR Array Data Analysis Tutorial: qPCR Technology Webinar Series Part 3
PCR Array Data Analysis Tutorial: qPCR Technology Webinar Series Part 3PCR Array Data Analysis Tutorial: qPCR Technology Webinar Series Part 3
PCR Array Data Analysis Tutorial: qPCR Technology Webinar Series Part 3
 
Corona update 11 :: TESTING FOR CORONA VIRUS
Corona update 11 :: TESTING FOR CORONA VIRUSCorona update 11 :: TESTING FOR CORONA VIRUS
Corona update 11 :: TESTING FOR CORONA VIRUS
 
A Fully Automated POCKIT Central PCR System for Evaluation of the Infectious ...
A Fully Automated POCKIT Central PCR System for Evaluation of the Infectious ...A Fully Automated POCKIT Central PCR System for Evaluation of the Infectious ...
A Fully Automated POCKIT Central PCR System for Evaluation of the Infectious ...
 
What is RTPCR
What is RTPCRWhat is RTPCR
What is RTPCR
 
Quality Control of RNA Samples - For Gene-Expression Results you Can Rely on
Quality Control of RNA Samples - For Gene-Expression Results you Can Rely onQuality Control of RNA Samples - For Gene-Expression Results you Can Rely on
Quality Control of RNA Samples - For Gene-Expression Results you Can Rely on
 
A Field-Deployable Insulated Isothermal PCR-Based System for Rapid and Sensit...
A Field-Deployable Insulated Isothermal PCR-Based System for Rapid and Sensit...A Field-Deployable Insulated Isothermal PCR-Based System for Rapid and Sensit...
A Field-Deployable Insulated Isothermal PCR-Based System for Rapid and Sensit...
 
Research Paper Presentation: Sensitivity Evaluation of 2019 Novel Coronavirus...
Research Paper Presentation: Sensitivity Evaluation of 2019 Novel Coronavirus...Research Paper Presentation: Sensitivity Evaluation of 2019 Novel Coronavirus...
Research Paper Presentation: Sensitivity Evaluation of 2019 Novel Coronavirus...
 
Nucleic Acid Quantification from FFPE Samples – Are You Doing it Right?
Nucleic Acid Quantification from FFPE Samples – Are You Doing it Right?Nucleic Acid Quantification from FFPE Samples – Are You Doing it Right?
Nucleic Acid Quantification from FFPE Samples – Are You Doing it Right?
 
RotorGene Q A Rapid, Automatable real-time PCR Instrument for Genotyping and...
RotorGene Q  A Rapid, Automatable real-time PCR Instrument for Genotyping and...RotorGene Q  A Rapid, Automatable real-time PCR Instrument for Genotyping and...
RotorGene Q A Rapid, Automatable real-time PCR Instrument for Genotyping and...
 
1073956 wp rt2_profilerarrays_1012
1073956 wp rt2_profilerarrays_10121073956 wp rt2_profilerarrays_1012
1073956 wp rt2_profilerarrays_1012
 
Reproducibility, Quality Control and Importance of Automation
Reproducibility, Quality Control and Importance of AutomationReproducibility, Quality Control and Importance of Automation
Reproducibility, Quality Control and Importance of Automation
 
Rapid antigen test when and how
Rapid antigen test when and howRapid antigen test when and how
Rapid antigen test when and how
 
A Fully Automated Sample-to-result PCR System for Detecting Infectious Diseases
A Fully Automated Sample-to-result PCR System for Detecting Infectious DiseasesA Fully Automated Sample-to-result PCR System for Detecting Infectious Diseases
A Fully Automated Sample-to-result PCR System for Detecting Infectious Diseases
 
QIAGEN LNA Tools - Experience truly exceptional RNA Research
QIAGEN LNA Tools - Experience truly exceptional RNA ResearchQIAGEN LNA Tools - Experience truly exceptional RNA Research
QIAGEN LNA Tools - Experience truly exceptional RNA Research
 
Gene Xpert
Gene XpertGene Xpert
Gene Xpert
 
Advanced Real-Time PCR Array Technology – Coding and Noncoding RNA Expression...
Advanced Real-Time PCR Array Technology – Coding and Noncoding RNA Expression...Advanced Real-Time PCR Array Technology – Coding and Noncoding RNA Expression...
Advanced Real-Time PCR Array Technology – Coding and Noncoding RNA Expression...
 
Critical Factors for Successful Real-Time PCR: Multiplex PCR
Critical Factors for Successful Real-Time PCR: Multiplex PCRCritical Factors for Successful Real-Time PCR: Multiplex PCR
Critical Factors for Successful Real-Time PCR: Multiplex PCR
 
RNA Quality Control - Comparing Different RNA Quality Indicators
RNA Quality Control - Comparing Different RNA Quality IndicatorsRNA Quality Control - Comparing Different RNA Quality Indicators
RNA Quality Control - Comparing Different RNA Quality Indicators
 
10 Tips to maximize your Real Time PCR Success - Download the Technical Note
10 Tips to maximize your Real Time PCR Success - Download the Technical Note10 Tips to maximize your Real Time PCR Success - Download the Technical Note
10 Tips to maximize your Real Time PCR Success - Download the Technical Note
 
New Progress in Pyrosequencing for DNA Methylation
New Progress in Pyrosequencing for DNA MethylationNew Progress in Pyrosequencing for DNA Methylation
New Progress in Pyrosequencing for DNA Methylation
 

Similar to Real time rt-pcr Test molecolare per covid-19 (Sars-CoV-2) Protocollo Ufficiale

ic documents cdc (1د حاتم البيطارررررر).pdf
ic documents cdc (1د حاتم البيطارررررر).pdfic documents cdc (1د حاتم البيطارررررر).pdf
ic documents cdc (1د حاتم البيطارررررر).pdfد حاتم البيطار
 
Next Generation Sequencing- NGS for COVID19 PPT
Next Generation Sequencing- NGS for COVID19 PPTNext Generation Sequencing- NGS for COVID19 PPT
Next Generation Sequencing- NGS for COVID19 PPTMesele Tilahun
 
RECOMBINANT DNA TECHNOLOGY AND SARS CoV2
RECOMBINANT DNA TECHNOLOGY AND SARS CoV2 RECOMBINANT DNA TECHNOLOGY AND SARS CoV2
RECOMBINANT DNA TECHNOLOGY AND SARS CoV2 OindrillaDuttaGupta
 
EUA-Sansure-kit-ifu-v2.pdf
EUA-Sansure-kit-ifu-v2.pdfEUA-Sansure-kit-ifu-v2.pdf
EUA-Sansure-kit-ifu-v2.pdfTemitope75
 
Pcr technology and its importance in covid 19 pandemic
Pcr technology and its importance in covid 19 pandemicPcr technology and its importance in covid 19 pandemic
Pcr technology and its importance in covid 19 pandemicAnupam Maity
 
PCR Primer Design Tool for Sanger Sequencing Confirmation
PCR Primer Design Tool for Sanger Sequencing ConfirmationPCR Primer Design Tool for Sanger Sequencing Confirmation
PCR Primer Design Tool for Sanger Sequencing ConfirmationThermo Fisher Scientific
 
RT2 Profiler PCR Arrays: Pathway-focused Gene Expression Profiling with qRT-P...
RT2 Profiler PCR Arrays: Pathway-focused Gene Expression Profiling with qRT-P...RT2 Profiler PCR Arrays: Pathway-focused Gene Expression Profiling with qRT-P...
RT2 Profiler PCR Arrays: Pathway-focused Gene Expression Profiling with qRT-P...QIAGEN
 
Covid-19 Testing Kits Report - IntellectPeritus
Covid-19 Testing Kits Report - IntellectPeritusCovid-19 Testing Kits Report - IntellectPeritus
Covid-19 Testing Kits Report - IntellectPeritusIntellectPeritus Services
 
RT-PCR by Arnab Kumar Samanta(sen-4^J2020)[133].pptx
RT-PCR by Arnab Kumar Samanta(sen-4^J2020)[133].pptxRT-PCR by Arnab Kumar Samanta(sen-4^J2020)[133].pptx
RT-PCR by Arnab Kumar Samanta(sen-4^J2020)[133].pptxArnabSamanta26
 
RT-PCR by Arnab Kumar Samanta.pptx
RT-PCR by Arnab Kumar Samanta.pptxRT-PCR by Arnab Kumar Samanta.pptx
RT-PCR by Arnab Kumar Samanta.pptxArnabSamanta26
 
Investigative options covid 19
Investigative options covid  19 Investigative options covid  19
Investigative options covid 19 Sumi Nandwani
 
Instrumental analyisis assignmnet ppt.pptx
Instrumental analyisis assignmnet ppt.pptxInstrumental analyisis assignmnet ppt.pptx
Instrumental analyisis assignmnet ppt.pptxMesele Tilahun
 
CRISPR Based Diagnosis For SARS-CoV-2[FELUDA]
CRISPR Based Diagnosis For SARS-CoV-2[FELUDA]CRISPR Based Diagnosis For SARS-CoV-2[FELUDA]
CRISPR Based Diagnosis For SARS-CoV-2[FELUDA]Barun Kumar Sahu
 
CRISPR system for COVID-19 diagnostics.pptx
CRISPR system for COVID-19 diagnostics.pptxCRISPR system for COVID-19 diagnostics.pptx
CRISPR system for COVID-19 diagnostics.pptxPeng-Wen Liu
 
A real time RT-LAMP portable turbidimeter
A real time RT-LAMP portable turbidimeterA real time RT-LAMP portable turbidimeter
A real time RT-LAMP portable turbidimeterNarong Arunrut
 
real-time PCR .... by aqee-lhadithe - sem iv
real-time PCR ....   by aqee-lhadithe - sem ivreal-time PCR ....   by aqee-lhadithe - sem iv
real-time PCR .... by aqee-lhadithe - sem ivAqeelhadithe
 

Similar to Real time rt-pcr Test molecolare per covid-19 (Sars-CoV-2) Protocollo Ufficiale (20)

ic documents cdc (1د حاتم البيطارررررر).pdf
ic documents cdc (1د حاتم البيطارررررر).pdfic documents cdc (1د حاتم البيطارررررر).pdf
ic documents cdc (1د حاتم البيطارررررر).pdf
 
Next Generation Sequencing- NGS for COVID19 PPT
Next Generation Sequencing- NGS for COVID19 PPTNext Generation Sequencing- NGS for COVID19 PPT
Next Generation Sequencing- NGS for COVID19 PPT
 
RECOMBINANT DNA TECHNOLOGY AND SARS CoV2
RECOMBINANT DNA TECHNOLOGY AND SARS CoV2 RECOMBINANT DNA TECHNOLOGY AND SARS CoV2
RECOMBINANT DNA TECHNOLOGY AND SARS CoV2
 
Slide.pptx
Slide.pptxSlide.pptx
Slide.pptx
 
EUA-Sansure-kit-ifu-v2.pdf
EUA-Sansure-kit-ifu-v2.pdfEUA-Sansure-kit-ifu-v2.pdf
EUA-Sansure-kit-ifu-v2.pdf
 
Pcr technology and its importance in covid 19 pandemic
Pcr technology and its importance in covid 19 pandemicPcr technology and its importance in covid 19 pandemic
Pcr technology and its importance in covid 19 pandemic
 
PCR Primer Design Tool for Sanger Sequencing Confirmation
PCR Primer Design Tool for Sanger Sequencing ConfirmationPCR Primer Design Tool for Sanger Sequencing Confirmation
PCR Primer Design Tool for Sanger Sequencing Confirmation
 
RT2 Profiler PCR Arrays: Pathway-focused Gene Expression Profiling with qRT-P...
RT2 Profiler PCR Arrays: Pathway-focused Gene Expression Profiling with qRT-P...RT2 Profiler PCR Arrays: Pathway-focused Gene Expression Profiling with qRT-P...
RT2 Profiler PCR Arrays: Pathway-focused Gene Expression Profiling with qRT-P...
 
Covid-19 Testing Kits Report - IntellectPeritus
Covid-19 Testing Kits Report - IntellectPeritusCovid-19 Testing Kits Report - IntellectPeritus
Covid-19 Testing Kits Report - IntellectPeritus
 
RT-PCR by Arnab Kumar Samanta(sen-4^J2020)[133].pptx
RT-PCR by Arnab Kumar Samanta(sen-4^J2020)[133].pptxRT-PCR by Arnab Kumar Samanta(sen-4^J2020)[133].pptx
RT-PCR by Arnab Kumar Samanta(sen-4^J2020)[133].pptx
 
RT-PCR by Arnab Kumar Samanta.pptx
RT-PCR by Arnab Kumar Samanta.pptxRT-PCR by Arnab Kumar Samanta.pptx
RT-PCR by Arnab Kumar Samanta.pptx
 
Investigative options covid 19
Investigative options covid  19 Investigative options covid  19
Investigative options covid 19
 
A sensitive detection method for Covid-19
A sensitive detection method for Covid-19A sensitive detection method for Covid-19
A sensitive detection method for Covid-19
 
Instrumental analyisis assignmnet ppt.pptx
Instrumental analyisis assignmnet ppt.pptxInstrumental analyisis assignmnet ppt.pptx
Instrumental analyisis assignmnet ppt.pptx
 
Presentasi h5 n1 short
Presentasi h5 n1 shortPresentasi h5 n1 short
Presentasi h5 n1 short
 
CRISPR Based Diagnosis For SARS-CoV-2[FELUDA]
CRISPR Based Diagnosis For SARS-CoV-2[FELUDA]CRISPR Based Diagnosis For SARS-CoV-2[FELUDA]
CRISPR Based Diagnosis For SARS-CoV-2[FELUDA]
 
CRISPR system for COVID-19 diagnostics.pptx
CRISPR system for COVID-19 diagnostics.pptxCRISPR system for COVID-19 diagnostics.pptx
CRISPR system for COVID-19 diagnostics.pptx
 
A real time RT-LAMP portable turbidimeter
A real time RT-LAMP portable turbidimeterA real time RT-LAMP portable turbidimeter
A real time RT-LAMP portable turbidimeter
 
real time-PCR..
real time-PCR..real time-PCR..
real time-PCR..
 
real-time PCR .... by aqee-lhadithe - sem iv
real-time PCR ....   by aqee-lhadithe - sem ivreal-time PCR ....   by aqee-lhadithe - sem iv
real-time PCR .... by aqee-lhadithe - sem iv
 

Recently uploaded

Bangalore Call Girls Marathahalli 📞 9907093804 High Profile Service 100% Safe
Bangalore Call Girls Marathahalli 📞 9907093804 High Profile Service 100% SafeBangalore Call Girls Marathahalli 📞 9907093804 High Profile Service 100% Safe
Bangalore Call Girls Marathahalli 📞 9907093804 High Profile Service 100% Safenarwatsonia7
 
VIP Mumbai Call Girls Hiranandani Gardens Just Call 9920874524 with A/C Room ...
VIP Mumbai Call Girls Hiranandani Gardens Just Call 9920874524 with A/C Room ...VIP Mumbai Call Girls Hiranandani Gardens Just Call 9920874524 with A/C Room ...
VIP Mumbai Call Girls Hiranandani Gardens Just Call 9920874524 with A/C Room ...Garima Khatri
 
Low Rate Call Girls Pune Esha 9907093804 Short 1500 Night 6000 Best call girl...
Low Rate Call Girls Pune Esha 9907093804 Short 1500 Night 6000 Best call girl...Low Rate Call Girls Pune Esha 9907093804 Short 1500 Night 6000 Best call girl...
Low Rate Call Girls Pune Esha 9907093804 Short 1500 Night 6000 Best call girl...Miss joya
 
Low Rate Call Girls Mumbai Suman 9910780858 Independent Escort Service Mumbai
Low Rate Call Girls Mumbai Suman 9910780858 Independent Escort Service MumbaiLow Rate Call Girls Mumbai Suman 9910780858 Independent Escort Service Mumbai
Low Rate Call Girls Mumbai Suman 9910780858 Independent Escort Service Mumbaisonalikaur4
 
Call Girls Electronic City Just Call 7001305949 Top Class Call Girl Service A...
Call Girls Electronic City Just Call 7001305949 Top Class Call Girl Service A...Call Girls Electronic City Just Call 7001305949 Top Class Call Girl Service A...
Call Girls Electronic City Just Call 7001305949 Top Class Call Girl Service A...narwatsonia7
 
Call Girls Service in Bommanahalli - 7001305949 with real photos and phone nu...
Call Girls Service in Bommanahalli - 7001305949 with real photos and phone nu...Call Girls Service in Bommanahalli - 7001305949 with real photos and phone nu...
Call Girls Service in Bommanahalli - 7001305949 with real photos and phone nu...narwatsonia7
 
Asthma Review - GINA guidelines summary 2024
Asthma Review - GINA guidelines summary 2024Asthma Review - GINA guidelines summary 2024
Asthma Review - GINA guidelines summary 2024Gabriel Guevara MD
 
VIP Call Girls Mumbai Arpita 9910780858 Independent Escort Service Mumbai
VIP Call Girls Mumbai Arpita 9910780858 Independent Escort Service MumbaiVIP Call Girls Mumbai Arpita 9910780858 Independent Escort Service Mumbai
VIP Call Girls Mumbai Arpita 9910780858 Independent Escort Service Mumbaisonalikaur4
 
Bangalore Call Girls Majestic 📞 9907093804 High Profile Service 100% Safe
Bangalore Call Girls Majestic 📞 9907093804 High Profile Service 100% SafeBangalore Call Girls Majestic 📞 9907093804 High Profile Service 100% Safe
Bangalore Call Girls Majestic 📞 9907093804 High Profile Service 100% Safenarwatsonia7
 
Aspirin presentation slides by Dr. Rewas Ali
Aspirin presentation slides by Dr. Rewas AliAspirin presentation slides by Dr. Rewas Ali
Aspirin presentation slides by Dr. Rewas AliRewAs ALI
 
Call Girl Service Bidadi - For 7001305949 Cheap & Best with original Photos
Call Girl Service Bidadi - For 7001305949 Cheap & Best with original PhotosCall Girl Service Bidadi - For 7001305949 Cheap & Best with original Photos
Call Girl Service Bidadi - For 7001305949 Cheap & Best with original Photosnarwatsonia7
 
VIP Call Girls Pune Vrinda 9907093804 Short 1500 Night 6000 Best call girls S...
VIP Call Girls Pune Vrinda 9907093804 Short 1500 Night 6000 Best call girls S...VIP Call Girls Pune Vrinda 9907093804 Short 1500 Night 6000 Best call girls S...
VIP Call Girls Pune Vrinda 9907093804 Short 1500 Night 6000 Best call girls S...Miss joya
 
Call Girls Thane Just Call 9910780858 Get High Class Call Girls Service
Call Girls Thane Just Call 9910780858 Get High Class Call Girls ServiceCall Girls Thane Just Call 9910780858 Get High Class Call Girls Service
Call Girls Thane Just Call 9910780858 Get High Class Call Girls Servicesonalikaur4
 
Call Girls Whitefield Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Whitefield Just Call 7001305949 Top Class Call Girl Service AvailableCall Girls Whitefield Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Whitefield Just Call 7001305949 Top Class Call Girl Service Availablenarwatsonia7
 
Housewife Call Girls Hoskote | 7001305949 At Low Cost Cash Payment Booking
Housewife Call Girls Hoskote | 7001305949 At Low Cost Cash Payment BookingHousewife Call Girls Hoskote | 7001305949 At Low Cost Cash Payment Booking
Housewife Call Girls Hoskote | 7001305949 At Low Cost Cash Payment Bookingnarwatsonia7
 
Call Girls Hebbal Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Hebbal Just Call 7001305949 Top Class Call Girl Service AvailableCall Girls Hebbal Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Hebbal Just Call 7001305949 Top Class Call Girl Service Availablenarwatsonia7
 
Call Girls Service In Shyam Nagar Whatsapp 8445551418 Independent Escort Service
Call Girls Service In Shyam Nagar Whatsapp 8445551418 Independent Escort ServiceCall Girls Service In Shyam Nagar Whatsapp 8445551418 Independent Escort Service
Call Girls Service In Shyam Nagar Whatsapp 8445551418 Independent Escort Serviceparulsinha
 
Sonagachi Call Girls Services 9907093804 @24x7 High Class Babes Here Call Now
Sonagachi Call Girls Services 9907093804 @24x7 High Class Babes Here Call NowSonagachi Call Girls Services 9907093804 @24x7 High Class Babes Here Call Now
Sonagachi Call Girls Services 9907093804 @24x7 High Class Babes Here Call NowRiya Pathan
 
Artifacts in Nuclear Medicine with Identifying and resolving artifacts.
Artifacts in Nuclear Medicine with Identifying and resolving artifacts.Artifacts in Nuclear Medicine with Identifying and resolving artifacts.
Artifacts in Nuclear Medicine with Identifying and resolving artifacts.MiadAlsulami
 

Recently uploaded (20)

Bangalore Call Girls Marathahalli 📞 9907093804 High Profile Service 100% Safe
Bangalore Call Girls Marathahalli 📞 9907093804 High Profile Service 100% SafeBangalore Call Girls Marathahalli 📞 9907093804 High Profile Service 100% Safe
Bangalore Call Girls Marathahalli 📞 9907093804 High Profile Service 100% Safe
 
Escort Service Call Girls In Sarita Vihar,, 99530°56974 Delhi NCR
Escort Service Call Girls In Sarita Vihar,, 99530°56974 Delhi NCREscort Service Call Girls In Sarita Vihar,, 99530°56974 Delhi NCR
Escort Service Call Girls In Sarita Vihar,, 99530°56974 Delhi NCR
 
VIP Mumbai Call Girls Hiranandani Gardens Just Call 9920874524 with A/C Room ...
VIP Mumbai Call Girls Hiranandani Gardens Just Call 9920874524 with A/C Room ...VIP Mumbai Call Girls Hiranandani Gardens Just Call 9920874524 with A/C Room ...
VIP Mumbai Call Girls Hiranandani Gardens Just Call 9920874524 with A/C Room ...
 
Low Rate Call Girls Pune Esha 9907093804 Short 1500 Night 6000 Best call girl...
Low Rate Call Girls Pune Esha 9907093804 Short 1500 Night 6000 Best call girl...Low Rate Call Girls Pune Esha 9907093804 Short 1500 Night 6000 Best call girl...
Low Rate Call Girls Pune Esha 9907093804 Short 1500 Night 6000 Best call girl...
 
Low Rate Call Girls Mumbai Suman 9910780858 Independent Escort Service Mumbai
Low Rate Call Girls Mumbai Suman 9910780858 Independent Escort Service MumbaiLow Rate Call Girls Mumbai Suman 9910780858 Independent Escort Service Mumbai
Low Rate Call Girls Mumbai Suman 9910780858 Independent Escort Service Mumbai
 
Call Girls Electronic City Just Call 7001305949 Top Class Call Girl Service A...
Call Girls Electronic City Just Call 7001305949 Top Class Call Girl Service A...Call Girls Electronic City Just Call 7001305949 Top Class Call Girl Service A...
Call Girls Electronic City Just Call 7001305949 Top Class Call Girl Service A...
 
Call Girls Service in Bommanahalli - 7001305949 with real photos and phone nu...
Call Girls Service in Bommanahalli - 7001305949 with real photos and phone nu...Call Girls Service in Bommanahalli - 7001305949 with real photos and phone nu...
Call Girls Service in Bommanahalli - 7001305949 with real photos and phone nu...
 
Asthma Review - GINA guidelines summary 2024
Asthma Review - GINA guidelines summary 2024Asthma Review - GINA guidelines summary 2024
Asthma Review - GINA guidelines summary 2024
 
VIP Call Girls Mumbai Arpita 9910780858 Independent Escort Service Mumbai
VIP Call Girls Mumbai Arpita 9910780858 Independent Escort Service MumbaiVIP Call Girls Mumbai Arpita 9910780858 Independent Escort Service Mumbai
VIP Call Girls Mumbai Arpita 9910780858 Independent Escort Service Mumbai
 
Bangalore Call Girls Majestic 📞 9907093804 High Profile Service 100% Safe
Bangalore Call Girls Majestic 📞 9907093804 High Profile Service 100% SafeBangalore Call Girls Majestic 📞 9907093804 High Profile Service 100% Safe
Bangalore Call Girls Majestic 📞 9907093804 High Profile Service 100% Safe
 
Aspirin presentation slides by Dr. Rewas Ali
Aspirin presentation slides by Dr. Rewas AliAspirin presentation slides by Dr. Rewas Ali
Aspirin presentation slides by Dr. Rewas Ali
 
Call Girl Service Bidadi - For 7001305949 Cheap & Best with original Photos
Call Girl Service Bidadi - For 7001305949 Cheap & Best with original PhotosCall Girl Service Bidadi - For 7001305949 Cheap & Best with original Photos
Call Girl Service Bidadi - For 7001305949 Cheap & Best with original Photos
 
VIP Call Girls Pune Vrinda 9907093804 Short 1500 Night 6000 Best call girls S...
VIP Call Girls Pune Vrinda 9907093804 Short 1500 Night 6000 Best call girls S...VIP Call Girls Pune Vrinda 9907093804 Short 1500 Night 6000 Best call girls S...
VIP Call Girls Pune Vrinda 9907093804 Short 1500 Night 6000 Best call girls S...
 
Call Girls Thane Just Call 9910780858 Get High Class Call Girls Service
Call Girls Thane Just Call 9910780858 Get High Class Call Girls ServiceCall Girls Thane Just Call 9910780858 Get High Class Call Girls Service
Call Girls Thane Just Call 9910780858 Get High Class Call Girls Service
 
Call Girls Whitefield Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Whitefield Just Call 7001305949 Top Class Call Girl Service AvailableCall Girls Whitefield Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Whitefield Just Call 7001305949 Top Class Call Girl Service Available
 
Housewife Call Girls Hoskote | 7001305949 At Low Cost Cash Payment Booking
Housewife Call Girls Hoskote | 7001305949 At Low Cost Cash Payment BookingHousewife Call Girls Hoskote | 7001305949 At Low Cost Cash Payment Booking
Housewife Call Girls Hoskote | 7001305949 At Low Cost Cash Payment Booking
 
Call Girls Hebbal Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Hebbal Just Call 7001305949 Top Class Call Girl Service AvailableCall Girls Hebbal Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Hebbal Just Call 7001305949 Top Class Call Girl Service Available
 
Call Girls Service In Shyam Nagar Whatsapp 8445551418 Independent Escort Service
Call Girls Service In Shyam Nagar Whatsapp 8445551418 Independent Escort ServiceCall Girls Service In Shyam Nagar Whatsapp 8445551418 Independent Escort Service
Call Girls Service In Shyam Nagar Whatsapp 8445551418 Independent Escort Service
 
Sonagachi Call Girls Services 9907093804 @24x7 High Class Babes Here Call Now
Sonagachi Call Girls Services 9907093804 @24x7 High Class Babes Here Call NowSonagachi Call Girls Services 9907093804 @24x7 High Class Babes Here Call Now
Sonagachi Call Girls Services 9907093804 @24x7 High Class Babes Here Call Now
 
Artifacts in Nuclear Medicine with Identifying and resolving artifacts.
Artifacts in Nuclear Medicine with Identifying and resolving artifacts.Artifacts in Nuclear Medicine with Identifying and resolving artifacts.
Artifacts in Nuclear Medicine with Identifying and resolving artifacts.
 

Real time rt-pcr Test molecolare per covid-19 (Sars-CoV-2) Protocollo Ufficiale