SlideShare a Scribd company logo
1 of 35
Download to read offline
Open Source ArtScience practices
and collaborations in Bangalore,
India
Yashas Shetty
(Art)ScienceBLR
Bangalore,India
Indian Institute of Science
Infosys campus
Srishti School of Art, Design and
Technology
Srishti School of Art, Design and
Technology
(Art)ScienceBLR
National Center for Biological Sciences
International Genetically Engineered
Machines competion
Teenage Gene Poems(2009)
BBa_K221000 Teenage gene
Poems(2009)
• atgacgcaacagcccttccaactcccgcacttctacctgccgcaccccgcacggctcaacccgcatctcgacgaggcccgcgcccactcgacgacg
tggg
cgcgcgagatgggcatgctggagggctccggggtctgggagcagtccgacctcgaagcccacgactacggcctgctctgcgcctacacccacccc
gactg
cgacgggccggcgctctccctcatcaccgactggtacgtgtgggtcttcttcttcgacgaccacttcctggagaagtacaaacgcagccaggaccgc
ctc
gccggcaaggcccacctggaccggctcccgctgttcatgccgctcgacgacgccgccgggatgcccgagccgcggaacccggtggaggccggac
tcgccg
acctgtggacccgcacggtgcccgcgatgtcggccgactggcgccgccgcttcgccgtcgccaccgagcacctcctcaacgagtccatgtgggagc
tgtc
caacatcaacgaggggcgggtcgccaacccggtcgagtacatcgagatgcgccgcaaggtcggcggcgccccgtggtcggccgggctcgtggag
tacgcg
accgccgaggtgcccgccgccgtcgccgggaccaggccgctcagggtgctgatggagacgttctccgacgccgtgcacctgcgcaacgacctcttc
tcct
accagcgcgaggtcgaggacgagggcgagctgagcaacggggtgctggtgttggagaccttcttcggctgcaccacccaggaggccgccgacct
ggtcaa
cgacgtcctcacctcgcggctgcaccagttcgagcacaccgcgttcaccgaggtgcccgccgtcgccctggagaagggcctgaccccgttggaggt
cgcc
gccgtcggcgcgtacacgaagggcctccaggactggcagtccggcggccacgagtggcacatgcgttccagccgctacatgaacaagggggagc
ggcccc
tggccggctggcaggcgctgaccgggcccggcacctccgcggcggacgtgggagcactgctcgccgacgcggtcgcccaacgggcccgctccta
cacg
Synthetic/Post Natural Ecologies(2010)
DIY LAB equipment
DIY Lab Equipment
Autonomous Public Lab
Searching for Genetically Engineered
Machines(2011)
Searching for Genetically Engineered
Machines(2011)
Searching for Genetically Engineered
Machines(2011)
Searching for Genetically Engineered
Machines(2011)
Biodesign for the Real World
LifePatch(Indonesia) + ArtScienceBLR(India) + EPFL(Swiss)
Metamap.in
SeasonWatch.in
National Center for Biological Sciences, Bangalore
Migrantwatch.in
National Center for Biological Sciences, Bangalore
GubbiLabs.in
India’s most famous DIY hacker
Thank you
• Dr. Mukund Thattai, NCBS
• Dr. Geetha Narayanan, Srishti
• Dr. Marc Dusseiller, Dusjagr Labs, Hackteria
• Dr. Sachiko Hirosue, EPFL
• LifePatch

More Related Content

Recently uploaded

Verified # 971581275265 # Indian Call Girls In Deira By International City Ca...
Verified # 971581275265 # Indian Call Girls In Deira By International City Ca...Verified # 971581275265 # Indian Call Girls In Deira By International City Ca...
Verified # 971581275265 # Indian Call Girls In Deira By International City Ca...
home
 
UAE Call Girls # 0528675665 # Independent Call Girls In Dubai ~ (UAE)
UAE Call Girls # 0528675665 # Independent Call Girls In Dubai ~ (UAE)UAE Call Girls # 0528675665 # Independent Call Girls In Dubai ~ (UAE)
UAE Call Girls # 0528675665 # Independent Call Girls In Dubai ~ (UAE)
Business Bay Call Girls || 0529877582 || Call Girls Service in Business Bay Dubai
 
FULL NIGHT — 9999894380 Call Girls In Dwarka Mor | Delhi
FULL NIGHT — 9999894380 Call Girls In Dwarka Mor | DelhiFULL NIGHT — 9999894380 Call Girls In Dwarka Mor | Delhi
FULL NIGHT — 9999894380 Call Girls In Dwarka Mor | Delhi
SaketCallGirlsCallUs
 
Admirable # 00971529501107 # Call Girls at dubai by Dubai Call Girl
Admirable # 00971529501107 # Call Girls at dubai by Dubai Call GirlAdmirable # 00971529501107 # Call Girls at dubai by Dubai Call Girl
Admirable # 00971529501107 # Call Girls at dubai by Dubai Call Girl
home
 
FULL NIGHT — 9999894380 Call Girls In Saket | Delhi
FULL NIGHT — 9999894380 Call Girls In Saket | DelhiFULL NIGHT — 9999894380 Call Girls In Saket | Delhi
FULL NIGHT — 9999894380 Call Girls In Saket | Delhi
SaketCallGirlsCallUs
 
FULL NIGHT — 9999894380 Call Girls In Ashok Vihar | Delhi
FULL NIGHT — 9999894380 Call Girls In Ashok Vihar | DelhiFULL NIGHT — 9999894380 Call Girls In Ashok Vihar | Delhi
FULL NIGHT — 9999894380 Call Girls In Ashok Vihar | Delhi
SaketCallGirlsCallUs
 
Dubai Call Girl Number # 0522916705 # Call Girl Number In Dubai # (UAE)
Dubai Call Girl Number # 0522916705 # Call Girl Number In Dubai # (UAE)Dubai Call Girl Number # 0522916705 # Call Girl Number In Dubai # (UAE)
Dubai Call Girl Number # 0522916705 # Call Girl Number In Dubai # (UAE)
Business Bay Call Girls || 0529877582 || Call Girls Service in Business Bay Dubai
 
Deira Call Girls # 0588312479 # Call Girls In Deira Dubai ~ (UAE)
Deira Call Girls # 0588312479 # Call Girls In Deira Dubai ~ (UAE)Deira Call Girls # 0588312479 # Call Girls In Deira Dubai ~ (UAE)
Deira Call Girls # 0588312479 # Call Girls In Deira Dubai ~ (UAE)
Business Bay Call Girls || 0529877582 || Call Girls Service in Business Bay Dubai
 
DELHI NCR —@9711106444 Call Girls In Majnu Ka Tilla (MT)| Delhi
DELHI NCR —@9711106444 Call Girls In Majnu Ka Tilla (MT)| DelhiDELHI NCR —@9711106444 Call Girls In Majnu Ka Tilla (MT)| Delhi
DELHI NCR —@9711106444 Call Girls In Majnu Ka Tilla (MT)| Delhi
delhimunirka444
 
Dubai Call Girl Number # 00971588312479 # Call Girl Number In Dubai # (UAE)
Dubai Call Girl Number # 00971588312479 # Call Girl Number In Dubai # (UAE)Dubai Call Girl Number # 00971588312479 # Call Girl Number In Dubai # (UAE)
Dubai Call Girl Number # 00971588312479 # Call Girl Number In Dubai # (UAE)
Business Bay Call Girls || 0529877582 || Call Girls Service in Business Bay Dubai
 
FULL NIGHT — 9999894380 Call Girls In Mahipalpur | Delhi
FULL NIGHT — 9999894380 Call Girls In Mahipalpur | DelhiFULL NIGHT — 9999894380 Call Girls In Mahipalpur | Delhi
FULL NIGHT — 9999894380 Call Girls In Mahipalpur | Delhi
SaketCallGirlsCallUs
 
FULL NIGHT — 9999894380 Call Girls In New Ashok Nagar | Delhi
FULL NIGHT — 9999894380 Call Girls In New Ashok Nagar | DelhiFULL NIGHT — 9999894380 Call Girls In New Ashok Nagar | Delhi
FULL NIGHT — 9999894380 Call Girls In New Ashok Nagar | Delhi
SaketCallGirlsCallUs
 
FULL NIGHT — 9999894380 Call Girls In Paschim Vihar | Delhi
FULL NIGHT — 9999894380 Call Girls In  Paschim Vihar | DelhiFULL NIGHT — 9999894380 Call Girls In  Paschim Vihar | Delhi
FULL NIGHT — 9999894380 Call Girls In Paschim Vihar | Delhi
SaketCallGirlsCallUs
 

Recently uploaded (20)

Verified # 971581275265 # Indian Call Girls In Deira By International City Ca...
Verified # 971581275265 # Indian Call Girls In Deira By International City Ca...Verified # 971581275265 # Indian Call Girls In Deira By International City Ca...
Verified # 971581275265 # Indian Call Girls In Deira By International City Ca...
 
UAE Call Girls # 0528675665 # Independent Call Girls In Dubai ~ (UAE)
UAE Call Girls # 0528675665 # Independent Call Girls In Dubai ~ (UAE)UAE Call Girls # 0528675665 # Independent Call Girls In Dubai ~ (UAE)
UAE Call Girls # 0528675665 # Independent Call Girls In Dubai ~ (UAE)
 
Jeremy Casson - How Painstaking Restoration Has Revealed the Beauty of an Imp...
Jeremy Casson - How Painstaking Restoration Has Revealed the Beauty of an Imp...Jeremy Casson - How Painstaking Restoration Has Revealed the Beauty of an Imp...
Jeremy Casson - How Painstaking Restoration Has Revealed the Beauty of an Imp...
 
FULL NIGHT — 9999894380 Call Girls In Dwarka Mor | Delhi
FULL NIGHT — 9999894380 Call Girls In Dwarka Mor | DelhiFULL NIGHT — 9999894380 Call Girls In Dwarka Mor | Delhi
FULL NIGHT — 9999894380 Call Girls In Dwarka Mor | Delhi
 
Admirable # 00971529501107 # Call Girls at dubai by Dubai Call Girl
Admirable # 00971529501107 # Call Girls at dubai by Dubai Call GirlAdmirable # 00971529501107 # Call Girls at dubai by Dubai Call Girl
Admirable # 00971529501107 # Call Girls at dubai by Dubai Call Girl
 
FULL NIGHT — 9999894380 Call Girls In Saket | Delhi
FULL NIGHT — 9999894380 Call Girls In Saket | DelhiFULL NIGHT — 9999894380 Call Girls In Saket | Delhi
FULL NIGHT — 9999894380 Call Girls In Saket | Delhi
 
FULL NIGHT — 9999894380 Call Girls In Ashok Vihar | Delhi
FULL NIGHT — 9999894380 Call Girls In Ashok Vihar | DelhiFULL NIGHT — 9999894380 Call Girls In Ashok Vihar | Delhi
FULL NIGHT — 9999894380 Call Girls In Ashok Vihar | Delhi
 
Dubai Call Girl Number # 0522916705 # Call Girl Number In Dubai # (UAE)
Dubai Call Girl Number # 0522916705 # Call Girl Number In Dubai # (UAE)Dubai Call Girl Number # 0522916705 # Call Girl Number In Dubai # (UAE)
Dubai Call Girl Number # 0522916705 # Call Girl Number In Dubai # (UAE)
 
Deira Call Girls # 0588312479 # Call Girls In Deira Dubai ~ (UAE)
Deira Call Girls # 0588312479 # Call Girls In Deira Dubai ~ (UAE)Deira Call Girls # 0588312479 # Call Girls In Deira Dubai ~ (UAE)
Deira Call Girls # 0588312479 # Call Girls In Deira Dubai ~ (UAE)
 
DELHI NCR —@9711106444 Call Girls In Majnu Ka Tilla (MT)| Delhi
DELHI NCR —@9711106444 Call Girls In Majnu Ka Tilla (MT)| DelhiDELHI NCR —@9711106444 Call Girls In Majnu Ka Tilla (MT)| Delhi
DELHI NCR —@9711106444 Call Girls In Majnu Ka Tilla (MT)| Delhi
 
Dubai Call Girl Number # 00971588312479 # Call Girl Number In Dubai # (UAE)
Dubai Call Girl Number # 00971588312479 # Call Girl Number In Dubai # (UAE)Dubai Call Girl Number # 00971588312479 # Call Girl Number In Dubai # (UAE)
Dubai Call Girl Number # 00971588312479 # Call Girl Number In Dubai # (UAE)
 
FULL NIGHT — 9999894380 Call Girls In Mahipalpur | Delhi
FULL NIGHT — 9999894380 Call Girls In Mahipalpur | DelhiFULL NIGHT — 9999894380 Call Girls In Mahipalpur | Delhi
FULL NIGHT — 9999894380 Call Girls In Mahipalpur | Delhi
 
Jeremy Casson - Top Tips for Pottery Wheel Throwing
Jeremy Casson - Top Tips for Pottery Wheel ThrowingJeremy Casson - Top Tips for Pottery Wheel Throwing
Jeremy Casson - Top Tips for Pottery Wheel Throwing
 
FULL NIGHT — 9999894380 Call Girls In New Ashok Nagar | Delhi
FULL NIGHT — 9999894380 Call Girls In New Ashok Nagar | DelhiFULL NIGHT — 9999894380 Call Girls In New Ashok Nagar | Delhi
FULL NIGHT — 9999894380 Call Girls In New Ashok Nagar | Delhi
 
Storyboard short: Ferrarius Tries to Sing
Storyboard short: Ferrarius Tries to SingStoryboard short: Ferrarius Tries to Sing
Storyboard short: Ferrarius Tries to Sing
 
Jeremy Casson - An Architectural and Historical Journey Around Europe
Jeremy Casson - An Architectural and Historical Journey Around EuropeJeremy Casson - An Architectural and Historical Journey Around Europe
Jeremy Casson - An Architectural and Historical Journey Around Europe
 
(NEHA) Call Girls Mumbai Call Now 8250077686 Mumbai Escorts 24x7
(NEHA) Call Girls Mumbai Call Now 8250077686 Mumbai Escorts 24x7(NEHA) Call Girls Mumbai Call Now 8250077686 Mumbai Escorts 24x7
(NEHA) Call Girls Mumbai Call Now 8250077686 Mumbai Escorts 24x7
 
Amelia's Dad's Father of the Bride Speech
Amelia's Dad's Father of the Bride SpeechAmelia's Dad's Father of the Bride Speech
Amelia's Dad's Father of the Bride Speech
 
Editorial sephora annual report design project
Editorial sephora annual report design projectEditorial sephora annual report design project
Editorial sephora annual report design project
 
FULL NIGHT — 9999894380 Call Girls In Paschim Vihar | Delhi
FULL NIGHT — 9999894380 Call Girls In  Paschim Vihar | DelhiFULL NIGHT — 9999894380 Call Girls In  Paschim Vihar | Delhi
FULL NIGHT — 9999894380 Call Girls In Paschim Vihar | Delhi
 

Featured

How Race, Age and Gender Shape Attitudes Towards Mental Health
How Race, Age and Gender Shape Attitudes Towards Mental HealthHow Race, Age and Gender Shape Attitudes Towards Mental Health
How Race, Age and Gender Shape Attitudes Towards Mental Health
ThinkNow
 
Social Media Marketing Trends 2024 // The Global Indie Insights
Social Media Marketing Trends 2024 // The Global Indie InsightsSocial Media Marketing Trends 2024 // The Global Indie Insights
Social Media Marketing Trends 2024 // The Global Indie Insights
Kurio // The Social Media Age(ncy)
 

Featured (20)

2024 State of Marketing Report – by Hubspot
2024 State of Marketing Report – by Hubspot2024 State of Marketing Report – by Hubspot
2024 State of Marketing Report – by Hubspot
 
Everything You Need To Know About ChatGPT
Everything You Need To Know About ChatGPTEverything You Need To Know About ChatGPT
Everything You Need To Know About ChatGPT
 
Product Design Trends in 2024 | Teenage Engineerings
Product Design Trends in 2024 | Teenage EngineeringsProduct Design Trends in 2024 | Teenage Engineerings
Product Design Trends in 2024 | Teenage Engineerings
 
How Race, Age and Gender Shape Attitudes Towards Mental Health
How Race, Age and Gender Shape Attitudes Towards Mental HealthHow Race, Age and Gender Shape Attitudes Towards Mental Health
How Race, Age and Gender Shape Attitudes Towards Mental Health
 
AI Trends in Creative Operations 2024 by Artwork Flow.pdf
AI Trends in Creative Operations 2024 by Artwork Flow.pdfAI Trends in Creative Operations 2024 by Artwork Flow.pdf
AI Trends in Creative Operations 2024 by Artwork Flow.pdf
 
Skeleton Culture Code
Skeleton Culture CodeSkeleton Culture Code
Skeleton Culture Code
 
PEPSICO Presentation to CAGNY Conference Feb 2024
PEPSICO Presentation to CAGNY Conference Feb 2024PEPSICO Presentation to CAGNY Conference Feb 2024
PEPSICO Presentation to CAGNY Conference Feb 2024
 
Content Methodology: A Best Practices Report (Webinar)
Content Methodology: A Best Practices Report (Webinar)Content Methodology: A Best Practices Report (Webinar)
Content Methodology: A Best Practices Report (Webinar)
 
How to Prepare For a Successful Job Search for 2024
How to Prepare For a Successful Job Search for 2024How to Prepare For a Successful Job Search for 2024
How to Prepare For a Successful Job Search for 2024
 
Social Media Marketing Trends 2024 // The Global Indie Insights
Social Media Marketing Trends 2024 // The Global Indie InsightsSocial Media Marketing Trends 2024 // The Global Indie Insights
Social Media Marketing Trends 2024 // The Global Indie Insights
 
Trends In Paid Search: Navigating The Digital Landscape In 2024
Trends In Paid Search: Navigating The Digital Landscape In 2024Trends In Paid Search: Navigating The Digital Landscape In 2024
Trends In Paid Search: Navigating The Digital Landscape In 2024
 
5 Public speaking tips from TED - Visualized summary
5 Public speaking tips from TED - Visualized summary5 Public speaking tips from TED - Visualized summary
5 Public speaking tips from TED - Visualized summary
 
ChatGPT and the Future of Work - Clark Boyd
ChatGPT and the Future of Work - Clark Boyd ChatGPT and the Future of Work - Clark Boyd
ChatGPT and the Future of Work - Clark Boyd
 
Getting into the tech field. what next
Getting into the tech field. what next Getting into the tech field. what next
Getting into the tech field. what next
 
Google's Just Not That Into You: Understanding Core Updates & Search Intent
Google's Just Not That Into You: Understanding Core Updates & Search IntentGoogle's Just Not That Into You: Understanding Core Updates & Search Intent
Google's Just Not That Into You: Understanding Core Updates & Search Intent
 
How to have difficult conversations
How to have difficult conversations How to have difficult conversations
How to have difficult conversations
 
Introduction to Data Science
Introduction to Data ScienceIntroduction to Data Science
Introduction to Data Science
 
Time Management & Productivity - Best Practices
Time Management & Productivity -  Best PracticesTime Management & Productivity -  Best Practices
Time Management & Productivity - Best Practices
 
The six step guide to practical project management
The six step guide to practical project managementThe six step guide to practical project management
The six step guide to practical project management
 
Beginners Guide to TikTok for Search - Rachel Pearson - We are Tilt __ Bright...
Beginners Guide to TikTok for Search - Rachel Pearson - We are Tilt __ Bright...Beginners Guide to TikTok for Search - Rachel Pearson - We are Tilt __ Bright...
Beginners Guide to TikTok for Search - Rachel Pearson - We are Tilt __ Bright...
 

Art science practices and collaborations in bangalore, india