A novel RLIM/RNF12 variant disrupts protein stability and function to cause severe Tonne–Kalscheuer syndrome Francisco Bustos, Carmen Espejo-Serrano, Anna Segarra-Fas, Rachel Toth, Alison J. Eaton, Kristin D. Kernohan, Meredith J. Wilson, Lisa G. Riley. Published online 2021 May 5 presented by: Joaquin Aguirre and Daniela Álvarez Universidad Pontificia Bolivariana - Molecular Biology

1. Presented by: Joaquin Aguirre and Daniela Álvarez
Universidad Pontificia Bolivariana
3º semester - Molecular Biology

2. Global developmental delay apparent from early infancy
Speech delay
Behavioural abnormalities
Abnormal gait
It can present variable clinical manifestations
Dysmorphic facial features
Abnormal pulmonary development
Hypogenitalism
Congenital diaphragmatic hernia
Introduction
Tonne–Kalscheuer syndrome (TOKAS) is an X-linked intellectual disability syndrome
This syndrome results as a perinatal lethality due to the
diphragmatic hernia in cases of severe tokas.

3. it's a gene that codifies the E3 ubiquitin-protein ligase RLIM enzyme which ubiquitylates
transcription factor substrates to control key developmental processes including imprinted X-
chromosome inactivation, stem cell maintenance, and differentiation.
Specific disruption of RLIM activity by TOKAS variants results in deregulated stem cell
differentiation to neurons.
R L I M / R N F 1 2 .

4. Objective
Understand how the RLIM/RNF12 variant
disrupt proteins stability and function to cause
severe Tonne-Kalscheuer syndrome

5. Genomic DNA sequencing and analysis
DNA sequencing means determining the order of the nitrogenous bases, which make up the
DNA molecule. The sequence tells scientists the kind of genetic information that is carried in
a specific segment of DNA.
This article explains how they use trio exome sequencing of genomic DNA from proband
and parents. The target capture was performed with the Agilent CRE V1.0, and sequencing
was performed on the Illumina NextSeq 500 using 150 base-pair paired-end reads.

6. cDNA expression vectors and transfection
Recombinant DNA technology allows the
manipulation of an individual's genome, which
today is helpful in the medical field, in the
study and diagnosis of diseases that develop
genetic disorders.
in this study, they used this technique on
mESCs (mouse embryonic stem cells) that
were transfected with Lipofectamine LTX

7. Immunoblotting
Lysis Buffer
1.
20 mM Tris (pH 7.4)
150 mM NaCl
1 mM EDTA
1% Nonidet P-40 (NP-40)
0.5% sodium deoxycholate
10 mM β-glycerophosphate
10 mM sodium pyrophosphate
1 mM NaF,
2 mM Na3VO4
Roche Complete Protease Inhibitor
2. SDS-PAGE gels
10–30 μg of cell lysate
3. Polyvinylidene fuoride
(PVDF) membranes
4. Membranes were blocked
Tris bufered saline-tween 20 (TBS-T)
5% non-fat milk bufer
5. Antibodies
Primary:
anti-mouse RLIM amino acids 1–271
anti-ERK1/2
anti-REX1
Secondary antibodies:
Sheep IgG-horseradish peroxidase
Mouse IgG-HRP (Cell Signaling Technology)
Rabbit IgG-HRP (Cell Signaling Technology
6. Chemiluminescence
detection
Immobilon Western
Chemiluminescent HRP substrate
Gel-Doc XR+System
7.Detected protein signals
were quantifed
Image J (NIH) or
Image Studio (LI-COR Biosciences)

8. RNA extraction and quantitative RT‑PCR
It is a technique to identify a gene by means of RNA to know if it is present in the sample.
Omega total RNA extraction kit iScript cDNA synthesis Kit RT PCR
CFX384 real time PCR system
GraphPad Prism v7.0c sofware
Primers
Human RLIM:
Forward (5′–3′): ATCATCAGGCTCATCAGGTGC,
Reverse (3′–5′): AAGGAAGGGCAAAGAGCCAC;
Mouse Xist:
Forward (5′–3′): GGATCCTGCTTGAACTACTGC,
Reverse (3′–5′): CAGGCAATCCTTCTTCTTGAG:
Mouse Gapdh:
Forward (5′–3′): CTCGTCCCGTAGACAAAA,
Reverse (3′–5′): TGAATTTGCCGTGAGTGG.

13. Conclusions
This article could be of use in the medical field thanks to the variants discovery and its new knowledge of
this high-risk perinatal disease.
Its location and the way it expresses makes it easier to identify in time, in addition to discovering it is a
genetic problem and how we could correct it.
the fact that we know it is a gene linked to the X chromosome makes us conclude that it is a gene that
affects mostly the male population and that women may have the variant, but it is not expressed and can
inherit it, makes the DNA analysis easier when looking for these genomic anomalies.

14. Discussion
FRINTS SGM
In the most severe cases,
diaphragmatic hernia causes
death shortly after birth
BUSTOS F
Work from our group has
previously identified a function
for RLIM signaling in controlling
expression of neuronal genes
FRINTS SGM
TONNE E
TOKAS is a developmental disorder
characterized by clinical features including
intellectual disability, facial dysmorphism,
velopharyngeal abnormalities and
diaphragmatic hernia

15. Daniela Álvarez

16. Joaquin Aguirre