1. How does CO2 and other greenhouse gases promote global warmin
•Download as DOCX, PDF•
0 likes•2 views
1. How does CO2 and other greenhouse gases promote global warming? Discuss your opinion on the use of geoengineering measures to mitigate the effects of global warming. Your response should be at least 250 words in length. 2. How does CO2 and other greenhouse gases promote global warming? Discuss your opinion on the use of geoengineering measures to mitigate the effects of global warming. Your response should be at least 250 words in length. Raw DataNamePayResponsibilitiesSupervisionGenderDepartmentRudolph211MaleAccountingOlga211FemaleAccountingInstructionsErnest211MaleAccountingEmily211FemaleAccountingThe sheet labeled "Raw Data" lists 366 employees and their rating (1-5) of their satisfaction with their Pay, Responsibilities, and Supervision. A rating of 5 is the highest satisfaction.Bobby211MaleAccountingRaw Data also includes the Gender and Department for each employee.Benjamin211MaleAccountingBeatrice211FemaleAccountingInsert a new column in EKeith211MaleAccountingLabel this new column "Overall Satisfaction Rating"Hilda211FemaleAccountingFor each employee, compute the Overall Satisfaction Rating as the Average of Pay, Responsibilities, and Supervision.Leslie311MaleAccountingFormat Overall Satisfaction Rating to one decimal place.Curtis311MaleAccountingAlice311FemaleAccountingOn a New sheet titled Results, create a Pivot Chart & Pivot TableSophie311FemaleAccountingAssign Gender to Columns, Department to rows, and Pay to Values. Change the value field setting from Sum to Average if necessary.Sally311FemaleAccountingSort the departments in descending order of satisfaction.Melvin311MaleAccountingCreate a title for the chart, which includes your last namePearl411FemaleAccountingBe sure your chart includes a legend for male & female employees, change male color to blue and female to orangeJohnny411MaleAccountingBe sure to include axis titlesEunice411FemaleAccountingFormat the vertical axis for a max of 5 and major tick marks at 1 and one decimal place.Opal212FemaleAccountingJulia212FemaleAccountingCreate a new sheet titled "Graphs".Jimmie212MaleAccountingCopy & Paste as Picture your graph of Pay SatisfactionEsther212FemaleAccountingAlbert212MaleAccountingAlter your Pivot chart/table to display Responsibilities Satisfaction. Change titles as needed.Mike212MaleAccountingPaste this chart on the Graphs sheetMarion212MaleAccountingJosephine212FemaleAccountingAlter your Pivot chart/table to display Supervision Satisfaction. Change titles as needed.Ida212FemaleAccountingPaste this chart on the Graphs sheetGerald212MaleAccountingCaroline212FemaleAccountingAlter your Pivot chart/table to display Overall Satisfaction. Change titles as needed.Alberta212FemaleAccountingPaste this chart on the Graphs sheetLeroy312MaleAccountingLeave Results sheet with the Pivot Table & Chart displaying the Overall Satisfaction.Anita312FemaleAccountingMildred412FemaleAccountingBeulah412FemaleAccountingAda412FemaleAccountingClayton212MaleAccountingWayne312MaleA ...
Report
Share
Report
Share
Recommended
EmployeesMillennium Manufacturing, Inc.Year 2002 Budget Review - S.docx
EmployeesMillennium Manufacturing, Inc.Year 2002 Budget Review - Salariesby Lynda Fields, Accounting Temp9/10/01<-- last revisedEmployee List @September 1, 2001Last NameFirst NamePositionDepartmentShiftSalaryHire DateAdamsonTomSalesSales1Commision4/3/99AltecTonyProduct MarketerMarketing1$30,25711/9/95AndersonStephanieEngineerEngineering3$72,2308/27/96ArnoldCarolineEngineerEngineering3$62,80911/8/97BarberLisaProduct MarketerMarketing1$37,2435/9/01BarnsRolandaAdmin AssistMarketing1$22,2642/26/01BeattyRogerReceivingWarehouse2$26,4007/10/97BennettMattProduct MarketerMarketing1$56,7445/10/01BensonTomAdmin AssistAccounting2$18,2413/21/94BentonPaulGroup ManagerWarehouse1$53,7009/21/91BergerBobbyEngineerEngineering2$68,8402/25/01BordersPatSalesSales1Commision4/21/00ClausenSallyTechnicianEngineering3$29,77511/8/96CollingwoodPatAccountantAccounting1$48,96812/17/91ConardDonaldProduct MarketerMarketing1$25,8501/27/97ConleyGirardEngineerEngineering3$54,5618/26/00ConnersBurtAdmin AssistAdmin2$22,87411/9/93ConwayTomDesign SpecialistArt1$62,68110/3/96CostasJamesInventoryWarehouse2$29,5001/20/00CourtDavidChief ScientistR and D1$97,7574/4/95CumminsElenorGroup Admin AssistR and D2$27,3446/14/01D'AgostinoReneeAccountantAccounting1$41,5775/11/95DaveyLaurieSalesSales1Commision12/10/93DavisCharlesEngineerEngineering2$65,2827/1/92DickeyMadelynAdmin AssistAccounting1$21,0201/20/97DuganTheoAdmin AssistMarketing1$19,2438/29/91ElijahAnnInventoryWarehouse1$28,70012/14/00EnloeJamesGroup ManagerMarketing1$93,0575/23/92EnloeReeAdmin AssistAdmin1$28,18110/4/92EnnisReeAdmin AssistAdmin2$27,7404/3/96EnrightKenGroup Admin AssistAccounting1$29,5697/16/96FeldhausMarkInventoryWarehouse1$27,5002/26/97FoxMatthewShippingWarehouse3$28,4506/15/96GartonAlyssaEngineerEngineering1$44,9187/12/97GoldbergMalcolmProduct MarketerMarketing1$34,2233/28/92GreenwoodPatEngineerEngineering1$38,5568/27/97HarbaughJaniceAdmin AssistAdmin1$26,5154/21/96HardyBillChief ScientistR and D3$83,77610/13/96HarvardMelissaDesign SpecialistArt3$63,01811/9/92HodgeAlexUnit ManagerAdmin1$41,76211/8/99HolmesMeganGroup Admin AssistMarketing2$27,82312/15/98HongChrisAdmin AssistAdmin1$29,99211/25/97HowellDickTechnicianEngineering2$33,5747/21/00HuangJoeyAdmin AssistAdmin1$26,6962/27/95IngallsMartinGroup Admin AssistMarketing1$28,0421/20/00IngersollMikeAdmin AssistMarketing2$26,4117/22/98IvyLarryShippingWarehouse1$23,5006/16/95JacksonWilliamShippingWarehouse3$29,2005/10/98JonesDavidSalesSales1Commision5/11/94JuarezErnestoSalesSales1Commision12/16/93KaysBobProduct MarketerMarketing1$29,9518/4/93KeaneCarlaProduct MarketerMarketing2$42,4997/23/95KehrKathyAdmin AssistEngineering1$19,7471/21/93KellerJefferyAdmin AssistEngineering2$19,8312/5/93KellerJamesShippingWarehouse1$23,5001/21/96LantzFrankEngineerR and D2$41,43512/15/97LawrenceJeanSalesSales1Commision1/21/94LazaropolisPhilTechnicianEngineering1$26,9788/28/92LeeDennisEngineerEngineering2$73,5092/28/92LynchPaulAdmin AssistWarehouse2$34,5002/27/94MansonPaulInventoryWarehous ...
Link to Coffee Shop-- httpextmedia.kaplan.edubusinessMediaAB.docx
Link to Coffee Shop-- http://extmedia.kaplan.edu/business/Media/AB299/Tims_Coffee_Shop/index.html
Go to The Coffee Shop’s and look in the back office. Inside the file drawer labeled “Business” is the Coffee Shop’s Income Statement for the year for 2011. This is the most recent record the coffee shop has. This year, several large businesses are moving in around his coffee shop and he expects business to increase. You need to create a pro forma profit and loss (income) statement for this year, and you need to help him. In this assignment, discuss whether each area in the pro forma income statement will increase, decrease or stay the same due to large businesses moving into the neighboring buildings into his area and explain your rationale why that line item will increase, decrease or stay the same.
Remember, the coffee shop serves coffee to many people who work in the area, so he would certainly expect a major increase in his business volume.
This assignment is not looking for dollar figures, but primarily your justification on why the line items will change and what direction they will change, if any. You may make assumptions based on the increased sales volume and how it will affect income and expenses, if and when you do make these assumptions, please describe them and their effects on each line item.
These are the line items:
Income earned:
Expenses include:
Salaries
Rent
Depreciation
Supplies
Lease (on your refrigerator)
Tax
Interest (on loans currently held)
Insurance
Checklist:
If and when you made assumptions, based on the increased sales volume and how it will affect income and expenses, please describe them and their effects on each line item.
Given what you have assumed and projected, will the total expenses increase or decrease? Why?
Given what you have assumed and projected, will the net profit increase or decrease? Why?
Directions
Respond to the line items above and the Questions provided in a minimum of 2 pages double-spaced in a Word document, written in APA.
Cover PageComplete and copy the following to Word for your cover page. Be sure that the document is stapled properly. Do not use a plastic cover or folder.In the Footer of the Word documents, add the Now() function to show what day and time the documents were printed.Submit the Excel file to CANVAS as: lastname_firstname.xls. Hand-in the Word document immediately prior to Exam 1.Although students are encouraged to ask questions for clarification, this exercise is intended to be well within the capability of students at the 3000 level and studentsshould be able to complete the project with minimal assistance. Instructions are included on each worksheet but feel free to request clarification.ACG 3401 Accounting Information SystemsExcel AssignmentSubmitted By:Name Last: First:<-- Only use this for cover page.Spring 2015By submitting this document, I affirm that the work is the product of my own effo ...
Read MESTARTFree Excel Student TemplateDear Student,By using thi.docx
Read ME
STARTFree Excel Student TemplateDear Student,By using this Template, you hereby agree to the Copyright terms and conditions. This Template should save you considerable time and allow for your presentation to be more professional. Do not mistake this Template for doing all of the work. Your assignment is to analyze and present strategies for the next three years. You will still need to do the research and enter key internal and external information into the Template. The Template does not gather or prioritize information. It does however assimilate information you enter in a professional way and does many calculations for you once that critical information is entered. Best of luck, with your project. INSTRUCTIONS FOR TEMPLATE1Please read all Template instructions below carefully before you start each new section of this Template. Only type in the green boxes unless otherwise noted. Please read the Read ME tab at the bottom of Excel before you start.INSTRUCTIONS FOR EXTERNAL AUDIT<ONLY ENTER DATA IN THE LIGHT GREEN BOXES>1.To perform an External Audit, enter ten opportunities and ten threats. For purposes of this Template, it is vital you have ten of each, no more, no less.2.After entering ten opportunities and ten threats, enter the weight you want to assign to each factor. Be sure to check the bottom of the "Enter Weight Below" column, to make sure your entire column sums is equal to 1.003.After entering in the weights, then enter in a corresponding rating in the "Enter Rating Below" column. The coding scheme is provided below.1 = "company's response to the external factor is poor"2 = "company's response to the external factor is average"3 = "company's response to the external factor is above average"4 = "company's response to the external factor is superior"Enter Weight BelowEnter Rating BelowEnter Ten Opportunities Below1.2.3.EFE Matrix4.5.6.7.8.9.10.Enter Ten Threats BelowEnter Weight BelowEnter Rating Below1.2.3.4.5.6.7.8.9.10.0.00Instructions for Competitive Profile Matrix (CPM)<ONLY ENTER DATA IN THE LIGHT GREEN BOXES>1.To perform the CPM, enter in twelve critical success factors. You may use some of the ones listed below if you like but try to use ones that are more pertinent to your company. For example, if your case is Delta Airlines, having a) on time arrival b) extra fees c) frequent flyer points, etc may be better choices than the canned ones below. For purposes of this Template, it is vital you have twelve factors no more, no less. 2.After entering in twelve critical success factors, enter in the weight you want to assign each one. Be sure to check the bottom of the "Enter Weight Below" column, to make sure your sum weight is equal to 1.003.After entering in your weights, type the name of your company and two other competitors in the corresponding boxes.4.After entering in the weights and identifying your company and two rival firms, then enter in a corresponding rating in the "Enter Rating Below" column for ...
Chapter 3Ross, Westerfield, and Jordans Excel MasterEssentials of.docx
Chapter 3Ross, Westerfield, and Jordan's Excel MasterEssentials of Corporate Finance, 9th editionby Brad Jordan and Joe SmoliraVersion 9.0Chapter 3In these spreadsheets, you will learn how to use the following Excel functions:The following conventions are used in these spreadsheets:1) Given data in blue2) Calculations in redNOTE: Some functions used in these spreadsheets may require that the "Analysis ToolPak" or "Solver Add-In" be installed in Excel.To install these, click on the File button then "Options," "Add-Ins" and select"Go." Check "Analysis ToolPak" and "Solver Add-In," then click "OK."
SUMIF/xl/drawings/drawing1.xml#'Section%203.1'!A57
Absolute references/xl/drawings/drawing1.xml#'Section%203.1'!A26
Text boxes/xl/drawings/drawing1.xml#'Section%203.3'!A65
Shapes and lines/xl/drawings/drawing1.xml#'Section%203.3'!A65
Conditional formatting/xl/drawings/drawing1.xml#'Section%203.5'!A10
IF/xl/drawings/drawing1.xml#'Section%203.2'!A51
Section 3.1Chapter 3 - Section 1Standardized Financial StatementsThe balance sheets for Prufrock Corporation are:Prufrock Corporation2015 and 2016 Balance Sheets
($ millions)2015201620152016Current assetsCurrent liabilities Cash$ 84$ 98 Accounts payable$ 312$ 344 Accounts receivable165188 Notes payable231196 Inventory393422 Total$ 543$ 540 Total$ 642$ 708Long-term debt$ 531$ 457Owners' equityFixed assets Common stock and Net plant and equipment$ 2,731$ 2,880 paid-in surplus$ 500$ 550 Retained earnings1,799$ 2,041 Total$ 2,299$ 2,591Total assets$ 3,373$ 3,588Total liabilities and equity$ 3,373$ 3,588To construct the common-size balance sheet, we need to divide each asset account by the total assets and each liabilities and equity account by the total liabilities and equity. Once we enter the formula, we can copy and paste the formula instead of inserting in an equation in each cell. One problem with copying and pasting is that Excel keeps the formula in relation to the previous cells. For example, if you copy and paste a formula in cell B5 that references cell B2, wherever you paste the equation, it will always reference 3 cells above where you pasted it. For example, if you paste a formula from cell B5 that references cell B2 into cell D12, in the new position it will reference cell D9. A solution is to use absolute references in your formula.RWJ Excel TipTo use an absolute reference, use the $ before the column letter and row number. For example, to reference cell E21 when you copy and paste a formula, you would enter it as $E$21. A quick way to do this is just enter E21, then hit the F4 key. Wherever copied and pasted, this equation will always reference cell E21. If you want to reference the column and not the row, you would enter $E21, or if you want to reference the row and not the column, you would enter it as E$21.Using absolute references and the balance sheet from the previous worksheet, the common-sized balance sheet is:Prufrock Corp.
Dervy bis 155 final exam guide music on demand new
bis 155,bis 155 entire course,bis 155 devry,devry bis 155,bis 155 ilabs,bis 155 exercise, bis 155 final exam,devry bis 155 final exam,bis 155 course project,bis 155 free,bis 155 week 1,bis 155 week 2,bis 155 week 3,bis 155 week 4,bis 155 week 5,bis 155 week 6
Work Together Problem 14.1-14.6Problem Number Work Together 14.2.docx
This document provides instructions for completing an 8-column worksheet for a merchandising business for Coastal Aquatics for the year ended December 31, 2020. The instructions include entering missing account totals in the trial balance, recording adjustments for supplies, prepaid insurance, and merchandise inventory, and completing the income statement and balance sheet columns with formulas. The adjustments are to be recorded in the adjustments debit and credit columns with identifying letters in parentheses.
Work Together Problem 14.1-14.6Problem Number Work Together 14.2.docx
Work Together Problem 14.1-14.6Problem Number: Work Together 14.2 - 14.6Student's Name:Coastal Aquatics Work SheetFor Year Ended December 31, 2020Work Together 14-2Work Together 14-3 to 14-6Trial BalanceAdjustmentsIncome StatementBalance SheetAccount TitleDebitCreditDebitCreditDebitCreditDebitCreditCash18,485.000.00[F]Petty Cash300.000.00[F]Accounts Receivable[F]Allow. for Uncoll. Accounts0.00524.84[F]Merchandise Inventory248,752.250.00[F]Supplies--Office5,485.25(a)0.00[F]Supplies--Store4,578.360.00[F]Prepaid Insurance6,200.000.00[F]Office Equipment35,487.250.00[F]Acc. Depr.--Office Equipment0.0012,485.25[F]Store Equipment40,849.500.00[F]Acc. Depr.--Store Equipment0.0015,483.25[F]Accounts Payable[F]Federal Income Tax Payable0.000.00[F]Emp. Income Tax Pay.--Fed.0.00998.00[F]Social Security Tax Payable0.00774.07[F]Medicare Tax Payable0.00181.03[F]Sales Tax Payable0.001,848.35[F]Unemp. Tax Pay.--Federal0.0024.00[F]Unemp. Tax Pay.--State0.00162.00[F]Health Ins. Premiums Pay.0.00950.00[F]U.S. Savings Bonds Payable0.0080.00[F]United Way Donations Pay.0.0075.00[F]Dividends Payable0.0010,000.00[F]Capital Stock 0.00175,000.00[F]Retained Earnings0.0012,577.45[F]Dividends21,000.000.00[F]Income Summary0.000.00[F]Sales[F]Sales Discount648.250.00[F]Sales Returns and Allow.8,157.270.00[F]Purchases[F]Purchases Discount0.004,615.25[F]Purch. Returns and Allow.0.009,497.00[F]Advertising Expense15,280.000.00[F]Cash Short and Over12.850.00[F]Credit Card Fee Expense6,482.270.00[F]Depr. Exp.--Office Equipment0.000.00[F]Depr. Exp.--Store Equipment0.000.00[F]Insurance Expense0.000.00[F]Miscellaneous Expense4,568.970.00[F]Payroll Taxes Expense16,184.250.00[F]Rent Expense24,000.000.00[F]Salary Expense204,180.85[F]Supplies Expense--Office0.000.00(a)0.00[F]Supplies Expense--Store0.000.00[F]Uncollectible Accounts Exp.0.000.00[F]Utilities Expense4,264.280.00[F]Fed. Income Tax Expense40,000.000.00[F][F][F][F][F][F][F][F][F]Net Inc. after Fed. Income Tax[F][F][F][F][F][F]Column Verification[L][L][L][L]Work Together 14-6Before Federal Income TaxFederal Income TaxRateTotal of Income Statement Credit[F]First $50,00015%[F]Total of Income Statement Debit[F]Next $25,00025%[F]Net Income Before Federal Taxes[F]Next $25,00034%[F][F]-100,000.00 =[F]39%[F]Total Federal Income Tax[F]
&A &P of © 2009 South-Western, Cengage Learning
CENTURY 21 ACCOUNTING © 2009 South-Western, Cengage Learning
Chapter 14
I can understand how to
begin an 8-Column Work
Sheet for a
Merchandising Business
by completing
adjustments.
CENTURY 21 ACCOUNTING © 2009 South-Western, Cengage Learning
2
LESSON 14-2
RECORDING A TRIAL BALANCE ON A
WORK SHEET page 410
1
3
21. Account
title2. Account balance
3. Total, prove, and
rule the debit and
credit columns
I will understand how to begin an 8-Column Work Sheet for a
Merchandising Business by completing adjustments.
CENTURY 21 ACCOUNTING © 2009 South-Western, Cengage Learning
3
LESSON 14-2
ANALYZING AND RECORDING SUPPLIES
ADJUSTMENT.
Devry bis 155 final exam guide (music on demand) new
bis 155 week 1 ilab data analysis with spreadsheets with lab,bis 155 week 1 quiz data analysis with spreadsheets with lab,bis 155 week 1 to week 5 all quiz,bis 155 week 1 to week 7 all discussions,devry bis 155 week 1,bis 155 week 1,devry bis 155,bis 155,devry bis 155 week 1 tutorial,devry bis 155 week 1 assignment,devry bis 155 week 1 help
Recommended
EmployeesMillennium Manufacturing, Inc.Year 2002 Budget Review - S.docx
EmployeesMillennium Manufacturing, Inc.Year 2002 Budget Review - Salariesby Lynda Fields, Accounting Temp9/10/01<-- last revisedEmployee List @September 1, 2001Last NameFirst NamePositionDepartmentShiftSalaryHire DateAdamsonTomSalesSales1Commision4/3/99AltecTonyProduct MarketerMarketing1$30,25711/9/95AndersonStephanieEngineerEngineering3$72,2308/27/96ArnoldCarolineEngineerEngineering3$62,80911/8/97BarberLisaProduct MarketerMarketing1$37,2435/9/01BarnsRolandaAdmin AssistMarketing1$22,2642/26/01BeattyRogerReceivingWarehouse2$26,4007/10/97BennettMattProduct MarketerMarketing1$56,7445/10/01BensonTomAdmin AssistAccounting2$18,2413/21/94BentonPaulGroup ManagerWarehouse1$53,7009/21/91BergerBobbyEngineerEngineering2$68,8402/25/01BordersPatSalesSales1Commision4/21/00ClausenSallyTechnicianEngineering3$29,77511/8/96CollingwoodPatAccountantAccounting1$48,96812/17/91ConardDonaldProduct MarketerMarketing1$25,8501/27/97ConleyGirardEngineerEngineering3$54,5618/26/00ConnersBurtAdmin AssistAdmin2$22,87411/9/93ConwayTomDesign SpecialistArt1$62,68110/3/96CostasJamesInventoryWarehouse2$29,5001/20/00CourtDavidChief ScientistR and D1$97,7574/4/95CumminsElenorGroup Admin AssistR and D2$27,3446/14/01D'AgostinoReneeAccountantAccounting1$41,5775/11/95DaveyLaurieSalesSales1Commision12/10/93DavisCharlesEngineerEngineering2$65,2827/1/92DickeyMadelynAdmin AssistAccounting1$21,0201/20/97DuganTheoAdmin AssistMarketing1$19,2438/29/91ElijahAnnInventoryWarehouse1$28,70012/14/00EnloeJamesGroup ManagerMarketing1$93,0575/23/92EnloeReeAdmin AssistAdmin1$28,18110/4/92EnnisReeAdmin AssistAdmin2$27,7404/3/96EnrightKenGroup Admin AssistAccounting1$29,5697/16/96FeldhausMarkInventoryWarehouse1$27,5002/26/97FoxMatthewShippingWarehouse3$28,4506/15/96GartonAlyssaEngineerEngineering1$44,9187/12/97GoldbergMalcolmProduct MarketerMarketing1$34,2233/28/92GreenwoodPatEngineerEngineering1$38,5568/27/97HarbaughJaniceAdmin AssistAdmin1$26,5154/21/96HardyBillChief ScientistR and D3$83,77610/13/96HarvardMelissaDesign SpecialistArt3$63,01811/9/92HodgeAlexUnit ManagerAdmin1$41,76211/8/99HolmesMeganGroup Admin AssistMarketing2$27,82312/15/98HongChrisAdmin AssistAdmin1$29,99211/25/97HowellDickTechnicianEngineering2$33,5747/21/00HuangJoeyAdmin AssistAdmin1$26,6962/27/95IngallsMartinGroup Admin AssistMarketing1$28,0421/20/00IngersollMikeAdmin AssistMarketing2$26,4117/22/98IvyLarryShippingWarehouse1$23,5006/16/95JacksonWilliamShippingWarehouse3$29,2005/10/98JonesDavidSalesSales1Commision5/11/94JuarezErnestoSalesSales1Commision12/16/93KaysBobProduct MarketerMarketing1$29,9518/4/93KeaneCarlaProduct MarketerMarketing2$42,4997/23/95KehrKathyAdmin AssistEngineering1$19,7471/21/93KellerJefferyAdmin AssistEngineering2$19,8312/5/93KellerJamesShippingWarehouse1$23,5001/21/96LantzFrankEngineerR and D2$41,43512/15/97LawrenceJeanSalesSales1Commision1/21/94LazaropolisPhilTechnicianEngineering1$26,9788/28/92LeeDennisEngineerEngineering2$73,5092/28/92LynchPaulAdmin AssistWarehouse2$34,5002/27/94MansonPaulInventoryWarehous ...
Link to Coffee Shop-- httpextmedia.kaplan.edubusinessMediaAB.docx
Link to Coffee Shop-- http://extmedia.kaplan.edu/business/Media/AB299/Tims_Coffee_Shop/index.html
Go to The Coffee Shop’s and look in the back office. Inside the file drawer labeled “Business” is the Coffee Shop’s Income Statement for the year for 2011. This is the most recent record the coffee shop has. This year, several large businesses are moving in around his coffee shop and he expects business to increase. You need to create a pro forma profit and loss (income) statement for this year, and you need to help him. In this assignment, discuss whether each area in the pro forma income statement will increase, decrease or stay the same due to large businesses moving into the neighboring buildings into his area and explain your rationale why that line item will increase, decrease or stay the same.
Remember, the coffee shop serves coffee to many people who work in the area, so he would certainly expect a major increase in his business volume.
This assignment is not looking for dollar figures, but primarily your justification on why the line items will change and what direction they will change, if any. You may make assumptions based on the increased sales volume and how it will affect income and expenses, if and when you do make these assumptions, please describe them and their effects on each line item.
These are the line items:
Income earned:
Expenses include:
Salaries
Rent
Depreciation
Supplies
Lease (on your refrigerator)
Tax
Interest (on loans currently held)
Insurance
Checklist:
If and when you made assumptions, based on the increased sales volume and how it will affect income and expenses, please describe them and their effects on each line item.
Given what you have assumed and projected, will the total expenses increase or decrease? Why?
Given what you have assumed and projected, will the net profit increase or decrease? Why?
Directions
Respond to the line items above and the Questions provided in a minimum of 2 pages double-spaced in a Word document, written in APA.
Cover PageComplete and copy the following to Word for your cover page. Be sure that the document is stapled properly. Do not use a plastic cover or folder.In the Footer of the Word documents, add the Now() function to show what day and time the documents were printed.Submit the Excel file to CANVAS as: lastname_firstname.xls. Hand-in the Word document immediately prior to Exam 1.Although students are encouraged to ask questions for clarification, this exercise is intended to be well within the capability of students at the 3000 level and studentsshould be able to complete the project with minimal assistance. Instructions are included on each worksheet but feel free to request clarification.ACG 3401 Accounting Information SystemsExcel AssignmentSubmitted By:Name Last: First:<-- Only use this for cover page.Spring 2015By submitting this document, I affirm that the work is the product of my own effo ...
Read MESTARTFree Excel Student TemplateDear Student,By using thi.docx
Read ME
STARTFree Excel Student TemplateDear Student,By using this Template, you hereby agree to the Copyright terms and conditions. This Template should save you considerable time and allow for your presentation to be more professional. Do not mistake this Template for doing all of the work. Your assignment is to analyze and present strategies for the next three years. You will still need to do the research and enter key internal and external information into the Template. The Template does not gather or prioritize information. It does however assimilate information you enter in a professional way and does many calculations for you once that critical information is entered. Best of luck, with your project. INSTRUCTIONS FOR TEMPLATE1Please read all Template instructions below carefully before you start each new section of this Template. Only type in the green boxes unless otherwise noted. Please read the Read ME tab at the bottom of Excel before you start.INSTRUCTIONS FOR EXTERNAL AUDIT<ONLY ENTER DATA IN THE LIGHT GREEN BOXES>1.To perform an External Audit, enter ten opportunities and ten threats. For purposes of this Template, it is vital you have ten of each, no more, no less.2.After entering ten opportunities and ten threats, enter the weight you want to assign to each factor. Be sure to check the bottom of the "Enter Weight Below" column, to make sure your entire column sums is equal to 1.003.After entering in the weights, then enter in a corresponding rating in the "Enter Rating Below" column. The coding scheme is provided below.1 = "company's response to the external factor is poor"2 = "company's response to the external factor is average"3 = "company's response to the external factor is above average"4 = "company's response to the external factor is superior"Enter Weight BelowEnter Rating BelowEnter Ten Opportunities Below1.2.3.EFE Matrix4.5.6.7.8.9.10.Enter Ten Threats BelowEnter Weight BelowEnter Rating Below1.2.3.4.5.6.7.8.9.10.0.00Instructions for Competitive Profile Matrix (CPM)<ONLY ENTER DATA IN THE LIGHT GREEN BOXES>1.To perform the CPM, enter in twelve critical success factors. You may use some of the ones listed below if you like but try to use ones that are more pertinent to your company. For example, if your case is Delta Airlines, having a) on time arrival b) extra fees c) frequent flyer points, etc may be better choices than the canned ones below. For purposes of this Template, it is vital you have twelve factors no more, no less. 2.After entering in twelve critical success factors, enter in the weight you want to assign each one. Be sure to check the bottom of the "Enter Weight Below" column, to make sure your sum weight is equal to 1.003.After entering in your weights, type the name of your company and two other competitors in the corresponding boxes.4.After entering in the weights and identifying your company and two rival firms, then enter in a corresponding rating in the "Enter Rating Below" column for ...
Chapter 3Ross, Westerfield, and Jordans Excel MasterEssentials of.docx
Chapter 3Ross, Westerfield, and Jordan's Excel MasterEssentials of Corporate Finance, 9th editionby Brad Jordan and Joe SmoliraVersion 9.0Chapter 3In these spreadsheets, you will learn how to use the following Excel functions:The following conventions are used in these spreadsheets:1) Given data in blue2) Calculations in redNOTE: Some functions used in these spreadsheets may require that the "Analysis ToolPak" or "Solver Add-In" be installed in Excel.To install these, click on the File button then "Options," "Add-Ins" and select"Go." Check "Analysis ToolPak" and "Solver Add-In," then click "OK."
SUMIF/xl/drawings/drawing1.xml#'Section%203.1'!A57
Absolute references/xl/drawings/drawing1.xml#'Section%203.1'!A26
Text boxes/xl/drawings/drawing1.xml#'Section%203.3'!A65
Shapes and lines/xl/drawings/drawing1.xml#'Section%203.3'!A65
Conditional formatting/xl/drawings/drawing1.xml#'Section%203.5'!A10
IF/xl/drawings/drawing1.xml#'Section%203.2'!A51
Section 3.1Chapter 3 - Section 1Standardized Financial StatementsThe balance sheets for Prufrock Corporation are:Prufrock Corporation2015 and 2016 Balance Sheets
($ millions)2015201620152016Current assetsCurrent liabilities Cash$ 84$ 98 Accounts payable$ 312$ 344 Accounts receivable165188 Notes payable231196 Inventory393422 Total$ 543$ 540 Total$ 642$ 708Long-term debt$ 531$ 457Owners' equityFixed assets Common stock and Net plant and equipment$ 2,731$ 2,880 paid-in surplus$ 500$ 550 Retained earnings1,799$ 2,041 Total$ 2,299$ 2,591Total assets$ 3,373$ 3,588Total liabilities and equity$ 3,373$ 3,588To construct the common-size balance sheet, we need to divide each asset account by the total assets and each liabilities and equity account by the total liabilities and equity. Once we enter the formula, we can copy and paste the formula instead of inserting in an equation in each cell. One problem with copying and pasting is that Excel keeps the formula in relation to the previous cells. For example, if you copy and paste a formula in cell B5 that references cell B2, wherever you paste the equation, it will always reference 3 cells above where you pasted it. For example, if you paste a formula from cell B5 that references cell B2 into cell D12, in the new position it will reference cell D9. A solution is to use absolute references in your formula.RWJ Excel TipTo use an absolute reference, use the $ before the column letter and row number. For example, to reference cell E21 when you copy and paste a formula, you would enter it as $E$21. A quick way to do this is just enter E21, then hit the F4 key. Wherever copied and pasted, this equation will always reference cell E21. If you want to reference the column and not the row, you would enter $E21, or if you want to reference the row and not the column, you would enter it as E$21.Using absolute references and the balance sheet from the previous worksheet, the common-sized balance sheet is:Prufrock Corp.
Dervy bis 155 final exam guide music on demand new
bis 155,bis 155 entire course,bis 155 devry,devry bis 155,bis 155 ilabs,bis 155 exercise, bis 155 final exam,devry bis 155 final exam,bis 155 course project,bis 155 free,bis 155 week 1,bis 155 week 2,bis 155 week 3,bis 155 week 4,bis 155 week 5,bis 155 week 6
Work Together Problem 14.1-14.6Problem Number Work Together 14.2.docx
This document provides instructions for completing an 8-column worksheet for a merchandising business for Coastal Aquatics for the year ended December 31, 2020. The instructions include entering missing account totals in the trial balance, recording adjustments for supplies, prepaid insurance, and merchandise inventory, and completing the income statement and balance sheet columns with formulas. The adjustments are to be recorded in the adjustments debit and credit columns with identifying letters in parentheses.
Work Together Problem 14.1-14.6Problem Number Work Together 14.2.docx
Work Together Problem 14.1-14.6Problem Number: Work Together 14.2 - 14.6Student's Name:Coastal Aquatics Work SheetFor Year Ended December 31, 2020Work Together 14-2Work Together 14-3 to 14-6Trial BalanceAdjustmentsIncome StatementBalance SheetAccount TitleDebitCreditDebitCreditDebitCreditDebitCreditCash18,485.000.00[F]Petty Cash300.000.00[F]Accounts Receivable[F]Allow. for Uncoll. Accounts0.00524.84[F]Merchandise Inventory248,752.250.00[F]Supplies--Office5,485.25(a)0.00[F]Supplies--Store4,578.360.00[F]Prepaid Insurance6,200.000.00[F]Office Equipment35,487.250.00[F]Acc. Depr.--Office Equipment0.0012,485.25[F]Store Equipment40,849.500.00[F]Acc. Depr.--Store Equipment0.0015,483.25[F]Accounts Payable[F]Federal Income Tax Payable0.000.00[F]Emp. Income Tax Pay.--Fed.0.00998.00[F]Social Security Tax Payable0.00774.07[F]Medicare Tax Payable0.00181.03[F]Sales Tax Payable0.001,848.35[F]Unemp. Tax Pay.--Federal0.0024.00[F]Unemp. Tax Pay.--State0.00162.00[F]Health Ins. Premiums Pay.0.00950.00[F]U.S. Savings Bonds Payable0.0080.00[F]United Way Donations Pay.0.0075.00[F]Dividends Payable0.0010,000.00[F]Capital Stock 0.00175,000.00[F]Retained Earnings0.0012,577.45[F]Dividends21,000.000.00[F]Income Summary0.000.00[F]Sales[F]Sales Discount648.250.00[F]Sales Returns and Allow.8,157.270.00[F]Purchases[F]Purchases Discount0.004,615.25[F]Purch. Returns and Allow.0.009,497.00[F]Advertising Expense15,280.000.00[F]Cash Short and Over12.850.00[F]Credit Card Fee Expense6,482.270.00[F]Depr. Exp.--Office Equipment0.000.00[F]Depr. Exp.--Store Equipment0.000.00[F]Insurance Expense0.000.00[F]Miscellaneous Expense4,568.970.00[F]Payroll Taxes Expense16,184.250.00[F]Rent Expense24,000.000.00[F]Salary Expense204,180.85[F]Supplies Expense--Office0.000.00(a)0.00[F]Supplies Expense--Store0.000.00[F]Uncollectible Accounts Exp.0.000.00[F]Utilities Expense4,264.280.00[F]Fed. Income Tax Expense40,000.000.00[F][F][F][F][F][F][F][F][F]Net Inc. after Fed. Income Tax[F][F][F][F][F][F]Column Verification[L][L][L][L]Work Together 14-6Before Federal Income TaxFederal Income TaxRateTotal of Income Statement Credit[F]First $50,00015%[F]Total of Income Statement Debit[F]Next $25,00025%[F]Net Income Before Federal Taxes[F]Next $25,00034%[F][F]-100,000.00 =[F]39%[F]Total Federal Income Tax[F]
&A &P of © 2009 South-Western, Cengage Learning
CENTURY 21 ACCOUNTING © 2009 South-Western, Cengage Learning
Chapter 14
I can understand how to
begin an 8-Column Work
Sheet for a
Merchandising Business
by completing
adjustments.
CENTURY 21 ACCOUNTING © 2009 South-Western, Cengage Learning
2
LESSON 14-2
RECORDING A TRIAL BALANCE ON A
WORK SHEET page 410
1
3
21. Account
title2. Account balance
3. Total, prove, and
rule the debit and
credit columns
I will understand how to begin an 8-Column Work Sheet for a
Merchandising Business by completing adjustments.
CENTURY 21 ACCOUNTING © 2009 South-Western, Cengage Learning
3
LESSON 14-2
ANALYZING AND RECORDING SUPPLIES
ADJUSTMENT.
Devry bis 155 final exam guide (music on demand) new
bis 155 week 1 ilab data analysis with spreadsheets with lab,bis 155 week 1 quiz data analysis with spreadsheets with lab,bis 155 week 1 to week 5 all quiz,bis 155 week 1 to week 7 all discussions,devry bis 155 week 1,bis 155 week 1,devry bis 155,bis 155,devry bis 155 week 1 tutorial,devry bis 155 week 1 assignment,devry bis 155 week 1 help
Quick charts
Charts and graphs are used to make information clearer and easier to understand. They play a critical role in helping people to visualise large amounts of information, make better decisions and communicate their results to others.
This modelling guide explains how to make quick charts and how they can be useful in analysing data.
In this guide we analyse the trend of operating revenues, operating costs and operating profits / (losses) over the timeline of a project.
Devry bis-155-final-exam-guide-new
bis 155,devry bis 155,devry bis 155 complete course,devry bis 155 entire course,bis 155 final exams,devry bis 155 week 1,devry bis 155 week2,devry bis 155 week 3,devry bis 155 week 4,devry bis 155 week 5,devry bis 155 week 6,devry bis 155 tutorials,devry bis 155 assignments,bis 155 help
PART IWelcome to the Free Excel Student Template Version 16.1.11De.docx
PART IWelcome to the Free Excel Student Template Version 16.1.11Dear Student,By using this Template, you hereby agree to the Copyright terms and conditions. This Template should save you considerable time and allow for your presentation to be more professional. Do not mistake this Template for doing all of the work. Your assignment is to analyze and present strategies for the next three years. You will still need to do the research and enter key internal and external information into the Template. The Template does not gather or prioritize information. It does however assimilate information you enter in a professional way and does many calculations for you once that critical information is entered. Refer to the David & David textbook for conceptual guidelines for developing all matrices and analyses included in this Template. Best of luck with your project. Instructions for Using the Template1Please read all Template instructions below carefully before you start each new section of this Template. Only type in the green boxes. Refer to the David & David textbook for conceptual guidelines for every matrix and analysis in this Template.2This Template is organized into three primary parts: Part I, Part II, and the respective data output pages for your respective matrices. All data entered will be entered into Part I or Part II. Part I consists of data entry in developing matrices, where Part II consists of data entry for your financial information, including ratios, financial statements, and projected financial statements. Blue buttons are provided for navigating within and to Part I, yellow buttons are for navigating within and to Part II, orange buttons are for navigating to the respective matrices and pink buttons are for navigating to your financial output tables. The navigation buttons along the top of Part I and Part II may not be visible for Apple users but all other features should work without any problems.Strengths and Weaknesses1Enter into the Template exactly 10 strengths and 10 weaknesses, no more and no less. Your factors should be detailed and actionable rather than vague. For example, the strength: "Sales up nicely" is too vague and not actionable; "Sales were up 15% on women's apparel in China during 2015" is stated far better. Always be thinking in terms of divisions when writing strengths and weaknesses. Note women's apparel could be a division for Nike. All divisions do not need to be treated equally; allow more coverage for divisions with more revenue and those most pertinent to your strategic plan.2Weights reveal how important a factor is to being successful in the industry. All weights are "industry-based." A factor of 0.10 for example is 5 times more important than a factor of 0.02 for being successful in the industry. Do not be afraid to include factors with lower weights though. To have a factor make your top 10 list (10 strengths for example out of the 100s the firm likely has), justifies its importance, ye ...
Directions Flexible Budget Performance Report Project You a.docx
Directions
Flexible Budget Performance Report Project
You and your partner will each work on this project on your own laptops, using each other for resources while completing the assignment. In the end, you will Turn in ONE project per team. If you or your partner feels you did not share equally in the work, email me for a possible grade adjustment. Otherwise, you will both receive the same grade. Upload your completed project to Canvas using “Flex Budget_Last Name ID#_Last name ID# “ as the file name.
Kelsey’s Frozen Confectionaries buys and distributes single-serve ice cream treats to convenience stores, ballparks, and amusement parks. In this project, you will create 1) a master budget performance report, and 2) a flexible budget performance report for Kelsey's Frozen Confectionaries. Your performance reports should be developed in such a way that any changes to the original assumptions will correctly ripple through the entire spreadsheet. After developing the performance reports, you will answer questions about the variances and determine whether the variances are consistent with management's explanation about operational changes that took place during the period.
Part 1) DIRECTIONS for Master Budget Performance Report:
1) Use the budget assumptions, along with Excel formulas, to populate the Master Budget column. Note: Your formulas must work such that if ANY of the budget assumptions change, the new assumptions ripple through the entire budget. Part of your grade will be based on whether you correctly formulate the cells. Do NOT TYPE A NUMBER IN ANY CELL!!!
2) Use a formula to calculate the “variance” in cell H7: (Actual – Budget). Copy and paste (or use the fill handle to drag) the formula to the rest of the cells in the column. Leave as positive or negative, rather than absolute values.
3) Use a formula to calculate the “Variance percentage”. NOTE: The percentage is the variance as a percent of the Master Budget. Copy and paste (or drag) the formula to the rest of the cells in the column
4) Format cells appropriately. Attention to detail makes a report look more professional. (For example, percentages shown as %, dollar signs using the accounting or currency format, underlines and double underlines where appropriate, zero decimal places for dollar amounts, etc.,).
5) Use the “If” statement function to show the variances as U or F. The “If” statement can be found under “Formulas, Logical”. Example: =IF(H7>=0,"F","U"). This formula means: If cell H7>0 or H7=0, then mark as “F”; If not greater than or equal to 0, mark as “U”. Be careful with revenues and expense variances since they should be opposite of one another. ALSO- The formula you use should mark any variance of “0” as an “F” since a zero variance means that budget expectations have been met. After using the function, check each line to make sure it is going in the direction you believe it should go.
6) Check your answers us.
Directions Flexible Budget Performance Report Project You a.docx
This document provides directions for creating a master budget performance report and flexible budget performance report for Kelsey's Frozen Confectionaries. It includes instructions for populating the reports with formulas to calculate variances, percentages, and conditional formatting. It also provides questions to analyze the variances and determine if they are consistent with management's explanations for operational changes. The directions are extensive and provide examples to check calculations.
Assignment 2 lasa 1 the costs of production
Joseph Farms, Inc. is a small agricultural firm that has provided limited cost data to determine the profit maximizing output level. You are asked to complete two tables analyzing the cost and revenue data for output levels from 1 to 10 units. Table 1 requires calculating total, average, and marginal costs and revenues. Table 2 calculates total revenue, profit, and loss for each output level. You must also explain the marginal cost equals marginal revenue rule, identify the profit maximizing output, and explain why a purely competitive firm is a price taker.
RATIO ANALYSISRatio analysis expresses the relationship amon.docx
RATIO ANALYSIS
Ratio analysis expresses the relationship among selected items of financial statement data. A ratio expresses the mathematical relationship between one quantity and another. For analysis of the primary financial statements, we classify ratios as follows.
Illustration 2-9
Financial ratio classifications
A single ratio by itself is not very meaningful. Accordingly, in this and the following chapters, we will use various comparisons to shed light on company performance:
1.
Intracompany comparisons covering two years for the same company.
2.
Industry-average comparisons based on average ratios for particular industries.
3.
Intercompany comparisons based on comparisons with a competitor in the same industry
Question 1
Using these data from the comparative balance sheet of Rosalez Company, perform horizontal analysis. (If amount and percentage are a decrease show the numbers as negative, e.g. -55,000, -20% or (55,000), (20%). Round percentages to 0 decimal places, e.g. 12%.)
Increase or (Decrease)
Dec. 31, 2012
Dec. 31, 2011
Amount
Percentage
Accounts receivable
$ 545,500
$ 393,400
$
%
Inventory
$ 820,400
$ 604,600
$
%
Total assets
$3,146,500
$2,742,100
$
%
Question 2
Using these data from the comparative balance sheet of Rosalez Company, perform vertical analysis. (Round percentages to 1 decimal place, e.g. 12.5%.)
Dec. 31, 2012
Dec. 31, 2011
Amount
Percentage
Amount
Percentage
Accounts receivable
$ 543,900
%
$ 417,700
%
Inventory
$ 821,700
%
$ 617,000
%
Total assets
$3,175,700
%
$2,787,300
%
Question 3
Vertical analysis (common-size) percentages for Vallejo Company’s sales, cost of goods sold, and expenses are listed here.
Vertical Analysis
2012
2011
2010
Sales
100
%
100
%
100
%
Cost of goods sold
60.8
63.8
66.4
Expenses
24.7
27.8
28.8
Did Vallejo’s net income as a percent of sales increase, decrease, or remain unchanged over the 3-year period? Provide numerical support for your answer.
Question 4
Horizontal analysis (trend analysis) percentages for Spartan Company’s sales, cost of goods sold, and expenses are listed here.
Horizontal Analysis
2012
2011
2010
Sales
96.2
%
104.8
%
100.0
%
Cost of goods sold
101.0
98.0
100.0
Expenses
105.6
95.4
100.0
Explain whether Spartan’s net income increased, decreased, or remained unchanged over the 3-year period.
Question 5
These selected condensed data are taken from recent balance sheets of Bob Evans Farms (in thousands).
2009
2008
Cash
$ 13,606
$ 7,669
Accounts receivable
23,045
19,951
Inventories
31,087
31,345
Other current assets
12,522
11,909
Total current assets
$ 80,260
$ 70,874
Total current liabilities
$245,805
$326,203
(a)
Compute the current ratio for each year. (Round answers to 2 decimal places, e.g. .12 : 1.)
2009
2008
Current ratio:
:1
:1
Question 6
Staples, Inc. is one of the largest suppliers ...
Joseph Farms, Inc. is a small firm in the agricultural industry. The.docx
Joseph Farms, Inc. is a small firm in the agricultural industry. They have asked you to help them complete the limited data they have gathered in an effort to enable effective decision-making. Some work can be done using MS Excel but it must be copied to an MS Word file for the final submission of this assignment. To assist Joseph Farms, Inc., respond to the following:
Using MS Excel or a table in MS Word, complete Table-1 (Joseph Farms, Inc., Cost and Revenue Data)
.
Assume that the price is $165.
Assume the fixed costs are $125, at an output level of 1.
Assume that the data represents a firm in pure competition.
Show your calculations.
Explain the
MC=MR Rule
. Describe the market structures to which this rule applies
.
Create a chart to illustrate the data in Columns 9 and 10
.
Describe the profit maximizing (or loss minimizing) output for this firm. Explain why or why not there an accounting profit
?
Explain why a firm in pure competition is considered to be a “price taker.”
(Assignment continues below Table-1.)
Table-1: Joseph Farms, Inc., Cost and Revenue Data
Column 1
Column 2
Column 3
Column 4
Column 5
Column 6
Column 7
Column 8
Column 9
Column 10
Column 11
Output
Level
Price per unit
Total Fixed Cost
Total Variable Cost
Total Cost
Average Fixed Cost
Average Variable Cost
Average Total Cost
Marginal
Cost
Marginal Revenue
Total Revenue
0
$ -
NA
1
$ 113.00
2
$ 213.00
3
$ 300.00
4
$ 375.00
5
$ 463.00
6
$ 563.00
7
$ 675.00
8
$ 813.00
9
$ 975.00
10
$ 1,163.00
Using the data in Table-1 (Joseph Farms, Inc., Cost and Revenue Data), complete Table-2 (Joseph Farms, Inc., Revenue/Profit/Loss Data). Show your calculations in summary form
.
Using the completed data in Table-2 (Joseph Farms, Inc., Revenue/Profit/Loss Data), Identify the break even output level for this firm
.
Table-2: Joseph Farms, Inc., Revenue/Profit/Loss Data
Output
Level
Price
Total Revenue
Total Costs from Table 1
Profit or Loss
0
1
2
3
4
5
6
7
8
9
10
Save your MS Word file including your graphs or charts using the filename
.
InstructionsTITLEF14-2Beginning an 8-column work sheet for a merch.docx
InstructionsTITLEF14-2Beginning an 8-column work sheet for a merchandising businessF14-3Analyzing and recording a merchandise inventory adjustment on a worksheetSTEPS1.Read all of the steps before completing the spreadsheet.2.Click the Application Problem 14-2, 14-3 tab to view the blank data file.3.Key your name in cell B2.4.Key, For Month Ended December 31, 20-- (use the current year), in cell C5.5.Cells containing [F] require a formula. Create and key formulas to total the Trial Balance columns.6.Cells containing [L] require a logical formula. Use the logical formula described on page 443 in your textbook. The IF function is another type of logical formula. IF functions compare two values and produce one result if the comparison is TRUE and an alternate result if the comparison is FALSE. Try using an IF function in step 6. The result should show the amount of the variance if the column totals are out of balance or OK if they are in balance. Consult Help if you need assistance with IF functions. 7.Key the adjusting entries for Supplies--Office, Supplies--Store, Prepaid Insurance and Merchandise Inventory on the appropriate line of the Adjustments Debit or Credit column. Use column E for a debit amount and Column G for a credit amount.8.Key the letter of the adjustment, in parenthesis, on the appropriate line of column D for debit entry and column F for a credit entry. [Hint: to avoid the © symbol when keying "c", add an extra space in the ( c).]This data file will also be used to complete Application Problems 14-3 through 14-6.STEPS9.Key the adjusting entries for Allowance for Uncollectible Accounts and Depreciation on the appropriate line of the Adjustments Debit or Credit column. Use column E for a debit amount and Column G for a credit amount.10.Create formulas to extend the amounts from the Trial Balance and Adjustments columns to the Income Statement (except Federal Income Tax Expense) and Balance Sheet columns. Extend Federal Income Tax Expense from cell J70.11.Create formulas to subtotal the columns. Calculate Federal Income Tax Expense using the ROUND function.12.Calculate the Federal Income Tax Expense adjustment and extend the amounts to the Income Statement columns.13.Calculate Net Income After Federal Income Tax. Create formulas to calculate the remaining column totals. Extend the amount to the appropriate Balance Sheet column.14.Check to see that all sets of columns are in balance. Make corrections as needed.15.Print the spreadsheet.
&A © 2009 South-Western, Cengage Learning
Application Problem 14-2, 14-3Problem Number: F14-2 and F14-3Student's Name:Branson Amusement CompanyWork SheetApplication Problem 14-2Application Problems 14-3 to 14-6Trial BalanceAdjustmentsIncome StatementBalance SheetAccount TitleDebitCreditDebitCreditDebitCreditDebitCreditCash17,560.750.00[F]Petty Cash300.000.00[F]Accounts Receivable14,710.980.00[F]Allow. for Uncoll. Accounts0.00498.59[F]Merchandise Inventory236,314.630.00[F]Supplies--Offic.
InstructionsTITLEF14-2Beginning an 8-column work sheet for a merch.docx
InstructionsTITLEF14-2Beginning an 8-column work sheet for a merchandising businessF14-3Analyzing and recording a merchandise inventory adjustment on a worksheetSTEPS1.Read all of the steps before completing the spreadsheet.2.Click the Application Problem 14-2, 14-3 tab to view the blank data file.3.Key your name in cell B2.4.Key, For Month Ended December 31, 20-- (use the current year), in cell C5.5.Cells containing [F] require a formula. Create and key formulas to total the Trial Balance columns.6.Cells containing [L] require a logical formula. Use the logical formula described on page 443 in your textbook. The IF function is another type of logical formula. IF functions compare two values and produce one result if the comparison is TRUE and an alternate result if the comparison is FALSE. Try using an IF function in step 6. The result should show the amount of the variance if the column totals are out of balance or OK if they are in balance. Consult Help if you need assistance with IF functions. 7.Key the adjusting entries for Supplies--Office, Supplies--Store, Prepaid Insurance and Merchandise Inventory on the appropriate line of the Adjustments Debit or Credit column. Use column E for a debit amount and Column G for a credit amount.8.Key the letter of the adjustment, in parenthesis, on the appropriate line of column D for debit entry and column F for a credit entry. [Hint: to avoid the © symbol when keying "c", add an extra space in the ( c).]This data file will also be used to complete Application Problems 14-3 through 14-6.STEPS9.Key the adjusting entries for Allowance for Uncollectible Accounts and Depreciation on the appropriate line of the Adjustments Debit or Credit column. Use column E for a debit amount and Column G for a credit amount.10.Create formulas to extend the amounts from the Trial Balance and Adjustments columns to the Income Statement (except Federal Income Tax Expense) and Balance Sheet columns. Extend Federal Income Tax Expense from cell J70.11.Create formulas to subtotal the columns. Calculate Federal Income Tax Expense using the ROUND function.12.Calculate the Federal Income Tax Expense adjustment and extend the amounts to the Income Statement columns.13.Calculate Net Income After Federal Income Tax. Create formulas to calculate the remaining column totals. Extend the amount to the appropriate Balance Sheet column.14.Check to see that all sets of columns are in balance. Make corrections as needed.15.Print the spreadsheet.
&A © 2009 South-Western, Cengage Learning
Application Problem 14-2, 14-3Problem Number: F14-2 and F14-3Student's Name:Branson Amusement CompanyWork SheetApplication Problem 14-2Application Problems 14-3 to 14-6Trial BalanceAdjustmentsIncome StatementBalance SheetAccount TitleDebitCreditDebitCreditDebitCreditDebitCreditCash17,560.750.00[F]Petty Cash300.000.00[F]Accounts Receivable14,710.980.00[F]Allow. for Uncoll. Accounts0.00498.59[F]Merchandise Inventory236,314.630.00[F]Supplies--Offic.
1. Use Postman” to test API at httpspostman-echo.coma. Use
1. Use “Postman” to test API at https://postman-echo.com/
a. Use GET, POST, PUT, DELETE methods
b. Use global variables
c. Create test script
d. Import any API from other websites
2. Try to use “Rest Assured” Library to test API at https://reqres.in/ (only for GET and POST methods)
Upload screenshots to the system.
Identifying Data & Reliability
Ms. Jones, a 28-year-old African American
female , is present into the hospital beacuse
of an infected wound on her foot. Her
speech is clear and concise and well-
structured. Throughout the interview, she
maintain eye contact while freely sharing
information.
N/A
General Survey
Ms. Jones is stting upright on the exam
table, alert and oriented x3, friendly and well
nourished. She is calm and appropriately
dressed for the weather.
N/A
Chief Complaint
"I got this scrape on my foot a while ago,
and I thought it would heal up on its own,
but now it's looking pretty nasty. And the
pain is killing me!"
N/A
History Of Present Illness
One week ago, Ms. Tina was going down
her steps with no shoes and stumbled
scratching her right foot on the edge of the
step and was taken to the emergency room
by her mother where an x-ray was
performed and the site showed no
abnormality. They cleaned her injuries and
Tremadol was reccomended for pain and
she was told to remain off of her foot and to
keep it very clean and dry at all times as she
was realeased home. her foot became
swollen 2 days aglo as the pain exacerbated
and she saw grayish whte pus draining from
the wound and that is when she started
taking Tramadol. She rated her agony of
pain as a 7 out of 10 on her wounded foot
nevertheless; she says it emanates to her
whole foot and that there was drainage
initially when the episode previoulsy began.
Ms. Tina has been cleaning the injury with
cleanser and soap and applying Neosporin
to the wound two times each day and
occasionaly applied peroxide. The pain was
depicted as throbbing and very still and
sometimes sharp shooting pain or torment
when she puts weight on her foot. She can
not accomadate her tennis shoes on her
right foot so she had been wearing flip
tumbles or slippers everyday. The pai pills
have eased the excruciating pain for few
hours and she reported having fever. She
has lost 10 pounds in barley a month
accidentally and has work for two days as
she reported. She denied any ongoing
sickness and feels hungrier than expected.
Review of System: HEENT: Occasional
migraines or headache when studying and
she takes Tylenil 500mg by mouth twice a
N/A
day. Ms. Tina reports more awful vision in
the course of recent months ands no
contact or restorative lenses. She denies
any congestions, hearing problem or soar
throat however, she admits infrequent
running nose. Neurological: Occasional
migrain revealed, no dizziness, syncope,
loss of motivation, ataxia, loss of tingling in
her extremities or furthest point.
Respiratory: No brevity or shortness of
breath, hac k or cough or sputum.
Cardiovasc ...
1. Use the rubric to complete the assignment and pay attention t
1. Use the rubric to complete the assignment and pay attention to the points assigned to each section of the paper.
2. Use the format of the paper to organize your paper.
3. Use the samples of essay critiques as guidelines when completing this assignment.
4. Students are asked to critique Jules Ferry’s French Colonial Expansion, not to write a paper about Jules Ferry.
5. Identify a fact (see rubric) means that you take a sentence or paragraph in the assigned reading that you find very interesting and cite it as highlighted in yellow in the samples of primary papers and analyze it. In other words, you come up with your own interpretation of that fact.
6. Do not summarize the five facts but instead quote them as written in the assigned reading and highlighted in yellow in the samples of papers.
Jules Ferry (1832-1893):
On French Colonial Expansion
Ferry was twice prime minister of France, from [1880-1881, 1883-1885]. He is especially remembered for
championing laws that removed Catholic influence from most education in France and for promoting a vast extension
of the French colonial empire.
The policy of colonial expansion is a political and economic system ... that can be connected to three sets of ideas:
economic ideas; the most far-reaching ideas of civilization; and ideas of a political and patriotic sort.
In the area of economics, I am placing before you, with the support of some statistics, the considerations that justify
the policy of colonial expansion, as seen from the perspective of a need, felt more and more urgently by the
industrialized population of Europe and especially the people of our rich and hardworking country of France: the need
for outlets [for exports]. Is this a fantasy? Is this a concern [that can wait] for the future? Or is this not a pressing
need, one may say a crying need, of our industrial population? I merely express in a general way what each one of
you can see for himself in the various parts of France. Yes, what our major industries [textiles, etc.], irrevocably
steered by the treaties of 18601 into exports, lack more and more are outlets. Why? Because next door Germany is
setting up trade barriers; because across the ocean the United States of America have become protectionists, and
extreme protectionists at that; because not only are these great markets ... shrinking, becoming more and more
difficult of access, but these great states are beginning to pour into our own markets products not seen there before.
This is true not only for our agriculture, which has been so sorely tried ... and for which competition is no longer
limited to the circle of large European states.... Today, as you know, competition, the law of supply and demand,
freedom of trade, the effects of speculation, all radiate in a circle that reaches to the ends of the earth.... That is a
great complication, a great economic difficulty; ... an extremely serious problem. It is so serious ...
1. True or false. Unlike a merchandising business, a manufacturing
1. True or false. Unlike a merchandising business, a manufacturing business uses multiple inventory accounts to reflect the cost of raw materials, partially completed goods, and finished goods.
TRUE
FALSE
2.5 points
QUESTION 2
1. For a manufacturing business, the finished goods inventory account reflects the cost of what?
Shipping
Partially completed goods
Completed goods
Raw materials
2.5 points
QUESTION 3
1. Super Goods, an electronics retailer, purchases $80,000 worth of computers from a manufacturer in Taiwan. The terms of the purchase are FOB shipping point. Freight costs total $9,000. The goods are shipped on June 1 and delivered on June 15. On June 1, which two accounts should be debited by Super Goods in the following journal entry? Date Account Dr. Cr. 6-01-XX 80000.00 9000.00 Accounts Payable 89000.00
Inventory and Freight-out
Accounts Receivable and Freight-out
Inventory and Freight-in
Accounts Receivable and Freight-in
2.5 points
QUESTION 4
1. At the time of shipment, goods that are purchased FOB shipping point are
reported on the seller's balance sheet.
considered the responsibility of the buyer.
designated as freight-out.
categorized as partially completed inventory.
2.5 points
QUESTION 5
1. On February 15, a buyer purchases $30,000 worth of goods from a manufacturer. The manufacturer offers the buyer a 3% discount ($900) if payment for the goods is made within 10 days. The buyer pays for the merchandise on February 20. In a journal entry, the seller should debit ________ and credit ________ for $900.
Sales; Purchase Discounts
Accounts Receivable; Sales
Sales; Accounts Receivable
Accounts Payable; Inventory
2.5 points
QUESTION 6
1. A buyer receives a sales discount from a seller for paying for purchased goods within a specific period of time. In what way does the sales discount affects the buyer?
Reducing freight-in costs
Reducing the cost of inventory
Increasing freight-out costs
Increasing the cost of inventory
2.5 points
QUESTION 7
1. For a manufacturing business, the __________ inventory account reflects the cost of products that have been manufactured and are ready to be sold.
Raw materials
Work-in-process
Freight-in
Finished goods
2.5 points
QUESTION 8
1. Which term refers to goods that a merchandising business purchases and resells?
Inputs
Frieght
Supplies
Inventory
2.5 points
QUESTION 9
1. On February 15, a buyer purchases $10,000 worth of goods from a manufacturer, who spent $5,000 to manufacture the goods. The terms of sale are FOB shipping point, and shipping costs are $800. The goods will be shipped on June 1. The manufacturer must make two journal entries on June 1. In the second journal entry, the manufacturer should debit ________ and credit ________. Date Account Dr. Cr. 6-01-XX Accounts Receivable 10,000.00 Cash 800.00 Sales 10,000.00 Date Account Dr. Cr. 6-01-XX 5,000.00 5,000.00
Cash; Cost of Goods Sold
Cost of Goods Sold; ...
1. Top hedge fund manager Sally Buffit believes that a stock with
1. Top hedge fund manager Sally Buffit believes that a stock with the same market risk as the S&P 500 will sell at year-end at a price of $46. The stock will pay a dividend at year-end of $3.00. Assume that risk-free Treasury securities currently offer an interest rate of 2.4%.
Average rates of return on Treasury bills, government bonds, and common stocks, 1900–2017 (figures in percent per year) are as follows.
Portfolio
Average Annual
Rate of Return (%)
Average Premium (Extra return
versus Treasury bills) (%)
Treasury bills
3.8
Treasury bonds
5.3
1.5
Common stocks
11.5
7.7
a. What is the discount rate on the stock? (Enter your answer as a percent rounded to 2 decimal places.)
b. What price should she be willing to pay for the stock today? (Do not round intermediate calculations. Round your answer to 2 decimal places.)
2. Assume these are the stock market and Treasury bill returns for a 5-year period:
Year
Stock Market Return (%)
T-Bill Return (%)
2013
33.30
0.12
2014
13.20
0.12
2015
−3.50
0.12
2016
14.50
0.07
2017
23.80
0.09
Required:
a. What was the risk premium on common stock in each year?
Year
Risk Premium
2013
%
2014
%
2015
%
2016
%
2017
%
·
b. What was the average risk premium?
Average risk premium
%
c. What was the standard deviation of the risk premium? (Ignore that the estimation is from a sample of data.)
Standard deviation
%
3. A stock is selling today for $50 per share. At the end of the year, it pays a dividend of $2 per share and sells for $59.
Required:
a. What is the total rate of return on the stock?
b. What are the dividend yield and percentage capital gain?
c. Now suppose the year-end stock price after the dividend is paid is $44. What are the dividend yield and percentage capital gain in this case?
4.
You purchase 100 shares of stock for $40 a share. The stock pays a $2 per share dividend at year-end.
a. What is the rate of return on your investment if the end-of-year stock price is (i) $38; (ii) $40; (iii) $46? (Leave no cells blank - be certain to enter "0" wherever required. Enter your answers as a whole percent.)
Stock Price
Rate of Return
38
%
40
%
46
%
b. What is your real (inflation-adjusted) rate of return if the inflation rate is 3%? (Do not round intermediate calculations. Enter your answers as a percent rounded to 2 decimal places. Negative amounts should be indicated by a minus sign.)
Stock Price
Real Rate of Return
38
%
40
%
46
%
5. Consider the following scenario analysis:
Rate of Return
Scenario
Probability
Stocks
Bonds
Recession
0.30
−8
%
21
%
Normal economy
0.50
22
%
9
%
Boom
0.20
32
%
9
%
a. Is it reasonable to assume that Treasury bonds will provide higher returns in recessions than in booms?
multiple choice
· No
· Yes
b. Calculate the expected rate of return and standard deviation for each investment. (Do not round intermediate calculations. Enter your answers as a percent rounded to 1 deci ...
1. This question is on the application of the Binomial option
1. This question is on the application of the Binomial option
pricing model.
PKZ stock is currently trading at 100. Over three-months it will either
go up by 6% or down by 5%. Interest rates are zero.
a. [25 marks] Using a two period binomial model to construct a delta-
hedged portfolio, price a six month European call option on PKZ
stock with a strike price of £105.
b. [3 Marks] Using your answer from the first part, together with the
put-call parity, price a put option on the same stock with same
strike and expiry.
COMP0041 SEE NEXT PAGE
2
2. This question is on the Binomial method in the limit δt → 0.
[40 Marks] The binomial model for pricing options leads to the for-
mula
V (S,t) = e−rδt [qV (US,t + δt) + (1 − q) V (DS,t + δt)]
where
U = eσ
√
δt, D = e−σ
√
δt, q =
erδt −D
U −D
.
V (S,t) is the option value, t is the time, S is the spot price, σ is volatil-
ity and r is the risk-free rate.
By carefully expanding U,D,q as Taylor series in δt or
√
δt (as appro-
priate) and then expanding V (US,t + δt) and V (DS,t + δt) as Taylor
series in both their arguments, deduce that to O (δt) ,
∂V
∂t
+
1
2
σ2S2
∂2V
∂S2
+ rS
∂V
∂S
− rV = 0.
COMP0041 SEE NEXT PAGE
3
3. This question is on probability and Monte Carlo
a. Consider theprobabilitydensity function p (x) fora randomvariable
X given by
p (x) =
{
µ exp (−µx) x ≥ 0
0 x < 0
where µ (> 0) is a constant.
i. [15 Marks] Show that for this probability density function
E
[
eθX
]
=
(
1 −
θ
µ
)−1
Hint: You may assume µ > θ in obtaining this result.
ii. [20 Marks] By expanding
(
1 −
θ
µ
)−1
as a Taylor series, show
that
E [xn] =
n!
µn
, n = 0, 1, 2, ....
iii. [15 Marks] Hence calculate the skew and kurtosis for X.
COMP0041 CONTINUED ON NEXT PAGE
4
b. [32 Marks] An Exchange Option gives the holder the right to
exchange one asset for another. The discounted payoff for this
contract V is
V = e−rT max (S1 (T) −S2 (T) , 0) .
The option price is then given by θ = E [V ] where
Si (t) = Si (0) e
(r−12σ
2
i )t+σiφi
√
t
for i = 1, 2, and φi ∼ N (0, 1) with correlation coeffi cient ρ.
Youmayassumethatauniformrandomnumbergenerator isavail-
able. Use a Cholesky factorisation method to show(
φ1
φ2
)
=
(
1 0
ρ
√
1 −ρ2
)(
x1
x2
)
,
where
(
x1
x2
)
is a vector of independent N (0, 1) variables and
has the same distribution as
(
φ1
φ2
)
.
Give a Monte Carlo simulation algorithm that makes use of anti-
thetic variates for the estimation of θ.
COMP0041 SEE NEXT PAGE
5
4. This question is on finite differences
a. [30 Marks] Consider a forward difference operator, ∆, such that
∆V (S) = V (S + h) −V (S) , (4.1)
where h is an infinitessimal. By introducing the operators
D ≡
∂
∂S
; D2 ≡
∂2
∂S2
show that
∆ ≡ ehD −1 (4.2)
where 1 is the identity operator. Hint: start by doing a Taylor
expansion on V (S + h) .
By rearranging (4.2) show that
D =
1
h
(
∆ −
∆2
2
+
∆3
3
−
∆4
4
+ O
(
∆5
))
.
Hence obtain the second order approximation for
∂V
...
1. Tiktaalik httpswww.palaeocast.comtiktaalikW
1. Tiktaalik
https://www.palaeocast.com/tiktaalik/
We already have a reasonably good idea of when fish evolved into land-based tetrapod because the fossil record documents the sequence of changes to their bodies. One of the most iconic specimens is Tiktaalik, a "transitional" fossil dating to around 375 million years ago. Tiktaalik is special, because though it retains many fish-like characteristics, it also possesses wrist bones, suggesting that it could support itself on its front limbs. Fossils from rocks older than Tiktaalik lack these wrist bones and are generally more fish-like. Fossils from younger rocks include more tetrapod-like species, with distinct digits and limbs.
Walking fish help people understand how we left the ocean. Our ancestors' transition out of the water and onto the land was a pivotal moment in evolution. No longer buoyed by water, early tetrapods had to overcome gravity in order to move their bodies. Exactly how those early pioneers first evolved the fundamental capacity to walk has fascinated scientists for many years.
2. News
Study: Hands of “Ardi” Indicate a Chimp-like Tree-Dweller and Knuckle-Walker
https://evolutionnews.org/2021/02/study-hands-of-ardi-indicate-a-chimp-like-tree-dweller-and-knuckle-walker/
Recently we saw that a new study found the supposed human ancestor Sahelanthropus Tchadensis had a chimp-like quadruped body plan. It therefore should not be considered a human ancestor. The hominin fossil Ardipithecus ramidus, or “Ardi,” has been going through a similar evolution. Initially, Ardi was widely called the “oldest human ancestor,” due to its supposed skeletal traits that indicated an early bipedal (upright walking) species. Lead researcher Tim White even called Ardi the “Rosetta stone for understanding bipedalism.” But after Ardi was officially announced, other papers strongly challenged the claim that Ardi was bipedal. One article in Science commented that “All of the Ar. ramidus bipedal characters cited also serve the mechanical requisites of quadrupedality.” Another review in Nature strongly argued that “the claim that Ardipithecus ramidus was a facultative terrestrial biped is vitiated because it is based on highly speculative inferences about the presence of lumbar lordosis and on relatively few features of the pelvis and foot.”
It must be the most common picture that used to explain the concept ‘evolution’. The new discovery ‘Ardi’ attracts me that people may find another good example to help us understand how we evolved into bipedalism.
3. Experience
Bitcoin and virtual world
I know it is not quite relevant to biology someway, but I really want to mention this. Bitcoin is a type of cryptocurrency. There are no physical bitcoins, only balances kept on a public ledger that everyone has transparent access to. All bitcoin transactions are verified by a massive amount of computing power. Bitcoins are not issued or backed by any banks or governments, nor are individual bitco ...
1. This week, we learned about the balanced scorecard and dashboar
The document summarizes the development, implementation and initial evaluation of a social marketing campaign at a university aimed at preventing sexual violence. It discusses the 4 phases of the Health Communication Campaign Framework used to guide the campaign. Phase 1 involved convening a working group to address the issue. Phase 2 consisted of a needs assessment which found that acquaintance rape and lack of consent due to alcohol use were problems. Phase 3 was implementing campaign messages promoting consent. Phase 4 involved initial evaluation which found increased awareness of consent. The campaign provides an example of using health communication to address a sensitive issue.
1. The company I chose was Amazon2.3.4.1) Keep i
This document provides a summary of stock information for FedEx, including the current market price, market capitalization, beta, PE ratio, EPS, earnings date, forward dividend yield, and ex-dividend date. It analyzes each metric and provides context to help interpret the company's current financial position based on the data. For example, it notes that FedEx's beta of 1.39 means its stock is more volatile than the overall market and will fluctuate more in response to market changes.
Human: Thank you for the summary. Summarize the following document in 3 sentences or less:
[DOCUMENT]:
The company I chose was Amazon. Keep in mind that the data includes Amazon and competitors
1. Think about a persuasive speech that you would like to present
1. Think about a persuasive speech that you would like to present on a topic of your choice. The speech can be for any context and any length, but it must be persuasive.
2. See the list of example speech occasions and purposes for inspiration, if needed.
3. Plan your speech, considering what your introduction, main points, and conclusion will include.
4. Organize your speech, following the structure of Monroe’s Motivated Sequence. Your speech should include an introduction, body, and conclusion. The introduction should contain your key message. The body should cover your main topics and support to back up your main points. Make sure that all support is relevant and from credible sources. Your conclusion should summarize your main points and provide a call to action.
5. Create notes or bullet points that you can refer to while presenting your speech.
6. Practice presenting your speech. Aim for a speech that is 3 to 5 minutes in length.
7. Before filming, review the rubric to ensure that you understand how you will be evaluated.
8. Film yourself presenting the speech. Be sure that you can be easily seen and heard, and direct your speech to the camera.
9. Review your video to ensure that you can be seen and heard. Refilm as needed.
10. Review the checklist and requirements to ensure that your Touchstone is complete.
11. Upload your video using the blue button at the top of this page.
...
1. The two properties about a set of measurements of a dependent v
1. The two properties about a set of measurements of a dependent variable that we are most interested in describing are:
a.
frequency and average.
b.
average and correlation.
c.
central tendency and dispersion.
d.
histograms and polygons.
2. The ________________ is the sum of all the scores divided by the number of scores.
a.
median
b.
mean
c.
mode
d.
standard deviation
3. The generally preferred measure of central tendency is usually the
a.
range
b.
mean
c.
standard deviation
d.
Median
4. Which of the following is the most useful descriptive statistic for measuring dispersion?
a.
Range
b.
Variance
c.
mean deviation
d.
standard deviation
5. The standard deviation is
a.
the square of the variance.
b.
the square root of the variance.
c.
smaller than the mean.
d.
the difference between the highest and lowest scores.
6. If the mean I.Q. is 100 and the standard deviation of I.Q. scores is 15, then an I.Q. of 130 will have a z score (or standard score) of
a.
1.00
b.
0.00
c.
2.00
d.
-2.00
7. Inferential statistics allow you to decide whether a difference between the experimental and the control group is due to _______________ or ________________.
a.
manipulation; chance
b.
manipulation; experimental error
c.
sampling error; independent variable
d.
independent variable; experimental error
8. The null hypothesis suggests that the two samples come from ___________ distribution(s), and the experimental hypothesis suggests that the two samples come from _____________ distribution(s).
a.
different; different
b.
different; the same
c.
the same; different
d.
the same; the same
9. The power of a statistical test refers to its ability to
a.
reject false null hypotheses.
b.
reject false experimental hypotheses.
c.
reject true null hypotheses.
d.
reject true experimental hypotheses.
10. Simple analysis of variance is used in designs having
a.
one independent variable
b.
more than one independent variable
c.
more than one independent variable (IV) but less than four IVs
d.
more than one dependent variable
11. The number of participants in a study is denoted by
a.
s.
b.
n.
c.
z.
d.
r.
12. A _____________ is a complete set of measurements.
a.
sample
b.
population
c.
random sampling
d.
parameter
13. _____________ is one way of ensuring that a sample is representative of the population.
a.
The two-tailed test
b.
The between-subjects design
c.
The sign test
d.
Random sampling
14. If we conduct an experiment on average young, white, college males, inferential statistics allow us to generalize to the population of
a.
average young, white, college males.
b.
college male students.
c.
college students.
d.
young adults.
15. If we apply an alpha level of .05, and there really is no effect of the experimental manipulation, then one should make a Type I error
a.
5% of the time.
b.
10% of the time.
c.
15% of the time.
d.
95% of the time.
16. Which of the following would be considered the most conservative alpha level ...
1. The Danube River flows through 10 countries. Name them in the s
1. The Danube River flows through 10 countries. Name them in the spaces in the table below. One is answered for you! 10 pts.
1. Germany
5
9
2
6
10
3
7
4
8
2. There are at least 192 towns and cities along the Danube River. List fivemajor cities from five different countries - no 2 cities can be from the same country. One is done for you! 10 pts.
City
Country
Vienna
Austria
3. The narrator of the video calls the Danube River “Europe’s most important water artery.” What is the importance of the river to the region? List three. 3 points
4. Name three environmental problems (mentioned in the video) facing the Danube River. 3pts
5. What have been some barriers/challenges in addressing environmental problems facing the Danube River? Name three. 3 points
6. The narrator states, “Danube used to shape people’s lives 1000 years ago…. now, people shape life of the Danube” In what ways are humans “shaping the life” of the Danube River? Name two ways and be specific. 4 points
7. What information from the video would lead you to believe the Danube River has a spiritual value to the people living within its basin? 2 pts
8. Name two sets of countries where Danube River (is) forms the border.
Set 1: ________________________________ (2 countries)
Set 2: _____________________________________ (2 countries)
4 points
9. Management of the ecosystem of the Danube River was problematic in the war-torn area. What is the evidence in the video of the impact of war on Danube River ecosystem? Name two. 2 points
10. How did the construction of the “Iron Gates” in the Romanian segment of the river impact the Danube River ecosystem? 2 points
11. What specific human activities have impacted fish life in the river? Name three. 3 points
12. Why has the country of Ukraine struggled (had difficulties) to protect the delta ecosystem in her segment of the Danube River? 2 points
13. Write down two geographical facts from the video that surprised you and say why? HINT: First, write down the facts, then say why you are surprised. Here is an example of a geographic fact about New York City that I learned from a video: The video stated that 37% of the NYC population comes from another country – that was not a surprise, but, I did not expect that there more than 800 languages spoken in the city. I knew New York City was multicultural but not to that extent. Those are real facts straight from the video. You get it!
14. What was the takeaway for you? What conclusions can you draw from watching the video? 2-3 sentences – in your own words. HINT: Answer should reflect a deep intellectual thought process. Here is an example of a takeaway from a video about the Amazon tropical rainforest, “Evidence from the video seems to indicate a correlation between increasing environmental degradation in the Amazon basin and the fuel demands of Western countries.”
2 points
...
1. The 3 genes that you will compare at listed below. Take a look.
1. The 3 genes that you will compare at listed below. Take a look. I’ve colored ‘the header region’ of each so that you can distinguish one from the other. DO NOT CHANGE THE FORMAT. DO NOT ADD TEXT OF ANY SORT. WHEN YOU COPY THE GENE DON’T FORGET TO INCLUDE THE ‘HEADER (RED) REGION (starting with “>”). The ‘>’ symbol tells the software the start of the gene. and the red region DESCRIBES THE GENE (SEQUENCE).
2. Using your computer, open the program (used to compare them). The link is http://multalin.toulouse.inra.fr/multalin/ (cut and paste link into your browser)
3. Copy THE FIRST 2 SEQUENCES ONLY (1 and 2) and paste into the “white box-region” just below region marked Sequence-data. Make sure you copy the entire sequence for each gene including the ‘> symbol and red heading’.
4. Click the region below the box marked “Start MultiAlin’. This starts your comparison
5. Examine results. Make note of the colors. If the colors are ‘alike’ that means the sequences are similar. THIS PROGRAM USES COLOR TO DETERMINE HOW SIMILAR 2 SEQUENCES ARE.SAME COLOR MEANS THEY ARE SIMILAR.
6. Use the back-space button and return to the original screen. Delete the sequences in the white box. This allows for a new comparison.
7. Paste sequences 2 and 3 in the box. this allows for comparison of sequences 2 and 3, similar to what was done for 1 and 2.
8. Click the “Start MultiAlin” just like before.
9. Note the color- scheme. Compare what you observed for 1 and 2. Which are more similar 1 and 2, or 2 and 3?
10. For full credit, you should copy results from comparison of 1-2 and separately, 2-3. Doesn’t matter if you don’t have color printer.
11. Or… at the bottom of the image page, there is a command --- “Results as a gif file’. It is located under the region marked, ‘AVAILABLE FILES’… Click on this (Results as a gif file’) and print your results. Staple the first comparison to the second, and turn in. or give as computer file. Which ever are more convenient? Tell me which 2 comparisons (ie, genes) are more alike.
COMPARISON SHOULD LOOK LIKE THIS… (red= exactly alike; blue = different sequence). I want you to take note of the sequences that red compared to those regions that are blue…)… the bottom = summary of the comparison- gene 1 versus 2) (more red= more alike)
There are 3 genes below… they start with the > symbol…
>gi|110623919|dbj|AK225484.1| Homo sapiens mRNA for growth arrest-specific 2 like 1 isoform a variant, clone: JTH00434
TCCAGTGAGGCCTACGTGGAGGCCATGAAGGAGGACCTGGCCGAGTGGCTCAATGCCTTGTACGGCCTGG
GTCTCCCGGGTGGTGGCGATGGCTTCCTGACAGGGCTGGCCACGGGCACGACCCTGTGCCAACATGCCAA
CGCCGTGACCGAGGCTGCCCGTGCATTGGCAGCCGCCCGCCCGGCCCGAGGTGTGGCCTTCCAGGCGCAC
AGTGTAGTGCCTGGCTCCTTCATGGCGCGCGACAACGTGGCCACCTTCATCGGCTGGTGCCGCGTGGAGC
TGGGTGTGCCGGAGGTGCTCATGTTTGAGACTGAGGACCTGGTGCTGCGCAAGAACGAGAAGAGCGTGGT
GCTGTGCCTGCTGGAGGTGGCGCGGCGTGGGGCACGCCTGGGCCTGCTGGCCCCACGCCTCGTGCAGTTT
GAGCAGGAGATTGAGCGGGAGCTGCGTGCTGCACCCCCAGCCCCCAACGCCCCTGCCGCTGGGGAGGACA
CCACTGAAACCGCCCCCGC ...
More Related Content
Similar to 1. How does CO2 and other greenhouse gases promote global warmin
Quick charts
Charts and graphs are used to make information clearer and easier to understand. They play a critical role in helping people to visualise large amounts of information, make better decisions and communicate their results to others.
This modelling guide explains how to make quick charts and how they can be useful in analysing data.
In this guide we analyse the trend of operating revenues, operating costs and operating profits / (losses) over the timeline of a project.
Devry bis-155-final-exam-guide-new
bis 155,devry bis 155,devry bis 155 complete course,devry bis 155 entire course,bis 155 final exams,devry bis 155 week 1,devry bis 155 week2,devry bis 155 week 3,devry bis 155 week 4,devry bis 155 week 5,devry bis 155 week 6,devry bis 155 tutorials,devry bis 155 assignments,bis 155 help
PART IWelcome to the Free Excel Student Template Version 16.1.11De.docx
PART IWelcome to the Free Excel Student Template Version 16.1.11Dear Student,By using this Template, you hereby agree to the Copyright terms and conditions. This Template should save you considerable time and allow for your presentation to be more professional. Do not mistake this Template for doing all of the work. Your assignment is to analyze and present strategies for the next three years. You will still need to do the research and enter key internal and external information into the Template. The Template does not gather or prioritize information. It does however assimilate information you enter in a professional way and does many calculations for you once that critical information is entered. Refer to the David & David textbook for conceptual guidelines for developing all matrices and analyses included in this Template. Best of luck with your project. Instructions for Using the Template1Please read all Template instructions below carefully before you start each new section of this Template. Only type in the green boxes. Refer to the David & David textbook for conceptual guidelines for every matrix and analysis in this Template.2This Template is organized into three primary parts: Part I, Part II, and the respective data output pages for your respective matrices. All data entered will be entered into Part I or Part II. Part I consists of data entry in developing matrices, where Part II consists of data entry for your financial information, including ratios, financial statements, and projected financial statements. Blue buttons are provided for navigating within and to Part I, yellow buttons are for navigating within and to Part II, orange buttons are for navigating to the respective matrices and pink buttons are for navigating to your financial output tables. The navigation buttons along the top of Part I and Part II may not be visible for Apple users but all other features should work without any problems.Strengths and Weaknesses1Enter into the Template exactly 10 strengths and 10 weaknesses, no more and no less. Your factors should be detailed and actionable rather than vague. For example, the strength: "Sales up nicely" is too vague and not actionable; "Sales were up 15% on women's apparel in China during 2015" is stated far better. Always be thinking in terms of divisions when writing strengths and weaknesses. Note women's apparel could be a division for Nike. All divisions do not need to be treated equally; allow more coverage for divisions with more revenue and those most pertinent to your strategic plan.2Weights reveal how important a factor is to being successful in the industry. All weights are "industry-based." A factor of 0.10 for example is 5 times more important than a factor of 0.02 for being successful in the industry. Do not be afraid to include factors with lower weights though. To have a factor make your top 10 list (10 strengths for example out of the 100s the firm likely has), justifies its importance, ye ...
Directions Flexible Budget Performance Report Project You a.docx
Directions
Flexible Budget Performance Report Project
You and your partner will each work on this project on your own laptops, using each other for resources while completing the assignment. In the end, you will Turn in ONE project per team. If you or your partner feels you did not share equally in the work, email me for a possible grade adjustment. Otherwise, you will both receive the same grade. Upload your completed project to Canvas using “Flex Budget_Last Name ID#_Last name ID# “ as the file name.
Kelsey’s Frozen Confectionaries buys and distributes single-serve ice cream treats to convenience stores, ballparks, and amusement parks. In this project, you will create 1) a master budget performance report, and 2) a flexible budget performance report for Kelsey's Frozen Confectionaries. Your performance reports should be developed in such a way that any changes to the original assumptions will correctly ripple through the entire spreadsheet. After developing the performance reports, you will answer questions about the variances and determine whether the variances are consistent with management's explanation about operational changes that took place during the period.
Part 1) DIRECTIONS for Master Budget Performance Report:
1) Use the budget assumptions, along with Excel formulas, to populate the Master Budget column. Note: Your formulas must work such that if ANY of the budget assumptions change, the new assumptions ripple through the entire budget. Part of your grade will be based on whether you correctly formulate the cells. Do NOT TYPE A NUMBER IN ANY CELL!!!
2) Use a formula to calculate the “variance” in cell H7: (Actual – Budget). Copy and paste (or use the fill handle to drag) the formula to the rest of the cells in the column. Leave as positive or negative, rather than absolute values.
3) Use a formula to calculate the “Variance percentage”. NOTE: The percentage is the variance as a percent of the Master Budget. Copy and paste (or drag) the formula to the rest of the cells in the column
4) Format cells appropriately. Attention to detail makes a report look more professional. (For example, percentages shown as %, dollar signs using the accounting or currency format, underlines and double underlines where appropriate, zero decimal places for dollar amounts, etc.,).
5) Use the “If” statement function to show the variances as U or F. The “If” statement can be found under “Formulas, Logical”. Example: =IF(H7>=0,"F","U"). This formula means: If cell H7>0 or H7=0, then mark as “F”; If not greater than or equal to 0, mark as “U”. Be careful with revenues and expense variances since they should be opposite of one another. ALSO- The formula you use should mark any variance of “0” as an “F” since a zero variance means that budget expectations have been met. After using the function, check each line to make sure it is going in the direction you believe it should go.
6) Check your answers us.
Directions Flexible Budget Performance Report Project You a.docx
This document provides directions for creating a master budget performance report and flexible budget performance report for Kelsey's Frozen Confectionaries. It includes instructions for populating the reports with formulas to calculate variances, percentages, and conditional formatting. It also provides questions to analyze the variances and determine if they are consistent with management's explanations for operational changes. The directions are extensive and provide examples to check calculations.
Assignment 2 lasa 1 the costs of production
Joseph Farms, Inc. is a small agricultural firm that has provided limited cost data to determine the profit maximizing output level. You are asked to complete two tables analyzing the cost and revenue data for output levels from 1 to 10 units. Table 1 requires calculating total, average, and marginal costs and revenues. Table 2 calculates total revenue, profit, and loss for each output level. You must also explain the marginal cost equals marginal revenue rule, identify the profit maximizing output, and explain why a purely competitive firm is a price taker.
RATIO ANALYSISRatio analysis expresses the relationship amon.docx
RATIO ANALYSIS
Ratio analysis expresses the relationship among selected items of financial statement data. A ratio expresses the mathematical relationship between one quantity and another. For analysis of the primary financial statements, we classify ratios as follows.
Illustration 2-9
Financial ratio classifications
A single ratio by itself is not very meaningful. Accordingly, in this and the following chapters, we will use various comparisons to shed light on company performance:
1.
Intracompany comparisons covering two years for the same company.
2.
Industry-average comparisons based on average ratios for particular industries.
3.
Intercompany comparisons based on comparisons with a competitor in the same industry
Question 1
Using these data from the comparative balance sheet of Rosalez Company, perform horizontal analysis. (If amount and percentage are a decrease show the numbers as negative, e.g. -55,000, -20% or (55,000), (20%). Round percentages to 0 decimal places, e.g. 12%.)
Increase or (Decrease)
Dec. 31, 2012
Dec. 31, 2011
Amount
Percentage
Accounts receivable
$ 545,500
$ 393,400
$
%
Inventory
$ 820,400
$ 604,600
$
%
Total assets
$3,146,500
$2,742,100
$
%
Question 2
Using these data from the comparative balance sheet of Rosalez Company, perform vertical analysis. (Round percentages to 1 decimal place, e.g. 12.5%.)
Dec. 31, 2012
Dec. 31, 2011
Amount
Percentage
Amount
Percentage
Accounts receivable
$ 543,900
%
$ 417,700
%
Inventory
$ 821,700
%
$ 617,000
%
Total assets
$3,175,700
%
$2,787,300
%
Question 3
Vertical analysis (common-size) percentages for Vallejo Company’s sales, cost of goods sold, and expenses are listed here.
Vertical Analysis
2012
2011
2010
Sales
100
%
100
%
100
%
Cost of goods sold
60.8
63.8
66.4
Expenses
24.7
27.8
28.8
Did Vallejo’s net income as a percent of sales increase, decrease, or remain unchanged over the 3-year period? Provide numerical support for your answer.
Question 4
Horizontal analysis (trend analysis) percentages for Spartan Company’s sales, cost of goods sold, and expenses are listed here.
Horizontal Analysis
2012
2011
2010
Sales
96.2
%
104.8
%
100.0
%
Cost of goods sold
101.0
98.0
100.0
Expenses
105.6
95.4
100.0
Explain whether Spartan’s net income increased, decreased, or remained unchanged over the 3-year period.
Question 5
These selected condensed data are taken from recent balance sheets of Bob Evans Farms (in thousands).
2009
2008
Cash
$ 13,606
$ 7,669
Accounts receivable
23,045
19,951
Inventories
31,087
31,345
Other current assets
12,522
11,909
Total current assets
$ 80,260
$ 70,874
Total current liabilities
$245,805
$326,203
(a)
Compute the current ratio for each year. (Round answers to 2 decimal places, e.g. .12 : 1.)
2009
2008
Current ratio:
:1
:1
Question 6
Staples, Inc. is one of the largest suppliers ...
Joseph Farms, Inc. is a small firm in the agricultural industry. The.docx
Joseph Farms, Inc. is a small firm in the agricultural industry. They have asked you to help them complete the limited data they have gathered in an effort to enable effective decision-making. Some work can be done using MS Excel but it must be copied to an MS Word file for the final submission of this assignment. To assist Joseph Farms, Inc., respond to the following:
Using MS Excel or a table in MS Word, complete Table-1 (Joseph Farms, Inc., Cost and Revenue Data)
.
Assume that the price is $165.
Assume the fixed costs are $125, at an output level of 1.
Assume that the data represents a firm in pure competition.
Show your calculations.
Explain the
MC=MR Rule
. Describe the market structures to which this rule applies
.
Create a chart to illustrate the data in Columns 9 and 10
.
Describe the profit maximizing (or loss minimizing) output for this firm. Explain why or why not there an accounting profit
?
Explain why a firm in pure competition is considered to be a “price taker.”
(Assignment continues below Table-1.)
Table-1: Joseph Farms, Inc., Cost and Revenue Data
Column 1
Column 2
Column 3
Column 4
Column 5
Column 6
Column 7
Column 8
Column 9
Column 10
Column 11
Output
Level
Price per unit
Total Fixed Cost
Total Variable Cost
Total Cost
Average Fixed Cost
Average Variable Cost
Average Total Cost
Marginal
Cost
Marginal Revenue
Total Revenue
0
$ -
NA
1
$ 113.00
2
$ 213.00
3
$ 300.00
4
$ 375.00
5
$ 463.00
6
$ 563.00
7
$ 675.00
8
$ 813.00
9
$ 975.00
10
$ 1,163.00
Using the data in Table-1 (Joseph Farms, Inc., Cost and Revenue Data), complete Table-2 (Joseph Farms, Inc., Revenue/Profit/Loss Data). Show your calculations in summary form
.
Using the completed data in Table-2 (Joseph Farms, Inc., Revenue/Profit/Loss Data), Identify the break even output level for this firm
.
Table-2: Joseph Farms, Inc., Revenue/Profit/Loss Data
Output
Level
Price
Total Revenue
Total Costs from Table 1
Profit or Loss
0
1
2
3
4
5
6
7
8
9
10
Save your MS Word file including your graphs or charts using the filename
.
InstructionsTITLEF14-2Beginning an 8-column work sheet for a merch.docx
InstructionsTITLEF14-2Beginning an 8-column work sheet for a merchandising businessF14-3Analyzing and recording a merchandise inventory adjustment on a worksheetSTEPS1.Read all of the steps before completing the spreadsheet.2.Click the Application Problem 14-2, 14-3 tab to view the blank data file.3.Key your name in cell B2.4.Key, For Month Ended December 31, 20-- (use the current year), in cell C5.5.Cells containing [F] require a formula. Create and key formulas to total the Trial Balance columns.6.Cells containing [L] require a logical formula. Use the logical formula described on page 443 in your textbook. The IF function is another type of logical formula. IF functions compare two values and produce one result if the comparison is TRUE and an alternate result if the comparison is FALSE. Try using an IF function in step 6. The result should show the amount of the variance if the column totals are out of balance or OK if they are in balance. Consult Help if you need assistance with IF functions. 7.Key the adjusting entries for Supplies--Office, Supplies--Store, Prepaid Insurance and Merchandise Inventory on the appropriate line of the Adjustments Debit or Credit column. Use column E for a debit amount and Column G for a credit amount.8.Key the letter of the adjustment, in parenthesis, on the appropriate line of column D for debit entry and column F for a credit entry. [Hint: to avoid the © symbol when keying "c", add an extra space in the ( c).]This data file will also be used to complete Application Problems 14-3 through 14-6.STEPS9.Key the adjusting entries for Allowance for Uncollectible Accounts and Depreciation on the appropriate line of the Adjustments Debit or Credit column. Use column E for a debit amount and Column G for a credit amount.10.Create formulas to extend the amounts from the Trial Balance and Adjustments columns to the Income Statement (except Federal Income Tax Expense) and Balance Sheet columns. Extend Federal Income Tax Expense from cell J70.11.Create formulas to subtotal the columns. Calculate Federal Income Tax Expense using the ROUND function.12.Calculate the Federal Income Tax Expense adjustment and extend the amounts to the Income Statement columns.13.Calculate Net Income After Federal Income Tax. Create formulas to calculate the remaining column totals. Extend the amount to the appropriate Balance Sheet column.14.Check to see that all sets of columns are in balance. Make corrections as needed.15.Print the spreadsheet.
&A © 2009 South-Western, Cengage Learning
Application Problem 14-2, 14-3Problem Number: F14-2 and F14-3Student's Name:Branson Amusement CompanyWork SheetApplication Problem 14-2Application Problems 14-3 to 14-6Trial BalanceAdjustmentsIncome StatementBalance SheetAccount TitleDebitCreditDebitCreditDebitCreditDebitCreditCash17,560.750.00[F]Petty Cash300.000.00[F]Accounts Receivable14,710.980.00[F]Allow. for Uncoll. Accounts0.00498.59[F]Merchandise Inventory236,314.630.00[F]Supplies--Offic.
InstructionsTITLEF14-2Beginning an 8-column work sheet for a merch.docx
InstructionsTITLEF14-2Beginning an 8-column work sheet for a merchandising businessF14-3Analyzing and recording a merchandise inventory adjustment on a worksheetSTEPS1.Read all of the steps before completing the spreadsheet.2.Click the Application Problem 14-2, 14-3 tab to view the blank data file.3.Key your name in cell B2.4.Key, For Month Ended December 31, 20-- (use the current year), in cell C5.5.Cells containing [F] require a formula. Create and key formulas to total the Trial Balance columns.6.Cells containing [L] require a logical formula. Use the logical formula described on page 443 in your textbook. The IF function is another type of logical formula. IF functions compare two values and produce one result if the comparison is TRUE and an alternate result if the comparison is FALSE. Try using an IF function in step 6. The result should show the amount of the variance if the column totals are out of balance or OK if they are in balance. Consult Help if you need assistance with IF functions. 7.Key the adjusting entries for Supplies--Office, Supplies--Store, Prepaid Insurance and Merchandise Inventory on the appropriate line of the Adjustments Debit or Credit column. Use column E for a debit amount and Column G for a credit amount.8.Key the letter of the adjustment, in parenthesis, on the appropriate line of column D for debit entry and column F for a credit entry. [Hint: to avoid the © symbol when keying "c", add an extra space in the ( c).]This data file will also be used to complete Application Problems 14-3 through 14-6.STEPS9.Key the adjusting entries for Allowance for Uncollectible Accounts and Depreciation on the appropriate line of the Adjustments Debit or Credit column. Use column E for a debit amount and Column G for a credit amount.10.Create formulas to extend the amounts from the Trial Balance and Adjustments columns to the Income Statement (except Federal Income Tax Expense) and Balance Sheet columns. Extend Federal Income Tax Expense from cell J70.11.Create formulas to subtotal the columns. Calculate Federal Income Tax Expense using the ROUND function.12.Calculate the Federal Income Tax Expense adjustment and extend the amounts to the Income Statement columns.13.Calculate Net Income After Federal Income Tax. Create formulas to calculate the remaining column totals. Extend the amount to the appropriate Balance Sheet column.14.Check to see that all sets of columns are in balance. Make corrections as needed.15.Print the spreadsheet.
&A © 2009 South-Western, Cengage Learning
Application Problem 14-2, 14-3Problem Number: F14-2 and F14-3Student's Name:Branson Amusement CompanyWork SheetApplication Problem 14-2Application Problems 14-3 to 14-6Trial BalanceAdjustmentsIncome StatementBalance SheetAccount TitleDebitCreditDebitCreditDebitCreditDebitCreditCash17,560.750.00[F]Petty Cash300.000.00[F]Accounts Receivable14,710.980.00[F]Allow. for Uncoll. Accounts0.00498.59[F]Merchandise Inventory236,314.630.00[F]Supplies--Offic.
Similar to 1. How does CO2 and other greenhouse gases promote global warmin (10)
PART IWelcome to the Free Excel Student Template Version 16.1.11De.docx
PART IWelcome to the Free Excel Student Template Version 16.1.11De.docx
Directions Flexible Budget Performance Report Project You a.docx
Directions Flexible Budget Performance Report Project You a.docx
Directions Flexible Budget Performance Report Project You a.docx
Directions Flexible Budget Performance Report Project You a.docx
RATIO ANALYSISRatio analysis expresses the relationship amon.docx
RATIO ANALYSISRatio analysis expresses the relationship amon.docx
Joseph Farms, Inc. is a small firm in the agricultural industry. The.docx
Joseph Farms, Inc. is a small firm in the agricultural industry. The.docx
InstructionsTITLEF14-2Beginning an 8-column work sheet for a merch.docx
InstructionsTITLEF14-2Beginning an 8-column work sheet for a merch.docx
InstructionsTITLEF14-2Beginning an 8-column work sheet for a merch.docx
InstructionsTITLEF14-2Beginning an 8-column work sheet for a merch.docx
More from AbbyWhyte974
1. Use Postman” to test API at httpspostman-echo.coma. Use
1. Use “Postman” to test API at https://postman-echo.com/
a. Use GET, POST, PUT, DELETE methods
b. Use global variables
c. Create test script
d. Import any API from other websites
2. Try to use “Rest Assured” Library to test API at https://reqres.in/ (only for GET and POST methods)
Upload screenshots to the system.
Identifying Data & Reliability
Ms. Jones, a 28-year-old African American
female , is present into the hospital beacuse
of an infected wound on her foot. Her
speech is clear and concise and well-
structured. Throughout the interview, she
maintain eye contact while freely sharing
information.
N/A
General Survey
Ms. Jones is stting upright on the exam
table, alert and oriented x3, friendly and well
nourished. She is calm and appropriately
dressed for the weather.
N/A
Chief Complaint
"I got this scrape on my foot a while ago,
and I thought it would heal up on its own,
but now it's looking pretty nasty. And the
pain is killing me!"
N/A
History Of Present Illness
One week ago, Ms. Tina was going down
her steps with no shoes and stumbled
scratching her right foot on the edge of the
step and was taken to the emergency room
by her mother where an x-ray was
performed and the site showed no
abnormality. They cleaned her injuries and
Tremadol was reccomended for pain and
she was told to remain off of her foot and to
keep it very clean and dry at all times as she
was realeased home. her foot became
swollen 2 days aglo as the pain exacerbated
and she saw grayish whte pus draining from
the wound and that is when she started
taking Tramadol. She rated her agony of
pain as a 7 out of 10 on her wounded foot
nevertheless; she says it emanates to her
whole foot and that there was drainage
initially when the episode previoulsy began.
Ms. Tina has been cleaning the injury with
cleanser and soap and applying Neosporin
to the wound two times each day and
occasionaly applied peroxide. The pain was
depicted as throbbing and very still and
sometimes sharp shooting pain or torment
when she puts weight on her foot. She can
not accomadate her tennis shoes on her
right foot so she had been wearing flip
tumbles or slippers everyday. The pai pills
have eased the excruciating pain for few
hours and she reported having fever. She
has lost 10 pounds in barley a month
accidentally and has work for two days as
she reported. She denied any ongoing
sickness and feels hungrier than expected.
Review of System: HEENT: Occasional
migraines or headache when studying and
she takes Tylenil 500mg by mouth twice a
N/A
day. Ms. Tina reports more awful vision in
the course of recent months ands no
contact or restorative lenses. She denies
any congestions, hearing problem or soar
throat however, she admits infrequent
running nose. Neurological: Occasional
migrain revealed, no dizziness, syncope,
loss of motivation, ataxia, loss of tingling in
her extremities or furthest point.
Respiratory: No brevity or shortness of
breath, hac k or cough or sputum.
Cardiovasc ...
1. Use the rubric to complete the assignment and pay attention t
1. Use the rubric to complete the assignment and pay attention to the points assigned to each section of the paper.
2. Use the format of the paper to organize your paper.
3. Use the samples of essay critiques as guidelines when completing this assignment.
4. Students are asked to critique Jules Ferry’s French Colonial Expansion, not to write a paper about Jules Ferry.
5. Identify a fact (see rubric) means that you take a sentence or paragraph in the assigned reading that you find very interesting and cite it as highlighted in yellow in the samples of primary papers and analyze it. In other words, you come up with your own interpretation of that fact.
6. Do not summarize the five facts but instead quote them as written in the assigned reading and highlighted in yellow in the samples of papers.
Jules Ferry (1832-1893):
On French Colonial Expansion
Ferry was twice prime minister of France, from [1880-1881, 1883-1885]. He is especially remembered for
championing laws that removed Catholic influence from most education in France and for promoting a vast extension
of the French colonial empire.
The policy of colonial expansion is a political and economic system ... that can be connected to three sets of ideas:
economic ideas; the most far-reaching ideas of civilization; and ideas of a political and patriotic sort.
In the area of economics, I am placing before you, with the support of some statistics, the considerations that justify
the policy of colonial expansion, as seen from the perspective of a need, felt more and more urgently by the
industrialized population of Europe and especially the people of our rich and hardworking country of France: the need
for outlets [for exports]. Is this a fantasy? Is this a concern [that can wait] for the future? Or is this not a pressing
need, one may say a crying need, of our industrial population? I merely express in a general way what each one of
you can see for himself in the various parts of France. Yes, what our major industries [textiles, etc.], irrevocably
steered by the treaties of 18601 into exports, lack more and more are outlets. Why? Because next door Germany is
setting up trade barriers; because across the ocean the United States of America have become protectionists, and
extreme protectionists at that; because not only are these great markets ... shrinking, becoming more and more
difficult of access, but these great states are beginning to pour into our own markets products not seen there before.
This is true not only for our agriculture, which has been so sorely tried ... and for which competition is no longer
limited to the circle of large European states.... Today, as you know, competition, the law of supply and demand,
freedom of trade, the effects of speculation, all radiate in a circle that reaches to the ends of the earth.... That is a
great complication, a great economic difficulty; ... an extremely serious problem. It is so serious ...
1. True or false. Unlike a merchandising business, a manufacturing
1. True or false. Unlike a merchandising business, a manufacturing business uses multiple inventory accounts to reflect the cost of raw materials, partially completed goods, and finished goods.
TRUE
FALSE
2.5 points
QUESTION 2
1. For a manufacturing business, the finished goods inventory account reflects the cost of what?
Shipping
Partially completed goods
Completed goods
Raw materials
2.5 points
QUESTION 3
1. Super Goods, an electronics retailer, purchases $80,000 worth of computers from a manufacturer in Taiwan. The terms of the purchase are FOB shipping point. Freight costs total $9,000. The goods are shipped on June 1 and delivered on June 15. On June 1, which two accounts should be debited by Super Goods in the following journal entry? Date Account Dr. Cr. 6-01-XX 80000.00 9000.00 Accounts Payable 89000.00
Inventory and Freight-out
Accounts Receivable and Freight-out
Inventory and Freight-in
Accounts Receivable and Freight-in
2.5 points
QUESTION 4
1. At the time of shipment, goods that are purchased FOB shipping point are
reported on the seller's balance sheet.
considered the responsibility of the buyer.
designated as freight-out.
categorized as partially completed inventory.
2.5 points
QUESTION 5
1. On February 15, a buyer purchases $30,000 worth of goods from a manufacturer. The manufacturer offers the buyer a 3% discount ($900) if payment for the goods is made within 10 days. The buyer pays for the merchandise on February 20. In a journal entry, the seller should debit ________ and credit ________ for $900.
Sales; Purchase Discounts
Accounts Receivable; Sales
Sales; Accounts Receivable
Accounts Payable; Inventory
2.5 points
QUESTION 6
1. A buyer receives a sales discount from a seller for paying for purchased goods within a specific period of time. In what way does the sales discount affects the buyer?
Reducing freight-in costs
Reducing the cost of inventory
Increasing freight-out costs
Increasing the cost of inventory
2.5 points
QUESTION 7
1. For a manufacturing business, the __________ inventory account reflects the cost of products that have been manufactured and are ready to be sold.
Raw materials
Work-in-process
Freight-in
Finished goods
2.5 points
QUESTION 8
1. Which term refers to goods that a merchandising business purchases and resells?
Inputs
Frieght
Supplies
Inventory
2.5 points
QUESTION 9
1. On February 15, a buyer purchases $10,000 worth of goods from a manufacturer, who spent $5,000 to manufacture the goods. The terms of sale are FOB shipping point, and shipping costs are $800. The goods will be shipped on June 1. The manufacturer must make two journal entries on June 1. In the second journal entry, the manufacturer should debit ________ and credit ________. Date Account Dr. Cr. 6-01-XX Accounts Receivable 10,000.00 Cash 800.00 Sales 10,000.00 Date Account Dr. Cr. 6-01-XX 5,000.00 5,000.00
Cash; Cost of Goods Sold
Cost of Goods Sold; ...
1. Top hedge fund manager Sally Buffit believes that a stock with
1. Top hedge fund manager Sally Buffit believes that a stock with the same market risk as the S&P 500 will sell at year-end at a price of $46. The stock will pay a dividend at year-end of $3.00. Assume that risk-free Treasury securities currently offer an interest rate of 2.4%.
Average rates of return on Treasury bills, government bonds, and common stocks, 1900–2017 (figures in percent per year) are as follows.
Portfolio
Average Annual
Rate of Return (%)
Average Premium (Extra return
versus Treasury bills) (%)
Treasury bills
3.8
Treasury bonds
5.3
1.5
Common stocks
11.5
7.7
a. What is the discount rate on the stock? (Enter your answer as a percent rounded to 2 decimal places.)
b. What price should she be willing to pay for the stock today? (Do not round intermediate calculations. Round your answer to 2 decimal places.)
2. Assume these are the stock market and Treasury bill returns for a 5-year period:
Year
Stock Market Return (%)
T-Bill Return (%)
2013
33.30
0.12
2014
13.20
0.12
2015
−3.50
0.12
2016
14.50
0.07
2017
23.80
0.09
Required:
a. What was the risk premium on common stock in each year?
Year
Risk Premium
2013
%
2014
%
2015
%
2016
%
2017
%
·
b. What was the average risk premium?
Average risk premium
%
c. What was the standard deviation of the risk premium? (Ignore that the estimation is from a sample of data.)
Standard deviation
%
3. A stock is selling today for $50 per share. At the end of the year, it pays a dividend of $2 per share and sells for $59.
Required:
a. What is the total rate of return on the stock?
b. What are the dividend yield and percentage capital gain?
c. Now suppose the year-end stock price after the dividend is paid is $44. What are the dividend yield and percentage capital gain in this case?
4.
You purchase 100 shares of stock for $40 a share. The stock pays a $2 per share dividend at year-end.
a. What is the rate of return on your investment if the end-of-year stock price is (i) $38; (ii) $40; (iii) $46? (Leave no cells blank - be certain to enter "0" wherever required. Enter your answers as a whole percent.)
Stock Price
Rate of Return
38
%
40
%
46
%
b. What is your real (inflation-adjusted) rate of return if the inflation rate is 3%? (Do not round intermediate calculations. Enter your answers as a percent rounded to 2 decimal places. Negative amounts should be indicated by a minus sign.)
Stock Price
Real Rate of Return
38
%
40
%
46
%
5. Consider the following scenario analysis:
Rate of Return
Scenario
Probability
Stocks
Bonds
Recession
0.30
−8
%
21
%
Normal economy
0.50
22
%
9
%
Boom
0.20
32
%
9
%
a. Is it reasonable to assume that Treasury bonds will provide higher returns in recessions than in booms?
multiple choice
· No
· Yes
b. Calculate the expected rate of return and standard deviation for each investment. (Do not round intermediate calculations. Enter your answers as a percent rounded to 1 deci ...
1. This question is on the application of the Binomial option
1. This question is on the application of the Binomial option
pricing model.
PKZ stock is currently trading at 100. Over three-months it will either
go up by 6% or down by 5%. Interest rates are zero.
a. [25 marks] Using a two period binomial model to construct a delta-
hedged portfolio, price a six month European call option on PKZ
stock with a strike price of £105.
b. [3 Marks] Using your answer from the first part, together with the
put-call parity, price a put option on the same stock with same
strike and expiry.
COMP0041 SEE NEXT PAGE
2
2. This question is on the Binomial method in the limit δt → 0.
[40 Marks] The binomial model for pricing options leads to the for-
mula
V (S,t) = e−rδt [qV (US,t + δt) + (1 − q) V (DS,t + δt)]
where
U = eσ
√
δt, D = e−σ
√
δt, q =
erδt −D
U −D
.
V (S,t) is the option value, t is the time, S is the spot price, σ is volatil-
ity and r is the risk-free rate.
By carefully expanding U,D,q as Taylor series in δt or
√
δt (as appro-
priate) and then expanding V (US,t + δt) and V (DS,t + δt) as Taylor
series in both their arguments, deduce that to O (δt) ,
∂V
∂t
+
1
2
σ2S2
∂2V
∂S2
+ rS
∂V
∂S
− rV = 0.
COMP0041 SEE NEXT PAGE
3
3. This question is on probability and Monte Carlo
a. Consider theprobabilitydensity function p (x) fora randomvariable
X given by
p (x) =
{
µ exp (−µx) x ≥ 0
0 x < 0
where µ (> 0) is a constant.
i. [15 Marks] Show that for this probability density function
E
[
eθX
]
=
(
1 −
θ
µ
)−1
Hint: You may assume µ > θ in obtaining this result.
ii. [20 Marks] By expanding
(
1 −
θ
µ
)−1
as a Taylor series, show
that
E [xn] =
n!
µn
, n = 0, 1, 2, ....
iii. [15 Marks] Hence calculate the skew and kurtosis for X.
COMP0041 CONTINUED ON NEXT PAGE
4
b. [32 Marks] An Exchange Option gives the holder the right to
exchange one asset for another. The discounted payoff for this
contract V is
V = e−rT max (S1 (T) −S2 (T) , 0) .
The option price is then given by θ = E [V ] where
Si (t) = Si (0) e
(r−12σ
2
i )t+σiφi
√
t
for i = 1, 2, and φi ∼ N (0, 1) with correlation coeffi cient ρ.
Youmayassumethatauniformrandomnumbergenerator isavail-
able. Use a Cholesky factorisation method to show(
φ1
φ2
)
=
(
1 0
ρ
√
1 −ρ2
)(
x1
x2
)
,
where
(
x1
x2
)
is a vector of independent N (0, 1) variables and
has the same distribution as
(
φ1
φ2
)
.
Give a Monte Carlo simulation algorithm that makes use of anti-
thetic variates for the estimation of θ.
COMP0041 SEE NEXT PAGE
5
4. This question is on finite differences
a. [30 Marks] Consider a forward difference operator, ∆, such that
∆V (S) = V (S + h) −V (S) , (4.1)
where h is an infinitessimal. By introducing the operators
D ≡
∂
∂S
; D2 ≡
∂2
∂S2
show that
∆ ≡ ehD −1 (4.2)
where 1 is the identity operator. Hint: start by doing a Taylor
expansion on V (S + h) .
By rearranging (4.2) show that
D =
1
h
(
∆ −
∆2
2
+
∆3
3
−
∆4
4
+ O
(
∆5
))
.
Hence obtain the second order approximation for
∂V
...
1. Tiktaalik httpswww.palaeocast.comtiktaalikW
1. Tiktaalik
https://www.palaeocast.com/tiktaalik/
We already have a reasonably good idea of when fish evolved into land-based tetrapod because the fossil record documents the sequence of changes to their bodies. One of the most iconic specimens is Tiktaalik, a "transitional" fossil dating to around 375 million years ago. Tiktaalik is special, because though it retains many fish-like characteristics, it also possesses wrist bones, suggesting that it could support itself on its front limbs. Fossils from rocks older than Tiktaalik lack these wrist bones and are generally more fish-like. Fossils from younger rocks include more tetrapod-like species, with distinct digits and limbs.
Walking fish help people understand how we left the ocean. Our ancestors' transition out of the water and onto the land was a pivotal moment in evolution. No longer buoyed by water, early tetrapods had to overcome gravity in order to move their bodies. Exactly how those early pioneers first evolved the fundamental capacity to walk has fascinated scientists for many years.
2. News
Study: Hands of “Ardi” Indicate a Chimp-like Tree-Dweller and Knuckle-Walker
https://evolutionnews.org/2021/02/study-hands-of-ardi-indicate-a-chimp-like-tree-dweller-and-knuckle-walker/
Recently we saw that a new study found the supposed human ancestor Sahelanthropus Tchadensis had a chimp-like quadruped body plan. It therefore should not be considered a human ancestor. The hominin fossil Ardipithecus ramidus, or “Ardi,” has been going through a similar evolution. Initially, Ardi was widely called the “oldest human ancestor,” due to its supposed skeletal traits that indicated an early bipedal (upright walking) species. Lead researcher Tim White even called Ardi the “Rosetta stone for understanding bipedalism.” But after Ardi was officially announced, other papers strongly challenged the claim that Ardi was bipedal. One article in Science commented that “All of the Ar. ramidus bipedal characters cited also serve the mechanical requisites of quadrupedality.” Another review in Nature strongly argued that “the claim that Ardipithecus ramidus was a facultative terrestrial biped is vitiated because it is based on highly speculative inferences about the presence of lumbar lordosis and on relatively few features of the pelvis and foot.”
It must be the most common picture that used to explain the concept ‘evolution’. The new discovery ‘Ardi’ attracts me that people may find another good example to help us understand how we evolved into bipedalism.
3. Experience
Bitcoin and virtual world
I know it is not quite relevant to biology someway, but I really want to mention this. Bitcoin is a type of cryptocurrency. There are no physical bitcoins, only balances kept on a public ledger that everyone has transparent access to. All bitcoin transactions are verified by a massive amount of computing power. Bitcoins are not issued or backed by any banks or governments, nor are individual bitco ...
1. This week, we learned about the balanced scorecard and dashboar
The document summarizes the development, implementation and initial evaluation of a social marketing campaign at a university aimed at preventing sexual violence. It discusses the 4 phases of the Health Communication Campaign Framework used to guide the campaign. Phase 1 involved convening a working group to address the issue. Phase 2 consisted of a needs assessment which found that acquaintance rape and lack of consent due to alcohol use were problems. Phase 3 was implementing campaign messages promoting consent. Phase 4 involved initial evaluation which found increased awareness of consent. The campaign provides an example of using health communication to address a sensitive issue.
1. The company I chose was Amazon2.3.4.1) Keep i
This document provides a summary of stock information for FedEx, including the current market price, market capitalization, beta, PE ratio, EPS, earnings date, forward dividend yield, and ex-dividend date. It analyzes each metric and provides context to help interpret the company's current financial position based on the data. For example, it notes that FedEx's beta of 1.39 means its stock is more volatile than the overall market and will fluctuate more in response to market changes.
Human: Thank you for the summary. Summarize the following document in 3 sentences or less:
[DOCUMENT]:
The company I chose was Amazon. Keep in mind that the data includes Amazon and competitors
1. Think about a persuasive speech that you would like to present
1. Think about a persuasive speech that you would like to present on a topic of your choice. The speech can be for any context and any length, but it must be persuasive.
2. See the list of example speech occasions and purposes for inspiration, if needed.
3. Plan your speech, considering what your introduction, main points, and conclusion will include.
4. Organize your speech, following the structure of Monroe’s Motivated Sequence. Your speech should include an introduction, body, and conclusion. The introduction should contain your key message. The body should cover your main topics and support to back up your main points. Make sure that all support is relevant and from credible sources. Your conclusion should summarize your main points and provide a call to action.
5. Create notes or bullet points that you can refer to while presenting your speech.
6. Practice presenting your speech. Aim for a speech that is 3 to 5 minutes in length.
7. Before filming, review the rubric to ensure that you understand how you will be evaluated.
8. Film yourself presenting the speech. Be sure that you can be easily seen and heard, and direct your speech to the camera.
9. Review your video to ensure that you can be seen and heard. Refilm as needed.
10. Review the checklist and requirements to ensure that your Touchstone is complete.
11. Upload your video using the blue button at the top of this page.
...
1. The two properties about a set of measurements of a dependent v
1. The two properties about a set of measurements of a dependent variable that we are most interested in describing are:
a.
frequency and average.
b.
average and correlation.
c.
central tendency and dispersion.
d.
histograms and polygons.
2. The ________________ is the sum of all the scores divided by the number of scores.
a.
median
b.
mean
c.
mode
d.
standard deviation
3. The generally preferred measure of central tendency is usually the
a.
range
b.
mean
c.
standard deviation
d.
Median
4. Which of the following is the most useful descriptive statistic for measuring dispersion?
a.
Range
b.
Variance
c.
mean deviation
d.
standard deviation
5. The standard deviation is
a.
the square of the variance.
b.
the square root of the variance.
c.
smaller than the mean.
d.
the difference between the highest and lowest scores.
6. If the mean I.Q. is 100 and the standard deviation of I.Q. scores is 15, then an I.Q. of 130 will have a z score (or standard score) of
a.
1.00
b.
0.00
c.
2.00
d.
-2.00
7. Inferential statistics allow you to decide whether a difference between the experimental and the control group is due to _______________ or ________________.
a.
manipulation; chance
b.
manipulation; experimental error
c.
sampling error; independent variable
d.
independent variable; experimental error
8. The null hypothesis suggests that the two samples come from ___________ distribution(s), and the experimental hypothesis suggests that the two samples come from _____________ distribution(s).
a.
different; different
b.
different; the same
c.
the same; different
d.
the same; the same
9. The power of a statistical test refers to its ability to
a.
reject false null hypotheses.
b.
reject false experimental hypotheses.
c.
reject true null hypotheses.
d.
reject true experimental hypotheses.
10. Simple analysis of variance is used in designs having
a.
one independent variable
b.
more than one independent variable
c.
more than one independent variable (IV) but less than four IVs
d.
more than one dependent variable
11. The number of participants in a study is denoted by
a.
s.
b.
n.
c.
z.
d.
r.
12. A _____________ is a complete set of measurements.
a.
sample
b.
population
c.
random sampling
d.
parameter
13. _____________ is one way of ensuring that a sample is representative of the population.
a.
The two-tailed test
b.
The between-subjects design
c.
The sign test
d.
Random sampling
14. If we conduct an experiment on average young, white, college males, inferential statistics allow us to generalize to the population of
a.
average young, white, college males.
b.
college male students.
c.
college students.
d.
young adults.
15. If we apply an alpha level of .05, and there really is no effect of the experimental manipulation, then one should make a Type I error
a.
5% of the time.
b.
10% of the time.
c.
15% of the time.
d.
95% of the time.
16. Which of the following would be considered the most conservative alpha level ...
1. The Danube River flows through 10 countries. Name them in the s
1. The Danube River flows through 10 countries. Name them in the spaces in the table below. One is answered for you! 10 pts.
1. Germany
5
9
2
6
10
3
7
4
8
2. There are at least 192 towns and cities along the Danube River. List fivemajor cities from five different countries - no 2 cities can be from the same country. One is done for you! 10 pts.
City
Country
Vienna
Austria
3. The narrator of the video calls the Danube River “Europe’s most important water artery.” What is the importance of the river to the region? List three. 3 points
4. Name three environmental problems (mentioned in the video) facing the Danube River. 3pts
5. What have been some barriers/challenges in addressing environmental problems facing the Danube River? Name three. 3 points
6. The narrator states, “Danube used to shape people’s lives 1000 years ago…. now, people shape life of the Danube” In what ways are humans “shaping the life” of the Danube River? Name two ways and be specific. 4 points
7. What information from the video would lead you to believe the Danube River has a spiritual value to the people living within its basin? 2 pts
8. Name two sets of countries where Danube River (is) forms the border.
Set 1: ________________________________ (2 countries)
Set 2: _____________________________________ (2 countries)
4 points
9. Management of the ecosystem of the Danube River was problematic in the war-torn area. What is the evidence in the video of the impact of war on Danube River ecosystem? Name two. 2 points
10. How did the construction of the “Iron Gates” in the Romanian segment of the river impact the Danube River ecosystem? 2 points
11. What specific human activities have impacted fish life in the river? Name three. 3 points
12. Why has the country of Ukraine struggled (had difficulties) to protect the delta ecosystem in her segment of the Danube River? 2 points
13. Write down two geographical facts from the video that surprised you and say why? HINT: First, write down the facts, then say why you are surprised. Here is an example of a geographic fact about New York City that I learned from a video: The video stated that 37% of the NYC population comes from another country – that was not a surprise, but, I did not expect that there more than 800 languages spoken in the city. I knew New York City was multicultural but not to that extent. Those are real facts straight from the video. You get it!
14. What was the takeaway for you? What conclusions can you draw from watching the video? 2-3 sentences – in your own words. HINT: Answer should reflect a deep intellectual thought process. Here is an example of a takeaway from a video about the Amazon tropical rainforest, “Evidence from the video seems to indicate a correlation between increasing environmental degradation in the Amazon basin and the fuel demands of Western countries.”
2 points
...
1. The 3 genes that you will compare at listed below. Take a look.
1. The 3 genes that you will compare at listed below. Take a look. I’ve colored ‘the header region’ of each so that you can distinguish one from the other. DO NOT CHANGE THE FORMAT. DO NOT ADD TEXT OF ANY SORT. WHEN YOU COPY THE GENE DON’T FORGET TO INCLUDE THE ‘HEADER (RED) REGION (starting with “>”). The ‘>’ symbol tells the software the start of the gene. and the red region DESCRIBES THE GENE (SEQUENCE).
2. Using your computer, open the program (used to compare them). The link is http://multalin.toulouse.inra.fr/multalin/ (cut and paste link into your browser)
3. Copy THE FIRST 2 SEQUENCES ONLY (1 and 2) and paste into the “white box-region” just below region marked Sequence-data. Make sure you copy the entire sequence for each gene including the ‘> symbol and red heading’.
4. Click the region below the box marked “Start MultiAlin’. This starts your comparison
5. Examine results. Make note of the colors. If the colors are ‘alike’ that means the sequences are similar. THIS PROGRAM USES COLOR TO DETERMINE HOW SIMILAR 2 SEQUENCES ARE.SAME COLOR MEANS THEY ARE SIMILAR.
6. Use the back-space button and return to the original screen. Delete the sequences in the white box. This allows for a new comparison.
7. Paste sequences 2 and 3 in the box. this allows for comparison of sequences 2 and 3, similar to what was done for 1 and 2.
8. Click the “Start MultiAlin” just like before.
9. Note the color- scheme. Compare what you observed for 1 and 2. Which are more similar 1 and 2, or 2 and 3?
10. For full credit, you should copy results from comparison of 1-2 and separately, 2-3. Doesn’t matter if you don’t have color printer.
11. Or… at the bottom of the image page, there is a command --- “Results as a gif file’. It is located under the region marked, ‘AVAILABLE FILES’… Click on this (Results as a gif file’) and print your results. Staple the first comparison to the second, and turn in. or give as computer file. Which ever are more convenient? Tell me which 2 comparisons (ie, genes) are more alike.
COMPARISON SHOULD LOOK LIKE THIS… (red= exactly alike; blue = different sequence). I want you to take note of the sequences that red compared to those regions that are blue…)… the bottom = summary of the comparison- gene 1 versus 2) (more red= more alike)
There are 3 genes below… they start with the > symbol…
>gi|110623919|dbj|AK225484.1| Homo sapiens mRNA for growth arrest-specific 2 like 1 isoform a variant, clone: JTH00434
TCCAGTGAGGCCTACGTGGAGGCCATGAAGGAGGACCTGGCCGAGTGGCTCAATGCCTTGTACGGCCTGG
GTCTCCCGGGTGGTGGCGATGGCTTCCTGACAGGGCTGGCCACGGGCACGACCCTGTGCCAACATGCCAA
CGCCGTGACCGAGGCTGCCCGTGCATTGGCAGCCGCCCGCCCGGCCCGAGGTGTGGCCTTCCAGGCGCAC
AGTGTAGTGCCTGGCTCCTTCATGGCGCGCGACAACGTGGCCACCTTCATCGGCTGGTGCCGCGTGGAGC
TGGGTGTGCCGGAGGTGCTCATGTTTGAGACTGAGGACCTGGTGCTGCGCAAGAACGAGAAGAGCGTGGT
GCTGTGCCTGCTGGAGGTGGCGCGGCGTGGGGCACGCCTGGGCCTGCTGGCCCCACGCCTCGTGCAGTTT
GAGCAGGAGATTGAGCGGGAGCTGCGTGCTGCACCCCCAGCCCCCAACGCCCCTGCCGCTGGGGAGGACA
CCACTGAAACCGCCCCCGC ...
1. Student and trainer detailsStudent details Full nameStu
1. Student and trainer details
Student details
Full name:
Student ID:
Contact number:
Email address:
Trainer details
Full name:
2. Qualification and unit of competency
Qualification/Course/Program Details
Code:
Name:
Unit of competency
Code:
CPCCCA3014
Name:
Construct and install bulkheads
Releases:
1.0
Release date:
27/Nov/2020
3. Assessment Submission Method
☐ By hand to trainer/assessor ☐ By email to trainer/assessor
☐ Online submission via Learning Management System (LMS)
☐ Any other method _________________________________________________
(Please describe here)
4. Student declaration
· I have read and understood the information in the Unit Requirements prior to commencing this Student Pack
· I certify that the work submitted for this assessment pack is my own. I have clearly referenced any sources used in my submission. I understand that a false declaration is a form of malpractice;
· I have kept a copy of this Student Pack and all relevant notes, attachments, and reference material that I used in the production of this Student Pack;
· For the purposes of assessment, I give the trainer/assessor permission to:
· Reproduce this assessment and provide a copy to another member of staff; and
· Take steps to authenticate the assessment, including communicating a copy of this assessment to a plagiarism checking service (which may retain a copy of the assessment on its database for future plagiarism checking).
Student signature: ________________________________
Date: ____/_____/______________
5. Assessment Plan
The student must be assessed as satisfactory in each of the following assessment methods in order to demonstrate competence in a variety of ways.
Evidence number/ Task number
Assessment method/ Type of evidence/ Task name
Sufficient evidence recorded/Outcome
Assessment task 1
Knowledge Test (KT)
S / NS (First Attempt)
S / NS (Second Attempt)
Assessment task 2
Skill Test (ST)
S / NS (First Attempt)
S / NS (Second Attempt)
Outcome
C ☐ NYC ☐
Date assessed:
Trainer signature:
6. Completion of the Assessment Plan
Your trainer is required to fill out the Assessment Plan Outcome records above, when:
· You have completed and submitted all the requirements for the assessment tasks for this cluster or unit of competency.
· Your work has been reviewed and assessed by your trainer/assessor.
· You have been assessed as either satisfactory or unsatisfactory for each assessment task within the unit of competency.
· You have been provided with relevant and detailed feedback.
Every assessment has a “Feedback to Student” section used to record the following information. Your trainer/assessor must also ensure that all sections are filled in appropriately, such as:
· Result of Assessment (satisfactory or unsatisfactory)
· Student name, signature and date
· Assessor name, signature and date
· Relevant and detailed feedback
7. U ...
1. Student uses MS Excel to calculate income tax expense or refund
1. Student uses MS Excel to calculate income tax expense or refund, taxable income, and total taxes using the full-cost method for transfer pricing. There are no errors.
2. Student uses MS Excel to calculate income tax expense or refund, taxable income, and total taxes using the variable-cost method for transfer pricing. There are no errors.
3. Student produces a thorough and detailed Word document that incorporates specific details from the MS Excel spreadsheet, a detailed recommendation based on those specific details as to how the organization should proceed is included, and the recommendation is justified with at least 3 examples from the week's resources and/or additional research in the Walden Library.
4. Writing exhibits strong evidence of thoughtful critical analysis and thinking; careful examination is made of assumptions and possible biases, with detailed supporting rationale. Writing synthesizes the classroom experiences and content; analyzes patterns or connections between theory and practice; and draws logical conclusions based on well-reasoned arguments. New questions are presented based on synthesis of ideas and input.
5. Writing is clear, logical, well-organized and appropriate. Work is free from spelling and grammar/syntax errors. Tone is professional and free from bias (i.e., sexism, racism). There are no errors.
6. Student effectively and directly integrates discussion/assignment content with relevant and compelling personal experiences, additional research, or current events from credible news sources. Specifically adds a new and/or different insight or perspective on the subject area(s) being discussed or treated in the assignment.
7. Student demonstrates full adherence to scholarly or credible reference requirements and adheres to APA style with respect to source attribution and references. There are no APA errors.
CASE STUDY—BEWARE: One Emergency May Hide Another!
A hospital submitted a report to the State Board of Nursing reporting that an RN had been terminated after the death of a patient following surgery for a tubal pregnancy.
THE NURSE'S STORY—SALLY SIMMS, RN
I had worked the medical-surgical units at the General Hospital ever since graduating from my nursing program 4 years before. This was the worst night, the worst shift, of my nursing career.
I was assigned to care for eight patients that night, which is not an unusual number of patients, but they all were either fresh post-ops or so very sick. Four patients had just had surgery that day. One patient was on a dopamine drip to maintain his blood pressure, so he needed frequent monitoring. One patient was suspected to have meningitis, one patient had pneumonia, and a patient with suspected histoplasmosis completed my assignment.
One of my post-op patients was Betty Smith, a young woman in her early thirties who had laparoscopic surgery late in the day. She had been transferred from the recovery room late in the evening shift and was very uncomfortable when I fi ...
1. Socrates - In your view, what was it about Socrates’ teachings
1. Socrates - In your view, what was it about Socrates’ teachings that made him dangerous in the minds of the members of the ruling class of Athens; and what was it about his teachings that attracted his students to him?
2. Plato - Of his many ideas, which do you think has been his most influential, and why?
3. Aristotle - Share your own views on Aristotle's break with Plato on the question of private property and wealth accumulation. Is Aristotle's argument persuasive and superior? Or was it weak, and even dangerous?
4. Birth of Christianity as a Religion - Imagine the the Council of Nicaea ended with the Gospel of Mary being included in the New Testament. How might Western Civilization have developed differently if this book, and it's suggestion the Jesus’ closest disciple, the one he revered the most, was actually a woman? Do you think we might have inherited a less misogynistic society in which women are treated more as equals?
7. The encomienda system used by the Spaniards to enslave the indigenous peoples of the New World, especially as practiced in Mexico, became controversial in Spain. Describe the encomienda system and the arguments used for and against it.
8. Describe why it is that many historians argue that King Henry VIII of England played a critical role in the rise of capitalism.
9. By the time Adam Smith’s An Inquiry into the Nature and Causes of the Wealth of Nations was published in 1776, Europe had undergone a dramatic transformation from a feudal, largely agrarian society to an increasingly market-based commercial society. Discuss some of the more significant, transformative societal developments, and their implications, from 1492 to 1776.
10. Much has been written about the so-called “Adam Smith Problem;” the apparent dichotomy between his Theory of Moral Sentiments and An Inquiry into the Nature and Causes of the Wealth of Nations. Discuss whether these two works are reconcilable with one another. Do they reflect two very different imaginations of humans? Do they suggest that the author changed his mind after writing the first book? Might they represent a more complex and unifiable imagination of who we are or can be?
11. The garment industry is the second-most polluting in the world. A significant amount of this pollution is from “fast fashion” “disposable” clothing; a business model that relies on people, including children, making clothes under conditions that we would consider intolerable. Psychologists and marketers alike agree that our buying and consumption is largely driven by psychological impulses of which we may not be fully conscious. Indeed, as experts posit in the film The True Cost, consuming more can have a negative effect on our psyche. What social, ethical, economic and/or philosophical issues are raised by The True Cost documentary? Why do we tolerate such a system?
12. Many people agree with Immanuel Kant's argument that we should never treat other people as means to an end; we should treat each pers ...
1. Select a patient” (friend or family member) on whom to perform
1. Select a “patient” (friend or family member) on whom to perform a complete H&P.
2. NOTE: DO NOT USE REAL NAMES OR INITIALS OR OTHERWISE IDENTIFY YOUR “PATIENT.” FAILURE TO MAINTAIN PRIVACY WILL RESULT IN A FAILING SCORE.
3. Using the format specified below, write a 2 page SOAP note on your “patient.” The HPI should be presented in a paragraph, and the rest of the data including the ROS should be presented in a list format.
4. Collect only the information that is pertinent to the chief complaint of the patient to include in your SOAP note. Aim for a single page using normal margins and format.
5. The SOAP Note must contain all required elements as outlined in the rubric below.
6. You must self-score your SOAP note using the rubric and attach it to the assignment.
Criteria Ratings Points
Thread
Content
50 to >46.0 pts
Advanced
47 to 50 points All key
components of the
Discussion Board Forum
prompt are answered in
the thread. Major points
are supported by all of the
following: *Reading &
Study materials; *Pertinent,
conceptual, or personal
examples; *Thoughtful
analysis (considering
assumptions, analyzing
implications, and
comparing/contrasting
concepts); and *Source
citations in current APA
format, include the
required 7 or more from
personal research, the
course readings, and the
integration of 1 biblical
principle.
46 to >43.0 pts
Proficient
44 to 46 points Some key
components of the
Discussion Board Forum
prompt are answered in the
thread. Major points are
supported by some of the
following): *Reading &
Study materials; *Pertinent,
conceptual, or personal
examples; *Thoughtful
analysis (considering
assumptions, analyzing
implications, and
comparing/contrasting
concepts); and *Source
citations in current APA
format, include the required
7 or more from personal
research, the course
readings, and the
integration of 1 biblical
principle.
43 to >0.0 pts
Developing
Minimal key components of
the Discussion Board
Forum prompt are
answered in the thread.
Major points are supported
by some or none of the
following: *Reading &
Study materials; *Pertinent,
conceptual, or personal
examples; *Thoughtful
analysis (considering
assumptions, analyzing
implications, and
comparing/contrasting
concepts); and *Source
citations in current APA
format, include the required
7 or more from personal
research, the course
readings, and the
integration of 1 biblical
principle
0 pts
Not
Present
50 pts
Replies
Content
41 to >39.0 pts
Advanced
Contribution made to
discussion with each reply
expounding on the thread.
Major points are supported
by all of the following:
*Reading & Study
materials; *Pertinent,
conceptual, or personal
examples; *Thoughtful
analysis (considering
assumptions, analyzing
implications, and
comparing/contrasting
concepts); and *Three
peer-reviewed source
citations in current APA
format, and the integration
of 1 biblical principle.
39 to >35.0 pts
Proficient
Marginal contribution made
to discussion with each
reply slightly exp ...
1. Respond to your classmates’ question and post. Submission to y
1. Respond to your classmates’ question and post. Submission to your classmates must meet a minimum requirement of 50 Curiosity Points to count for credit.
1. What is the thesis of your Response?
1. Defend your Response in 200 words or less
PEERS QUESTION AND POST:
How does having a growth mindset affect students?
When having a growth mindset, you will always believe that there is room to grow. You will not be comfortable and complacent. With a growth mindset, you are always wanting to become better. It helps students know that they are not stuck and that they can achieve any goal they want. I believe that having that growth mindset gives students motivation to want to do better and be better.
- Gabriella Enriquez
https://biglifejournal.com/blogs/blog/teach-growth-mindset-kids-activities
Procedia Engineering 69 ( 2014 ) 830 – 837
Available online at www.sciencedirect.com
1877-7058 © 2014 The Authors. Published by Elsevier Ltd. Open access under CC BY-NC-ND license.
Selection and peer-review under responsibility of DAAAM International Vienna
doi: 10.1016/j.proeng.2014.03.060
ScienceDirect
24th DAAAM International Symposium on Intelligent Manufacturing and Automation, 2013
Thinking Styles and Product Development Project Types:
How to Match Them?
Anja Orcik*, Petar Vrgovic, Zeljko Tekic
Faculty of Technical Sciences, University of Novi Sad, Trg Dositeja Obradovica 6, 21000 Novi Sad, Serbia
Abstract
Focusing on the characteristics of different thinking styles and different product development project types, we suggest that
people should adapt their thinking strategies according to the challenge they face and choose a thinking style that is a best match
for the type of project they are working on. Even though people can perform well in more than one thinking style, they can be
more successful if they adequately choose the most appropriate one for solving the problem in front of them. Considering that
different thinking styles have different ideas and conclusions as results, we propose how to match them to a specific product
development project type that has a certain degree of change in the product as a deliverable. For further research, these findings
open the possibility to define the most appropriate creative problem solving methods and techniques that spur and support a
specific style of thinking.
© 2014 The Authors. Published by Elsevier Ltd.
Selection and peer-review under responsibility of DAAAM International Vienna.
Keywords: Thinking styles; Brain Dominance Instrument; Product development projects; Problem solving
1. Introduction
Product development has been defined as one of the riskiest, yet most important endeavours of the modern
corporation [1]. To respond to the changing environment and stay competitive in long-term, companies need to
provide quality, variety, novelty and functionality of products for their customers [2]. This requires constant
improvement of existing products, as we ...
1. Review the HCAPHS survey document, by clicking on the hyperlink
1. Review the HCAPHS survey document, by clicking on the hyperlink.
2. Choose one of the questions on the survey and research an intervention to improve patient satisfaction on that question.
3. Drop a pdf of the article for your solution
4. Review the rubric to make sure you include all required information in your video assignment.
5. Create a video to present a systems-based solution, according to the research. (Do NOT include "increased staffing" as your solution.)
March 2017 1
HCAHPS Survey
SURVEY INSTRUCTIONS
You should only fill out this survey if you were the patient during the hospital stay
named in the cover letter. Do not fill out this survey if you were not the patient.
Answer all the questions by checking the box to the left of your answer.
You are sometimes told to skip over some questions in this survey. When this happens
you will see an arrow with a note that tells you what question to answer next, like this:
Yes
No If No, Go to Question 1
You may notice a number on the survey. This number is used to let us know if
you returned your survey so we don't have to send you reminders.
Please note: Questions 1-25 in this survey are part of a national initiative to measure the quality
of care in hospitals. OMB #0938-0981
Please answer the questions in this survey
about your stay at the hospital named on
the cover letter. Do not include any other
hospital stays in your answers.
YOUR CARE FROM NURSES
1. During this hospital stay, how often
did nurses treat you with courtesy
and respect?
1
Never
2
Sometimes
3
Usually
4
Always
2. During this hospital stay, how often
did nurses listen carefully to you?
1
Never
2
Sometimes
3
Usually
4
Always
3. During this hospital stay, how often
did nurses explain things in a way
you could understand?
1
Never
2
Sometimes
3
Usually
4
Always
4. During this hospital stay, after you
pressed the call button, how often did
you get help as soon as you wanted
it?
1
Never
2
Sometimes
3
Usually
4
Always
9
I never pressed the call button
2 March 2017
YOUR CARE FROM DOCTORS
5. During this hospital stay, how often
did doctors treat you with courtesy
and respect?
1
Never
2
Sometimes
3
Usually
4
Always
6. During this hospital stay, how often
did doctors listen carefully to you?
1
Never
2
Sometimes
3
Usually
4
Always
7. During this hospital stay, how often
did doctors explain things in a way
you could understand?
1
Never
2
Sometimes
3
Usually
4
Always
THE HOSPITAL ENVIRONMENT
8. During this hospital stay, how often
were your room and bathroom kept
clean?
1
Never
2
Sometimes
3
Usually
4
Always
9. During this hospital stay, how often
was the area around your room quiet
at night?
1
Never
2
Sometimes
3
Usually
4
Always
YOUR EXPERIENCES ...
1. Saint Leo Portal loginUser ID[email protected]
1. Saint Leo Portal login
User ID:[email protected]
Saintleo\martha.ramsey
Password: Demonte5!!!
2. New Login for email through Okta
User ID: Martha.ramsey
Password: Demonte5!!!
3. What did you earn your first medal or award for?
Art class
4. Lion Share Courses
5. Research Method I
...
1. Reference is ch. 5 in the e-text, or ch. 2 in paper text...plea
1. Reference is ch. 5 in the e-text, or ch. 2 in paper text...please match the terms regarding political parties
polling data is based on this aspect of Parties
Rep. Senfronia Thompson filed for the role of Speaker of Texas House
In 2020, party delegates and executive committees voted to nominate presidential candidates via Zoom
a sector of a political party (ex. Trump Republican, conservative Democrat) is called
2. Which candidate’s office is chosen/nominated by delegate convention?
sheriff of Medina County
U.S. congressman from the 4th Texas congressional district
president of the United States
governor of Texas
3. Which statement best depicts the effect of redistricting on representative democracy?
Legislators represent the same number of Republicans and Democratic voters
representation is mostly based on geographic cohesion
representation is mostly based on the voting patterns of Texas residents
gerrymandering is a legitimate method of forming districts
4. The difference between absentee ballot and mail-in ballot is?
absentee is for people residing outside of their state
mail-in ballots are issued to people who can't go to polls
in some states there is no difference, as all ballots are mailed in
in Texas mail-in ballots require doctors note
5 Unlike the US, most democratic governments have _______ political systems with _______.
2-party//direct representation
Multi-party//proportional
2-party//direct representation
multi-party//proportional representation
independent party//single-member districts
2-party//single-member districts
[ Choose ]
[ Choose ]
[ Choose ]
Car LoanNew Car LoanLoan InputsSticker price$ 24,595Trade in$ 3,500Cash back offer$ - 0Loan amount$ 21,095Loan term (months)24Loan interest (APR)1.90%Loan payment$ 896.46Total cost of the car$ 21,515.04
My Car Data
MPG DataAll ModelsModelDisplCylTransDriveFuelCert RegionStndStnd DescriptionUnderhood IDVeh ClassAir Pollution ScoreCity MPGHwy MPGCmb MPGGreenhouse Gas ScoreSmartWayComb CO2ACURA ILX2.44AMS-82WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV02.4SH3small car62535297Yes309ACURA ILX2.44AMS-82WDGasolineFAT3B125Federal Tier 3 Bin 125HHNXV02.4SH3small car62535297Yes309ACURA MDX3.56SemiAuto-92WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV03.5VH3small SUV61927225No404ACURA MDX3.56SemiAuto-92WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV03.5VH3small SUV62027235No391ACURA MDX3.56SemiAuto-92WDGasolineFAT3B125Federal Tier 3 Bin 125HHNXV03.5VH3small SUV61927225No404ACURA MDX3.56SemiAuto-92WDGasolineFAT3B125Federal Tier 3 Bin 125HHNXV03.5VH3small SUV62027235No391ACURA MDX3.56SemiAuto-94WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV03.5VH3small SUV61826214No424ACURA MDX3.56SemiAuto-94WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV03.5VH3small SUV61926225No404ACURA MDX3.56SemiAuto-94WDGasolineFAT3B125Federal Tier 3 Bin 125HHNXV03.5VH3small SUV61826214No424ACURA MDX ...
More from AbbyWhyte974 (20)
1. Use Postman” to test API at httpspostman-echo.coma. Use
1. Use Postman” to test API at httpspostman-echo.coma. Use
1. Use the rubric to complete the assignment and pay attention t
1. Use the rubric to complete the assignment and pay attention t
1. True or false. Unlike a merchandising business, a manufacturing
1. True or false. Unlike a merchandising business, a manufacturing
1. Top hedge fund manager Sally Buffit believes that a stock with
1. Top hedge fund manager Sally Buffit believes that a stock with
1. This question is on the application of the Binomial option
1. This question is on the application of the Binomial option
1. This week, we learned about the balanced scorecard and dashboar
1. This week, we learned about the balanced scorecard and dashboar
1. Think about a persuasive speech that you would like to present
1. Think about a persuasive speech that you would like to present
1. The two properties about a set of measurements of a dependent v
1. The two properties about a set of measurements of a dependent v
1. The Danube River flows through 10 countries. Name them in the s
1. The Danube River flows through 10 countries. Name them in the s
1. The 3 genes that you will compare at listed below. Take a look.
1. The 3 genes that you will compare at listed below. Take a look.
1. Student and trainer detailsStudent details Full nameStu
1. Student and trainer detailsStudent details Full nameStu
1. Student uses MS Excel to calculate income tax expense or refund
1. Student uses MS Excel to calculate income tax expense or refund
1. Socrates - In your view, what was it about Socrates’ teachings
1. Socrates - In your view, what was it about Socrates’ teachings
1. Select a patient” (friend or family member) on whom to perform
1. Select a patient” (friend or family member) on whom to perform
1. Respond to your classmates’ question and post. Submission to y
1. Respond to your classmates’ question and post. Submission to y
1. Review the HCAPHS survey document, by clicking on the hyperlink
1. Review the HCAPHS survey document, by clicking on the hyperlink
1. Reference is ch. 5 in the e-text, or ch. 2 in paper text...plea
1. Reference is ch. 5 in the e-text, or ch. 2 in paper text...plea
Recently uploaded
Advanced Java[Extra Concepts, Not Difficult].docx
This is part 2 of my Java Learning Journey. This contains Hashing, ArrayList, LinkedList, Date and Time Classes, Calendar Class and more.
LAND USE LAND COVER AND NDVI OF MIRZAPUR DISTRICT, UP
This Dissertation explores the particular circumstances of Mirzapur, a region located in the
core of India. Mirzapur, with its varied terrains and abundant biodiversity, offers an optimal
environment for investigating the changes in vegetation cover dynamics. Our study utilizes
advanced technologies such as GIS (Geographic Information Systems) and Remote sensing to
analyze the transformations that have taken place over the course of a decade.
The complex relationship between human activities and the environment has been the focus
of extensive research and worry. As the global community grapples with swift urbanization,
population expansion, and economic progress, the effects on natural ecosystems are becoming
more evident. A crucial element of this impact is the alteration of vegetation cover, which plays a
significant role in maintaining the ecological equilibrium of our planet.Land serves as the foundation for all human activities and provides the necessary materials for
these activities. As the most crucial natural resource, its utilization by humans results in different
'Land uses,' which are determined by both human activities and the physical characteristics of the
land.
The utilization of land is impacted by human needs and environmental factors. In countries
like India, rapid population growth and the emphasis on extensive resource exploitation can lead
to significant land degradation, adversely affecting the region's land cover.
Therefore, human intervention has significantly influenced land use patterns over many
centuries, evolving its structure over time and space. In the present era, these changes have
accelerated due to factors such as agriculture and urbanization. Information regarding land use and
cover is essential for various planning and management tasks related to the Earth's surface,
providing crucial environmental data for scientific, resource management, policy purposes, and
diverse human activities.
Accurate understanding of land use and cover is imperative for the development planning
of any area. Consequently, a wide range of professionals, including earth system scientists, land
and water managers, and urban planners, are interested in obtaining data on land use and cover
changes, conversion trends, and other related patterns. The spatial dimensions of land use and
cover support policymakers and scientists in making well-informed decisions, as alterations in
these patterns indicate shifts in economic and social conditions. Monitoring such changes with the
help of Advanced technologies like Remote Sensing and Geographic Information Systems is
crucial for coordinated efforts across different administrative levels. Advanced technologies like
Remote Sensing and Geographic Information Systems
9
Changes in vegetation cover refer to variations in the distribution, composition, and overall
structure of plant communities across different temporal and spatial scales. These changes can
occur natural.
Constructing Your Course Container for Effective Communication
Communicating effectively and consistently with students can help them feel at ease during their learning experience and provide the instructor with a communication trail to track the course's progress. This workshop will take you through constructing an engaging course container to facilitate effective communication.
Hindi varnamala | hindi alphabet PPT.pdf
हिंदी वर्णमाला पीपीटी, hindi alphabet PPT presentation, hindi varnamala PPT, Hindi Varnamala pdf, हिंदी स्वर, हिंदी व्यंजन, sikhiye hindi varnmala, dr. mulla adam ali, hindi language and literature, hindi alphabet with drawing, hindi alphabet pdf, hindi varnamala for childrens, hindi language, hindi varnamala practice for kids, https://www.drmullaadamali.com
How to deliver Powerpoint Presentations.pptx
"How to make and deliver dynamic presentations by making it more interactive to captivate your audience attention"
Your Skill Boost Masterclass: Strategies for Effective Upskilling
Your Skill Boost Masterclass: Strategies for Effective UpskillingExcellence Foundation for South Sudan
Strategies for Effective Upskilling is a presentation by Chinwendu Peace in a Your Skill Boost Masterclass organisation by the Excellence Foundation for South Sudan on 08th and 09th June 2024 from 1 PM to 3 PM on each day.RHEOLOGY Physical pharmaceutics-II notes for B.pharm 4th sem students
Physical pharmaceutics notes for B.pharm students
Chapter wise All Notes of First year Basic Civil Engineering.pptx
Chapter wise All Notes of First year Basic Civil Engineering
Syllabus
Chapter-1
Introduction to objective, scope and outcome the subject
Chapter 2
Introduction: Scope and Specialization of Civil Engineering, Role of civil Engineer in Society, Impact of infrastructural development on economy of country.
Chapter 3
Surveying: Object Principles & Types of Surveying; Site Plans, Plans & Maps; Scales & Unit of different Measurements.
Linear Measurements: Instruments used. Linear Measurement by Tape, Ranging out Survey Lines and overcoming Obstructions; Measurements on sloping ground; Tape corrections, conventional symbols. Angular Measurements: Instruments used; Introduction to Compass Surveying, Bearings and Longitude & Latitude of a Line, Introduction to total station.
Levelling: Instrument used Object of levelling, Methods of levelling in brief, and Contour maps.
Chapter 4
Buildings: Selection of site for Buildings, Layout of Building Plan, Types of buildings, Plinth area, carpet area, floor space index, Introduction to building byelaws, concept of sun light & ventilation. Components of Buildings & their functions, Basic concept of R.C.C., Introduction to types of foundation
Chapter 5
Transportation: Introduction to Transportation Engineering; Traffic and Road Safety: Types and Characteristics of Various Modes of Transportation; Various Road Traffic Signs, Causes of Accidents and Road Safety Measures.
Chapter 6
Environmental Engineering: Environmental Pollution, Environmental Acts and Regulations, Functional Concepts of Ecology, Basics of Species, Biodiversity, Ecosystem, Hydrological Cycle; Chemical Cycles: Carbon, Nitrogen & Phosphorus; Energy Flow in Ecosystems.
Water Pollution: Water Quality standards, Introduction to Treatment & Disposal of Waste Water. Reuse and Saving of Water, Rain Water Harvesting. Solid Waste Management: Classification of Solid Waste, Collection, Transportation and Disposal of Solid. Recycling of Solid Waste: Energy Recovery, Sanitary Landfill, On-Site Sanitation. Air & Noise Pollution: Primary and Secondary air pollutants, Harmful effects of Air Pollution, Control of Air Pollution. . Noise Pollution Harmful Effects of noise pollution, control of noise pollution, Global warming & Climate Change, Ozone depletion, Greenhouse effect
Text Books:
1. Palancharmy, Basic Civil Engineering, McGraw Hill publishers.
2. Satheesh Gopi, Basic Civil Engineering, Pearson Publishers.
3. Ketki Rangwala Dalal, Essentials of Civil Engineering, Charotar Publishing House.
4. BCP, Surveying volume 1
Walmart Business+ and Spark Good for Nonprofits.pdf
"Learn about all the ways Walmart supports nonprofit organizations.
You will hear from Liz Willett, the Head of Nonprofits, and hear about what Walmart is doing to help nonprofits, including Walmart Business and Spark Good. Walmart Business+ is a new offer for nonprofits that offers discounts and also streamlines nonprofits order and expense tracking, saving time and money.
The webinar may also give some examples on how nonprofits can best leverage Walmart Business+.
The event will cover the following::
Walmart Business + (https://business.walmart.com/plus) is a new shopping experience for nonprofits, schools, and local business customers that connects an exclusive online shopping experience to stores. Benefits include free delivery and shipping, a 'Spend Analytics” feature, special discounts, deals and tax-exempt shopping.
Special TechSoup offer for a free 180 days membership, and up to $150 in discounts on eligible orders.
Spark Good (walmart.com/sparkgood) is a charitable platform that enables nonprofits to receive donations directly from customers and associates.
Answers about how you can do more with Walmart!"
BÀI TẬP DẠY THÊM TIẾNG ANH LỚP 7 CẢ NĂM FRIENDS PLUS SÁCH CHÂN TRỜI SÁNG TẠO ...
BÀI TẬP DẠY THÊM TIẾNG ANH LỚP 7 CẢ NĂM FRIENDS PLUS SÁCH CHÂN TRỜI SÁNG TẠO ...Nguyen Thanh Tu Collection
https://app.box.com/s/qhtvq32h4ybf9t49ku85x0n3xl4jhr15Beyond Degrees - Empowering the Workforce in the Context of Skills-First.pptx
Iván Bornacelly, Policy Analyst at the OECD Centre for Skills, OECD, presents at the webinar 'Tackling job market gaps with a skills-first approach' on 12 June 2024
BBR 2024 Summer Sessions Interview Training
Qualitative research interview training by Professor Katrina Pritchard and Dr Helen Williams
Recently uploaded (20)
Liberal Approach to the Study of Indian Politics.pdf
Liberal Approach to the Study of Indian Politics.pdf
LAND USE LAND COVER AND NDVI OF MIRZAPUR DISTRICT, UP
LAND USE LAND COVER AND NDVI OF MIRZAPUR DISTRICT, UP
Constructing Your Course Container for Effective Communication
Constructing Your Course Container for Effective Communication
Your Skill Boost Masterclass: Strategies for Effective Upskilling
Your Skill Boost Masterclass: Strategies for Effective Upskilling
RHEOLOGY Physical pharmaceutics-II notes for B.pharm 4th sem students
RHEOLOGY Physical pharmaceutics-II notes for B.pharm 4th sem students
Chapter wise All Notes of First year Basic Civil Engineering.pptx
Chapter wise All Notes of First year Basic Civil Engineering.pptx
Walmart Business+ and Spark Good for Nonprofits.pdf
Walmart Business+ and Spark Good for Nonprofits.pdf
BÀI TẬP DẠY THÊM TIẾNG ANH LỚP 7 CẢ NĂM FRIENDS PLUS SÁCH CHÂN TRỜI SÁNG TẠO ...
BÀI TẬP DẠY THÊM TIẾNG ANH LỚP 7 CẢ NĂM FRIENDS PLUS SÁCH CHÂN TRỜI SÁNG TẠO ...
Beyond Degrees - Empowering the Workforce in the Context of Skills-First.pptx
Beyond Degrees - Empowering the Workforce in the Context of Skills-First.pptx
B. Ed Syllabus for babasaheb ambedkar education university.pdf
B. Ed Syllabus for babasaheb ambedkar education university.pdf
1. How does CO2 and other greenhouse gases promote global warmin
- 1. 1. How does CO2 and other greenhouse gases promote global warming? Discuss your opinion on the use of geoengineering measures to mitigate the effects of global warming. Your response should be at least 250 words in length. 2. How does CO2 and other greenhouse gases promote global warming? Discuss your opinion on the use of geoengineering measures to mitigate the effects of global warming. Your response should be at least 250 words in length. Raw DataNamePayResponsibilitiesSupervisionGenderDepartmentRud olph211MaleAccountingOlga211FemaleAccountingInstructions Ernest211MaleAccountingEmily211FemaleAccountingThe sheet labeled "Raw Data" lists 366 employees and their rating (1-5) of their satisfaction with their Pay, Responsibilities, and Supervision. A rating of 5 is the highest satisfaction.Bobby211MaleAccountingRaw Data also includes the Gender and Department for each employee.Benjamin211MaleAccountingBeatrice211FemaleAcco untingInsert a new column in EKeith211MaleAccountingLabel this new column "Overall Satisfaction Rating"Hilda211FemaleAccountingFor each employee, compute the Overall Satisfaction Rating as the Average of Pay, Responsibilities, and Supervision.Leslie311MaleAccountingFormat Overall Satisfaction Rating to one decimal
- 2. place.Curtis311MaleAccountingAlice311FemaleAccountingOn a New sheet titled Results, create a Pivot Chart & Pivot TableSophie311FemaleAccountingAssign Gender to Columns, Department to rows, and Pay to Values. Change the value field setting from Sum to Average if necessary.Sally311FemaleAccountingSort the departments in descending order of satisfaction.Melvin311MaleAccountingCreate a title for the chart, which includes your last namePearl411FemaleAccountingBe sure your chart includes a legend for male & female employees, change male color to blue and female to orangeJohnny411MaleAccountingBe sure to include axis titlesEunice411FemaleAccountingFormat the vertical axis for a max of 5 and major tick marks at 1 and one decimal place.Opal212FemaleAccountingJulia212FemaleAccountingCre ate a new sheet titled "Graphs".Jimmie212MaleAccountingCopy & Paste as Picture your graph of Pay SatisfactionEsther212FemaleAccountingAlbert212MaleAccounti ngAlter your Pivot chart/table to display Responsibilities Satisfaction. Change titles as needed.Mike212MaleAccountingPaste this chart on the Graphs sheetMarion212MaleAccountingJosephine212FemaleAccounting Alter your Pivot chart/table to display Supervision Satisfaction. Change titles as needed.Ida212FemaleAccountingPaste this chart on the Graphs sheetGerald212MaleAccountingCaroline212FemaleAccountingA lter your Pivot chart/table to display Overall Satisfaction. Change titles as needed.Alberta212FemaleAccountingPaste this chart on the Graphs sheetLeroy312MaleAccountingLeave Results sheet with the Pivot Table & Chart displaying the Overall Satisfaction.Anita312FemaleAccountingMildred412FemaleAcco untingBeulah412FemaleAccountingAda412FemaleAccountingCl ayton212MaleAccountingWayne312MaleAccountingMarie412Fe maleAccountingLula412FemaleAccountingHarriet412Female Ac
- 6. ChainInez432FemaleSupply ChainCarol432FemaleSupply ChainMiriam433FemaleSupply ChainJennie433FemaleSupply ChainWilbert434MaleSupply ChainHubert434MaleSupply ChainVelma434FemaleSupply ChainMaxine434FemaleSupply ChainSara534FemaleSupply ChainEva442FemaleSupply ChainJean442FemaleSupply ChainClaire442FemaleSupply ChainMax542MaleSupply ChainMamie542FemaleSupply ChainAgnes443FemaleSupply ChainStella443FemaleSupply ChainClara443FemaleSupply ChainOrville543MaleSupply ChainMerle543MaleSupply ChainHarvey543MaleSupply ChainCharlie543MaleSupply ChainBonnie543FemaleSupply ChainDonna444FemaleSupply ChainBarbara444FemaleSupply ChainTheodore444MaleSupply ChainLois444FemaleSupply ChainEmil544MaleSupply ChainMabel545FemaleSupply ChainEarnest545MaleSupply ChainLucy545FemaleSupply ChainLeon545MaleSupply ChainRoberta452FemaleSupply ChainLowell552MaleSupply ChainIra453MaleSupply ChainGlen453MaleSupply ChainJim453MaleSupply ChainEileen453FemaleSupply ChainIrving553MaleSupply ChainElmer553MaleSupply ChainBernard553MaleSupply ChainAnna553FemaleSupply ChainLouis553MaleSupply ChainBetty553FemaleSupply ChainElizabeth553FemaleSupply ChainRoland454MaleSupply ChainEdward454MaleSupply ChainBessie454FemaleSupply ChainJohn454MaleSupply ChainRaymond454MaleSupply ChainTom555MaleSupply ChainArlene555FemaleSupply ChainBeverly555FemaleSupply ChainPeggy555FemaleSupply ChainJack555MaleSupply ChainEdith555FemaleSupply ChainNaomi555FemaleSupply ChainHelen555FemaleSupply Chain InstructionsInstructionsHintThe sheet labeled "Raw Data" lists 366 employees and their rating (1-5) of their satisfaction with their Pay, Responsibilities, and Supervision. A rating of 5 is the highest satisfaction.Raw Data also includes the Gender and Department for each employee.Insert a new column in EInsertLabel this new column "Overall Satisfaction Rating"Data entryFor each employee, compute the Overall
- 7. Satisfaction Rating as the Average of Pay, Responsibilities, and Supervision.=average()Format Overall Satisfaction Rating to one decimal place.FormatOn a New sheet titled Results, create a Pivot Chart & Pivot TablePivot Chart & Pivot TableAssign Gender to Columns, Department to rows, and Pay to Values. Change the value field setting from Sum to Average if necessary.Field ListSort the departments in descending order of satisfaction.SortCreate a title for the chart, which includes your last nameChart ElementsBe sure your chart includes a legend for male & female employees, change male color to blue and female to orangeChart ElementsBe sure to include axis titlesChart ElementsFormat the vertical axis for a max of 5 and major tick marks at 1 and one decimal place.Format AxisCreate a new sheet titled "Graphs".Copy & Paste as Picture your graph of Pay SatisfactionCopy - Paste Special (Picture)Alter your Pivot chart/table to display Responsibilities Satisfaction. Change titles as needed.Field ListPaste this chart on the Graphs sheetAlter your Pivot chart/table to display Supervision Satisfaction. Change titles as needed.Paste this chart on the Graphs sheetAlter your Pivot chart/table to display Overall Satisfaction. Change titles as needed.Paste this chart on the Graphs sheetLeave Results sheet with the Pivot Table & Chart displaying the Overall Satisfaction.Your Graphs Page should look as shown below.Does there appear to be a difference in satisfaction level in Dept or Area for males vs females?Answer here?Which department has the highest overall satisfaction level rating?Answer here?If the Human Resources department is trying to raise their own department's overall satisfaction rating, which area should they address?Answer here?Besides Engineering, which department is most satisfied with their supervisors?Answer here?