Presentation on leishmaniasis


Published on

Published in: Health & Medicine
  • Be the first to comment

No Downloads
Total views
On SlideShare
From Embeds
Number of Embeds
Embeds 0
No embeds

No notes for slide

Presentation on leishmaniasis

  1. 1. <ul><li>“ PCR for diagnosis and characterization of Leishmania in clinical samples from Kala Azar and Post Kala-azar Dermal Leishmaniasis patients ” </li></ul><ul><li>At </li></ul><ul><li>National institute of Pathology, Safdarjung Hospital Campus ,New delhi </li></ul><ul><li>  </li></ul><ul><li>Submitted by :- </li></ul><ul><li>Upma Gandhi </li></ul><ul><li>7251616222 </li></ul><ul><li> biotech </li></ul>
  2. 2. <ul><li>Institute of Pathology, New delhi is a premier research institute which was established in 1965 under ICMR. Its areas of reasearch are. </li></ul><ul><li>1. Metabolic syndromes(diabetes,obesity), chronic diseases biology fibrosis liver/ lung/) </li></ul><ul><li>2. Idiopathic skin diseases (Breast Cancer, </li></ul><ul><li>Lymphoma, </li></ul><ul><li>3.infectiousdiseases(Tuberculosis,Leishmaniasis,) </li></ul><ul><li> stem cell biology </li></ul><ul><li>5. environmental toxicology . </li></ul><ul><li>I </li></ul>
  3. 3. <ul><li>Leishmaniasis is a protozoan parasitic disease transmitted by the bite of sand flies. </li></ul><ul><li>Endemic in more than 88 countries and affecting 12 million people worldwide. </li></ul><ul><li>The majority of human cases occur in a small number of countries: </li></ul><ul><li>90% of visceral leishmaniasis cases occur in parts of India, Bangladesh, Nepal, Sudan, Ethiopia and Brazil </li></ul><ul><li>90% of cutaneous leishmaniasis cases occur in parts of Afghanistan, Algeria, Iran, Saudi Arabia, Syria, Brazil, Colombia, Peru and Bolivia  </li></ul>
  4. 4. <ul><li>Three main forms of Leishmaniasis </li></ul><ul><li>Cutaneous : affects the skin and mucus membranes. Skin sores usually start at the site of the sandfly bite. </li></ul><ul><li>Visceral : involving liver, spleen, and bone marrow </li></ul><ul><li>Mucocutaneous :involvingmucous membranes of the mouth and nose after spread from a nearby cutaneous lesion (very rare) </li></ul>
  5. 5. <ul><li>Phylum </li></ul><ul><li>Order </li></ul><ul><li>Family </li></ul><ul><li>Genus </li></ul><ul><li>Sarcomastigophora </li></ul><ul><li>Kinetoplastida </li></ul><ul><li>Trypanosomatidae </li></ul><ul><li>Leishmania </li></ul>
  6. 6. <ul><li>In India, states of Bihar, Uttar Pradesh and West Bengal are highly endemic foci of Kala azar where periodic epidemics are common. </li></ul><ul><li>The most common type of Leishmaniasis present in india is Visceral leishmaniasis or kala azar and Post kala azar dermal leishmaniasis. </li></ul>
  7. 7. <ul><li>Visceral leishmaniasis, also known in Asia as ' black fever/ 'kala azar', It is characterized by:- </li></ul><ul><li>1. Irregular fever, </li></ul><ul><li>2. Loss of weight, </li></ul><ul><li>3.Splenomegaly, </li></ul><ul><li>4.Hepatomegaly </li></ul><ul><li>5. Thrombocytopenia. </li></ul><ul><li>VL is caused by L. donovani in the Indian subcontinent </li></ul><ul><li>in East Africa, by L. infantum </li></ul><ul><li>L. chagasi in the in Brazil, Peru and Paraguay </li></ul>
  8. 8. <ul><li>Post kala-azar dermal leishmaniasis (PKDL) is a dermatosis, caused as a sequel to KA. </li></ul><ul><li>Characterized by a macular, maculopapular and nodular rash in a patient who has recovered from VL and is otherwise well </li></ul><ul><li>PKDL is also caused by L. donovani </li></ul>
  9. 10. <ul><li>These include: </li></ul><ul><li>Meglumine antimonate </li></ul><ul><li>Sodium stibogluconate </li></ul><ul><li>Other drugs that may be used include: </li></ul><ul><li>Amphotericin B </li></ul><ul><li>Fluconazole </li></ul><ul><li>Pentamidine </li></ul><ul><li>A. Plastic surgery may be needed to correct the disfigurement caused by sores on the face (Cutaneous Leishmaniasis). </li></ul><ul><li>B. Patients with drug-resistant viral Leishmaniasis may need to have their spleen removed (splenectomy). </li></ul>
  10. 11. <ul><li>As the symptoms of Leishmaniasis can vary and may be confused with other etiologic agents, diagnostic confirmation of the parasite is mandatory. </li></ul><ul><li>Methods of diagnosis of Leishmaniasis </li></ul><ul><li>1. Microscopy </li></ul><ul><li>2. Culture </li></ul><ul><li>3. Serodiagnosis (IFAT, ELISA ,DAT) </li></ul><ul><li>4. PCR ( polymerase Chain reaction ) </li></ul>
  11. 12. <ul><li>  </li></ul><ul><li>PCR will be used as a sensitive and specific technique for diagnosis of KA and PKDL. </li></ul><ul><li>PCR-RFLP assay based on internal transcribed spacer-1 (ITS-1) and PCR based on Kinetoplast DNA (kDNA) will be applied for diagnosis and species identification of parasite. </li></ul>
  12. 14. <ul><li>Leishmania spp . parasites will be used for this study. </li></ul><ul><li>Promastigotes will be cultured at 26  C in M199 medium with 25mM HEPES (pH7.4) supplemented with 10% FBS, 100 IU and 100  g/ml each of penicillin G and streptomycin, respectively. </li></ul>
  13. 15. <ul><li>Blood sample will be collected from KA </li></ul><ul><li>patient in heparinized tubes. Skin scrapings </li></ul><ul><li>were collected in NET buffer from PKDL </li></ul><ul><li>Patients. (150mM NaCl, 15mM Tris- HCl </li></ul><ul><li>[pH 8.30], 1mM EDTA). Then DNA isolation is </li></ul><ul><li>done using QIAamp DNA blood minikit </li></ul><ul><li>(Qiagen). </li></ul>
  14. 16. <ul><li>  </li></ul>
  15. 18. <ul><li>Template DNA (genomic, plasmid, cosmid, bacterial/yeast colony, etc.) </li></ul><ul><li>Gene Specific Primers :( Leishmania donovani specific primers, Salotra et al, JCM 2001) </li></ul><ul><li>Forward Primer-5`CTGGATCATTTTCCGATG3’ </li></ul><ul><li>Reverse Primer- 5`TGCATACCACTTATCGCACT 3’ </li></ul><ul><li>Buffer (usually 10X supplied along with Taq polymerase) </li></ul><ul><li>MgCl 2 (1.5 mM) </li></ul><ul><li>Taq DNA polymerase (1.25 Units) </li></ul><ul><li>dNTPs (2.5 mM stock ) </li></ul>
  16. 19. <ul><li>All the components Template DNA, </li></ul><ul><li>Forward Primer, Reverse Primer,Buffer 10X </li></ul><ul><li>MgCl 2, Taq DNA polymerase and dNTPs </li></ul><ul><li>A master mix is prepared with all the </li></ul><ul><li>components of PCR reaction. </li></ul><ul><li>24μL of the master mix is added into all aliquots , then DNA sample is added , mixed properly & centrifuged </li></ul>
  17. 20. <ul><li>PCR conditions- 40 cycles of </li></ul><ul><li>  </li></ul><ul><li>Denaturation : 95°C for 4 min, </li></ul><ul><li>Annealing : 95°C for 20 sec, </li></ul><ul><li>Extension : 53°C for 30 sec </li></ul><ul><li>Initial Denaturation : 72°C for 1 min </li></ul><ul><li>Final extension : 72°C for 3 min </li></ul><ul><li>  </li></ul>
  18. 23. <ul><li>An excellent target for a sensitive and rapid detection method of Leishmania donovani is the Kinetoplast DNA PCR. It can detect DNA upto conc. of 1 fg </li></ul><ul><li>This DNA from cultured parasites (1 ng) and from KA and PKDL patients will be taken for amplification using KDNA specific primers </li></ul>
  19. 24. <ul><li>Template DNA (genomic, plasmid, cosmid, bacterial/yeast colony, etc.) </li></ul><ul><li>Gene Specific Primers :( Leishmania donovani specific primers, Salotra et al, JCM 2001) </li></ul><ul><li>Forward Primer-5`-CTGGATCATTTTCCGATG-3’ </li></ul><ul><li>Reverse Primer- 5`-TGCATACCACTTATCGCACTT -3’ </li></ul><ul><li>Buffer (usually 10X supplied along with Taq polymerase) </li></ul><ul><li>MgCl 2 (1.5 mM) </li></ul><ul><li>Taq DNA polymerase (1.25 Units) </li></ul><ul><li>dNTPs (2.5 mM stock) </li></ul>
  20. 25. <ul><li>PCR conditions- 40 cycles of </li></ul><ul><li>Denaturation : 94°C for 1 min, </li></ul><ul><li>Annealing : 45°C for 30 sec, </li></ul><ul><li>Extension : 72°C for 60 sec </li></ul><ul><li>Initial Denaturation : 94°C for 2 min </li></ul><ul><li>Final extension : 72°C for 3 min </li></ul>
  21. 26. <ul><li>  </li></ul><ul><li>Detection and analysis of the reaction product </li></ul><ul><li>PCR product is loaded with 6X loading dye , along with appropriate molecular-weight markers which is 1Kb Ladder , onto an agarose gel (1 %) containing EtBr. DNA bands on the gel can then be visualized under ultraviolet trans-illumination. </li></ul>
  22. 27. <ul><li>Identification of Leishmania species in clinical material using ITS-1 PCR and restriction enzyme analysis was done. DNA (1ng) was subjected to pcr and analyzed. Lane1, 100bp ladder; lane 2 , L.donovani ; Lane 3, Sample DNA , Lane 4 L. tropica ; lane 5 L.major . </li></ul>
  23. 28. <ul><li>Identification of Leishmania species in clinical material using kDNA specific PCR was done. DNA (1ng) was subjected to PCR and analyzed. Lane1, 1kb ladder; Lane2 , L.donovani positiive control, lane 3, negative control ; lane 4, control blood; Lane 5 -8 KA sample. </li></ul>
  24. 29. <ul><li>Identification of Leishmania species in clinical samples using kDNA specific PCR was done. DNA (1ng) was subjected to PCR and analyzed. Lane1, 1kb ladder; lane 2, L.donovani positive control; Lane 3, negative control Lane 4 -6 PKDL sample </li></ul>
  25. 30. <ul><li>Current diagnostic methods based on parasite </li></ul><ul><li>detection are invasive and have poor sensitivity, </li></ul><ul><li>while immunological methods have limited specificity, </li></ul><ul><li>This method is rapid and reproducible, it can be used for the reliable identification and characterization of cultured parasites. </li></ul><ul><li>The test has other potential values in detecting and typing parasites in vectors for epidemiological surveys </li></ul>