Your SlideShare is downloading. ×
Presentation  on leishmaniasis
Upcoming SlideShare
Loading in...5
×

Thanks for flagging this SlideShare!

Oops! An error has occurred.

×

Saving this for later?

Get the SlideShare app to save on your phone or tablet. Read anywhere, anytime - even offline.

Text the download link to your phone

Standard text messaging rates apply

Presentation on leishmaniasis

3,319
views

Published on

Published in: Health & Medicine

0 Comments
1 Like
Statistics
Notes
  • Be the first to comment

No Downloads
Views
Total Views
3,319
On Slideshare
0
From Embeds
0
Number of Embeds
0
Actions
Shares
0
Downloads
155
Comments
0
Likes
1
Embeds 0
No embeds

Report content
Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
No notes for slide

Transcript

  • 1.
    • “ PCR for diagnosis and characterization of Leishmania in clinical samples from Kala Azar and Post Kala-azar Dermal Leishmaniasis patients ”
    • At
    • National institute of Pathology, Safdarjung Hospital Campus ,New delhi
    •  
    • Submitted by :-
    • Upma Gandhi
    • 7251616222
    • B.tech biotech
  • 2.
    • Institute of Pathology, New delhi is a premier research institute which was established in 1965 under ICMR. Its areas of reasearch are.
    • 1. Metabolic syndromes(diabetes,obesity), chronic diseases biology fibrosis liver/ lung/)
    • 2. Idiopathic skin diseases (Breast Cancer,
    • Lymphoma,
    • 3.infectiousdiseases(Tuberculosis,Leishmaniasis,)
    • 4.adult stem cell biology
    • 5. environmental toxicology .
    • I
  • 3.
    • Leishmaniasis is a protozoan parasitic disease transmitted by the bite of sand flies.
    • Endemic in more than 88 countries and affecting 12 million people worldwide.
    • The majority of human cases occur in a small number of countries:
    • 90% of visceral leishmaniasis cases occur in parts of India, Bangladesh, Nepal, Sudan, Ethiopia and Brazil
    • 90% of cutaneous leishmaniasis cases occur in parts of Afghanistan, Algeria, Iran, Saudi Arabia, Syria, Brazil, Colombia, Peru and Bolivia 
  • 4.
    • Three main forms of Leishmaniasis
    • Cutaneous : affects the skin and mucus membranes. Skin sores usually start at the site of the sandfly bite.
    • Visceral : involving liver, spleen, and bone marrow
    • Mucocutaneous :involvingmucous membranes of the mouth and nose after spread from a nearby cutaneous lesion (very rare)
  • 5.
    • Phylum
    • Order
    • Family
    • Genus
    • Sarcomastigophora
    • Kinetoplastida
    • Trypanosomatidae
    • Leishmania
  • 6.
    • In India, states of Bihar, Uttar Pradesh and West Bengal are highly endemic foci of Kala azar where periodic epidemics are common.
    • The most common type of Leishmaniasis present in india is Visceral leishmaniasis or kala azar and Post kala azar dermal leishmaniasis.
  • 7.
    • Visceral leishmaniasis, also known in Asia as ' black fever/ 'kala azar', It is characterized by:-
    • 1. Irregular fever,
    • 2. Loss of weight,
    • 3.Splenomegaly,
    • 4.Hepatomegaly
    • 5. Thrombocytopenia.
    • VL is caused by L. donovani in the Indian subcontinent
    • in East Africa, by L. infantum
    • L. chagasi in the in Brazil, Peru and Paraguay
  • 8.
    • Post kala-azar dermal leishmaniasis (PKDL) is a dermatosis, caused as a sequel to KA.
    • Characterized by a macular, maculopapular and nodular rash in a patient who has recovered from VL and is otherwise well
    • PKDL is also caused by L. donovani
  • 9.  
  • 10.
    • These include:
    • Meglumine antimonate
    • Sodium stibogluconate
    • Other drugs that may be used include:
    • Amphotericin B
    • Fluconazole
    • Pentamidine
    • A. Plastic surgery may be needed to correct the disfigurement caused by sores on the face (Cutaneous Leishmaniasis).
    • B. Patients with drug-resistant viral Leishmaniasis may need to have their spleen removed (splenectomy).
  • 11.
    • As the symptoms of Leishmaniasis can vary and may be confused with other etiologic agents, diagnostic confirmation of the parasite is mandatory.
    • Methods of diagnosis of Leishmaniasis
    • 1. Microscopy
    • 2. Culture
    • 3. Serodiagnosis (IFAT, ELISA ,DAT)
    • 4. PCR ( polymerase Chain reaction )
  • 12.
    •  
    • PCR will be used as a sensitive and specific technique for diagnosis of KA and PKDL.
    • PCR-RFLP assay based on internal transcribed spacer-1 (ITS-1) and PCR based on Kinetoplast DNA (kDNA) will be applied for diagnosis and species identification of parasite.
  • 13.  
  • 14.
    • Leishmania spp . parasites will be used for this study.
    • Promastigotes will be cultured at 26  C in M199 medium with 25mM HEPES (pH7.4) supplemented with 10% FBS, 100 IU and 100  g/ml each of penicillin G and streptomycin, respectively.
  • 15.
    • Blood sample will be collected from KA
    • patient in heparinized tubes. Skin scrapings
    • were collected in NET buffer from PKDL
    • Patients. (150mM NaCl, 15mM Tris- HCl
    • [pH 8.30], 1mM EDTA). Then DNA isolation is
    • done using QIAamp DNA blood minikit
    • (Qiagen).
  • 16.
    •  
  • 17.  
  • 18.
    • Template DNA (genomic, plasmid, cosmid, bacterial/yeast colony, etc.)
    • Gene Specific Primers :( Leishmania donovani specific primers, Salotra et al, JCM 2001)
    • Forward Primer-5`CTGGATCATTTTCCGATG3’
    • Reverse Primer- 5`TGCATACCACTTATCGCACT 3’
    • Buffer (usually 10X supplied along with Taq polymerase)
    • MgCl 2 (1.5 mM)
    • Taq DNA polymerase (1.25 Units)
    • dNTPs (2.5 mM stock )
  • 19.
    • All the components Template DNA,
    • Forward Primer, Reverse Primer,Buffer 10X
    • MgCl 2, Taq DNA polymerase and dNTPs
    • A master mix is prepared with all the
    • components of PCR reaction.
    • 24μL of the master mix is added into all aliquots , then DNA sample is added , mixed properly & centrifuged
  • 20.
    • PCR conditions- 40 cycles of
    •  
    • Denaturation : 95°C for 4 min,
    • Annealing : 95°C for 20 sec,
    • Extension : 53°C for 30 sec
    • Initial Denaturation : 72°C for 1 min
    • Final extension : 72°C for 3 min
    •  
  • 21.  
  • 22.  
  • 23.
    • An excellent target for a sensitive and rapid detection method of Leishmania donovani is the Kinetoplast DNA PCR. It can detect DNA upto conc. of 1 fg
    • This DNA from cultured parasites (1 ng) and from KA and PKDL patients will be taken for amplification using KDNA specific primers
  • 24.
    • Template DNA (genomic, plasmid, cosmid, bacterial/yeast colony, etc.)
    • Gene Specific Primers :( Leishmania donovani specific primers, Salotra et al, JCM 2001)
    • Forward Primer-5`-CTGGATCATTTTCCGATG-3’
    • Reverse Primer- 5`-TGCATACCACTTATCGCACTT -3’
    • Buffer (usually 10X supplied along with Taq polymerase)
    • MgCl 2 (1.5 mM)
    • Taq DNA polymerase (1.25 Units)
    • dNTPs (2.5 mM stock)
  • 25.
    • PCR conditions- 40 cycles of
    • Denaturation : 94°C for 1 min,
    • Annealing : 45°C for 30 sec,
    • Extension : 72°C for 60 sec
    • Initial Denaturation : 94°C for 2 min
    • Final extension : 72°C for 3 min
  • 26.
    •  
    • Detection and analysis of the reaction product
    • PCR product is loaded with 6X loading dye , along with appropriate molecular-weight markers which is 1Kb Ladder , onto an agarose gel (1 %) containing EtBr. DNA bands on the gel can then be visualized under ultraviolet trans-illumination.
  • 27.
    • Identification of Leishmania species in clinical material using ITS-1 PCR and restriction enzyme analysis was done. DNA (1ng) was subjected to pcr and analyzed. Lane1, 100bp ladder; lane 2 , L.donovani ; Lane 3, Sample DNA , Lane 4 L. tropica ; lane 5 L.major .
  • 28.
    • Identification of Leishmania species in clinical material using kDNA specific PCR was done. DNA (1ng) was subjected to PCR and analyzed. Lane1, 1kb ladder; Lane2 , L.donovani positiive control, lane 3, negative control ; lane 4, control blood; Lane 5 -8 KA sample.
  • 29.
    • Identification of Leishmania species in clinical samples using kDNA specific PCR was done. DNA (1ng) was subjected to PCR and analyzed. Lane1, 1kb ladder; lane 2, L.donovani positive control; Lane 3, negative control Lane 4 -6 PKDL sample
  • 30.
    • Current diagnostic methods based on parasite
    • detection are invasive and have poor sensitivity,
    • while immunological methods have limited specificity,
    • This method is rapid and reproducible, it can be used for the reliable identification and characterization of cultured parasites.
    • The test has other potential values in detecting and typing parasites in vectors for epidemiological surveys
  • 31.