• Like
  • Save
Gutell 041.nar.1994.22.03502
Upcoming SlideShare
Loading in...5
×
 

Gutell 041.nar.1994.22.03502

on

  • 221 views

 

Statistics

Views

Total Views
221
Views on SlideShare
221
Embed Views
0

Actions

Likes
0
Downloads
0
Comments
0

0 Embeds 0

No embeds

Accessibility

Categories

Upload Details

Uploaded via as Adobe PDF

Usage Rights

© All Rights Reserved

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Processing…
Post Comment
Edit your comment

    Gutell 041.nar.1994.22.03502 Gutell 041.nar.1994.22.03502 Document Transcript

    • 3502 -3507 Nucleic Acids Research, 1994, Vol. 22, No. 17Collection of small subunit (16S- and 16S-like) ribosomalRNA structures: 1994Robin R.GutellMCB Biology, Campus Box 347, University of Colorado, Boulder, CO 80309-0347, USAABSTRACTA collection of diverse 16S and 1 6S-like rRNAsecondary structure diagrams are available. This setof rRNAs contains representative structures from all ofthe major phylogenetic groupings Archaea,(eu)Bacteria, and the nucleus, mitochondrion, andchloroplast of Eucarya. Within this broad phylogeneticsampling are examples of the major forms of structuraldiversity currently known for this class of rRNAs. Thesestructure diagrams are available online through ourcomputer-network WWW server and anonymous ftp, aswell as from the author in hardcopy format.INTRODUCTIONComparative structure analysis of 16S rRNA has progressed forthe past 15 years. Initially with a minimal number of sequencesand a simpler perception of comparative analysis, a secondarystructure common to the few 16S and 16S-like rRNA sequenceswas proposed (reviewed in 1,2.). Since then, the number ofpublicly available and complete (or nearly complete) 16S and16S-like rRNA sequences has increased most dramatically. AsofJune 1994, this number is approximately 3,100 (see Table 1;Ribosomal RNA Database Project see article in this issue;RRG unpublished collection). In parallel with this pronouncedincrease in 16S rRNA sequences, our comparative methods andinterpretation have evolved, resulting in a more detailed 16SrRNA secondary and tertiary structure (reviewed in 1).The details of the current secondary and tertiary structure for16S rRNA should not be considered final. While the vast majorityofthe proposed secondary and tertiary structure interactions areconsidered correct given their high degree of comparativeevidence, alterations in these structural elements are notanticipated. However, a small number of proposed interactionsare considered tentative, for these contain a minimal amount ofcomparative evidence and are thus candidates for secondarystructure adjustments in the future. Further refinement in 16SrRNA higher-order structure will also result from the analysisof a larger number of aligned sequences with improvedcorrelation analysis methods (3; Gautheret, Damberger, andGutell, mss. in preparation). These latter structural constraintsare likely to involve base triples, non-canonical pairings, andother structural elements more complex than simple secondarystructure base pairings.OBJECTIVESThe primary goals for this 16S rRNA database are to: (1) Presentthe most recent comparatively inferred secondary and tertiarystructure for 16S rRNA. Minor refinements in these structuresare expected, as we identify new (or alternative) secondary andtertiary interactions. (2) Offer a sampling of representative 16Sand 16S-like secondary structure diagrams. The initial selectionof structures are phylogenetically as well as structurally distinctfrom one another (see Table 2). Over time additional examplesofdiverse structures will be generated, as well as structures thatare closely related to members of this database. (3) Threedivergent 16S-like rRNA diagrams are presented here. They are:Haloferax volcanii, a representative Archaea (5, Figure 1);Phreatamoeba balamuthi, a lower Eucarya that contains severallarge insertions (6, Figure 2); and the Chiamvydomonas reinhardtiimitochondrion; a most bizarre rRNA that is coded for by afragmented rRNA gene (7, Figure 3).DATABASEThe higher-order structures described herein will be availableon-line or in hardcopy format from the author. On-line accessis by anonymous ftp or through the WWW (World Wide Web).These computer files will be distributed in PostScript format only.Our ftp address and directory are:pundit. colorado. edu (128.138.212.53)/pub/RNA/16SOur WWW server can be accessed by programs like XMOSAIC(see Damberger and Gutell, this issue), that navigate the WWW.With this system the secondary structures can be viewed andTable 1. Phylogenetic distribution of publicly available 16S and 16S-like rRNAsequences (as of June 1994)Organism type # 16S rRNAArchaea 120(Eu)Bacteria 2130Eucarya (nuclear) 700OrganellesMitochondrion 110Plastid 40TOTAL 31001994 Oxford University Press
    • Nucleic Acids Research, 1994, Vol. 22, No. 17 3503Table 2. List of currently available 16S and 16S-like rRNA secondary structure diagrams. Phylogenetic classification is based on Woeseet al. (4)ArchaeaEuryarchaeota Archaeoglobus fulgidus, Halobacterium marismortui (HC8),Halobacterium marismortui (HCIO), Haloferax volcanii,Methanobacterium formicicum,Methanospirillum hungatei, Methanococcus vannielli,Thennococcus celer,Thernoplasma acidophilumCrenarchaeota Pyrodictium occultum, Sulfolobus solfataricus, Thermoproteustenax(eu)BacteriaAquifecales Aquifex pyrophilusThermotoga Thermotoga maritima, Geotoga subterranea, Petrotoga miothermaDeinococcus and relatives Thernus thennophilusSpirochetes and relatives Borrelia burgdorferi, Leptonemna illini, Spirochaeta aurantiaPlanctomyces and relatives Planctomyces staleyi, Gemmata obscuriglobus-1, Gemniataobscuriglobus-2Green sulfur bacteria Chlorobium vibrioformeGreen non-sulfur bacter. Thermomicrobium roseumCytophaga-Flexi.-Bacter. Bacteroides fragilisPurple bacteria Agrobacterium tumefaciens, Pseudomonas testosteroni,Escherichia coli, Dichelobacter nodosus, Myxococcus xanthus,Desulfovibrio desulfuricans, Campylobacter sputorum subsp.sputorumCyanobacteria Synechococcus sp. 6301Gram-positive Heliobacterium chlorum, Arthrobacter globiformis, Frankia sp.,Streptomyces coelicolor, Bacillus subtilis, Epulopiscium sp. (strainAl), Clostriiwum innocuum, Mycoplasma hyopneumoniae,Mycoplasma gallisepticum, Mycoplasma capricolum,Eucarya (nuclear)Archezoa Hexamita, Giardia muris, Giardia ardeae, Giardia intestinalis,Encephalitozoon cunuculi, Vairimorpha necatrixProtoctista Phreatamoeba balamuthi, Babesia bigemina, Chlorella luteoviridis,Staurastrun - M752, Genicularia spirotaenia, Gracilariopsis sp.,Tritrichomonas foetusFungi Saccharomnyces cerevisiae, Cryptococcus neoformansPlantae Fragaria ananassa (strawberry)Animalia Drosophila melanogaster, Placopecten magellanicus, Xenopuslaevis, Mus musculus, Homo sapiensMitochondrionProtoctista Chlamnydomonas reinhardtii, Paramecium tetraulia, Tetrahymenapyriformis, Physarum polycephalumFungi Saccharomnyces cerevisiae, Aspergillus nidulansPlantae Zea mays (maize)Animalia Bos taurus (bovine), Ascaris suum, Caenorhabditis elegansChloroplastProtoctista Chlamydomonas reinhardtii, Chlorella vulgaris, Cryptomonas sp., Olisthodiscus luteus,Astasia longa, Euglena gracilis, Pylaiella littoralis, Cyanidium caldarium, Palmaria palmataPlantae Nicotiana tabacum (tobacco), Zea mays (maize), Marchantia polymorpha (liverwort)downloaded, while ftp access only supports downloading of thePostScript files. Our WWW URL address is:URL:http://pundit. colorado. edu:8080/RNA/16S/16s. htmlThe work presented here complements the effort of the RDP(Ribosomal Database Project, see this issue); Their objectivesare to generate and present various types of ribosomal RNA dataand interpretation. On-line access to the 16S rRNA secondarystructure PostScript files is also available from the RDPanonymous ftp site (rdp.life.uiuc.edu). Additional informationabout this server and access to the Ribosomal Database Projectis described in this special Database issue.The interactive graphics program XRNA (developed by BrynWeiser, UC Santa Cruz) facilitated the generation ofthe higher-order structure diagrams. Manual alignment of these 16S and16S-like rRNA sequences was facilitated with the interactivesequence alignment editor AE2 (developed by Tom Macke,Scripps Clinic).
    • 3504 Nucleic Acids Research, 1994, Vol. 22, No. 17UGUGU AA C-GC U ccC-GC AAAAUCC CCGAGGACA GAUGGCG u A G C u GAGA CCGGC ACA G ACGAGC CCGCA CUUCUAA UGC CAGCAGUUUUGAGGGGGCCUGCUGGA0 CGAAG111111 III 1111111 1.1 I II I I I IAUG GGCG C AGG. ACG CS0A UGCUCG GGGCAA GAAGAUU AUG GUCGUCAGAUGAG-C ~~~ ~~~~~~~G-CA C G G AC G GG-C G-C C A G AA-U A G U -A A CG-C ~~ ~~~~~~~GUG-C A UU -A AGAU AUGA C -G G GC-G U A C-~~~~~~~~~~~~cG U GA GGGo A A C G c CA GA A ~~~~A / UUC-G G$A oG G-C UGG AU GGC GG A c-AC / CG GUGA AAUG-C C -G /CAGAC G C-A G AG ACG A -UG AC~~~GA~~AG CA-U G A A uC-GUG-C UC-G G GUCGG-C UA Gu G-Cu G ~~UGU AGUGA /,UAG AG-CAACUGGCG UCCGGUGAA CCACGUGGC A G-C UU G-CGA-U AcG cA GC IIIIII111 *II I I II II I II 111 C/GG U-AGC GN A G AUCGACCGC GGGCUACUU GG GCACCG G //GUGA CGUG AGC,GA C C-GUC A AA Cc a AG CUGUA AcA UCc UAUAA G GG A A %G CGAuAAA UG CAGCC //,CG A UGA%GU UCUC GUaC u-GA ACCuA AG %GU c GGG GCUCGCUA C A C AGCCAC GGCA cA G~ UUAUCU%Acm GGC-a GA G CG CaU AAU GC UUGC Aa-CG G- AA GCG- ~~~G/G A A G CAAUGGC AA a-c CUC U. CACG UA U G AC ACUCUAU A AU GGAAUCCCG C-G AG CAGG a-C U A UUCC G-C GA UA C G~~-C U A11 A-U CUCAAAA G ~~C-a A UUCA UAGGAA G ACAAUGCUGC/lG AGAC-G UAAAAG AG UG GCC A~~~~~~~~~~~~~~UACACG-~GAGGCCa CUACA /C :C AGG G A~Cc ,u GGCU0AG AC A GIIUGGGGGGGCi*1AC1 A AGAACGC CU CG CAGCA UACUUAC UACaAA G C G UU CUUGCUCG AU AC CUCUCG UGaA UNII _UA U UG UAA;AU_I A AUl CCUCA C77G A.ACAG UCuG A CGUaG a A G*UuAGUCCUCGCAG u A C / UC GU G.CCU111 A 5U C-U G Au C A T~~~~~CAaAl AGUAAG Ga/A U~AAGUGCGUAAG GG -C UGCCUGG a/ UCAAG A ACCCuCACU A A AaU GAUA G UAC0G CG~~~~~UAC CA G-AGG G-C~~~~~~UAGC UGG U ACGGGUAG U UCCCCAA.A ~~~C.A a A A/ A c-C CG Ca- GAGU GC CA CGCCGU ucA- A A GAUUGGC AC UA A CGa-CG-CC/GCG GU A CCC// C UCAAG a ~~~~~G: A a aA CUjG GCU CGa GC -G GUACAGU 3A UU /GGGC GCCA CAAG CGG UGCUCAACGUAIC AUUC A-U 3UU,CCGGC GAA A CUUACGGUUG.GAGGc/ CUUCUA UGGCGC A AA A a AG /C A CCU/ CG A %C A U-A GG C-G U-AGCUACGGGUUU.G-aAAC CA C-a aCCa *UG a-Ca-C ACGC CUGU C GC C a-C Ca ACC-GAC aG: CAA U A-AAAU~ ~ CA AU UAGGC AGAGACCGU AUC8 CUUGA CGGAGUCAA A UAAUA UAa AGC CC-aC AC - Ua-CU UA AG aFIgur 1. Higher-order structure diagram for Haloferax vokcanii 16S rRNA (5). Different typs of secondary structure, basepairings are distinquished as follows:short lines connect canonical pairs (C:G, U:A), G:U pairs are denoted with dots, A:G pairings with larger open circles, and other non-canonical pairings with closedcircles. Terdary interactions are connected with thicker and longer solid lines. [Sequence Accession number is K00421].
    • Nucleic Acids Research, 1994, Vol. 22, No. 17 3505AU GAA AACUGAAUCC UACGGAAAGAUUA A GCGG I *IIIIIIIII * II AUGGGGA C GUGCCUUCAUAAU uA CGAU UG-CAAUUCCAACACCCGGUUUCAAGUUGAAUGGAAAGAAGGGUAUAUUAGUAU Gz CU-AUUAGRRGGAGCAAUCCUUUUAAGUAUUGRUGUAUCAGUUCACCGUUUAAC G-CUCCGGGGAAGGCUAUCCACUCUAAUGCCUUAUUCCCGCCAGGGCUCUUAA G ° AUUGAGUCUUGGAUAUACCACCCGGACCGAUAAGGAAUGGGGGGAAUAAGG G AACUAAAGGUUUACCUUGAACAAAUUAGAGUGAUUCAGGCAGGCUUUUUUA C-GAGCCCUUGAAUACAUUAGCAUGGGACAAACACAUCCCAAAAACAACCUGG GC AGUCGGGUGGCACCGGGGUUGGAGGUUUGAUAUGAGAGGAGAUUAUGAGUA A- UGGUGGUUAUGAUCAUUUGUGCAAUCAAAACUUAUAGUAGCCUCAAUGGUU C-GUCCGUUUGGUUUUCCUGAGGGGGCUCGGACUUGGUCAUCUGUAGGUAUUUC A- UAGGGGUGAUGGGCUCCGGUCUGUUAUUCCUGAGGUAUUCGGAUGAUUGAG G. UGGGUCUAACCAGCAAUGGUUAUAUUAUGAGUUUGUAUGAAUGAUUAU0AU -CURCUCUURUAGUCGAYAAAGACUUCACGUGUCGGGCUUUCAGUCUUAGGA ACCAUCCAUUAAGACUCAGUCGUUUUGGUUGUAGAAAUGCAAUCGAAACGUIUAAACCAAAIUAAIA UAAAAC UCA A UGC AGU UI I I II CCG UCA UG AA AUa AU GGUG G CACACCGACGGCCUGAUCGGGUGACCGAGAGGGUCGCACUUGUCUUAAUUCACAGUGCCCCGGAACUGAGGCUGUUCGACGUGGUAGGGGAGGACGCUGAAUGGGGCUGGUAGAAACAACUGGGGGUAUAAAACCAAGGAGGAAGCAAAAAAGCCAUAACCCGGCGAUGGCCUUGGUGGAAACCUCUG00CUCAAGGUUGUUAUUAUGUUYAUURUGGCCUCUCGGGGUUAUUUURAAUGURGUAAUAAACCGAAAGCAACUCUAUCAGUUUGGUUYGGAUGUCCGUUAAUCCUGCGUGGCCAGCGGCUUUGGGACUCCAGGGGACAGGGCGAAACGAGGCAAUUCAAAGCUGAUU Aa _UUUCYGUAGG UI I -I IGGAAGACGUCCAAUCAAAGCUUU3,I
    • 3506 Nucleic Acids Research, 1994, Vol. 22, No. 17CUAGUGC CG GUCUCc CCACAAU A C U0 U ccOAGG UAAUGAUCCGGAUGGAAAGGAAGCGA G CA .1 III II* * GUC A GA c GUGGCUAGGAGGCUUAUAAUG G-C A GAG AG-C ~~~~~~~~~~~~~~~~~~~~AAU-A G CU-A C GUA~~~~~~~~~~~~UUG-C AGA U0 cC A U G AGAA U U A AAUAU.-..AAAC0-C GUU .G 0-CAU -A C-G ucC-G c cU-ACA-U A A AUAA C A GCO UGA A 0 UU GG U A~~~~~~AAC5AAUAA U-A U"AAUAG_C~U- AUUUUAA AA A AGC/U cU UC A AUCAUU -ACG0 A ACACC-A A Lcc uA UA C 111111~ ~~~~CC0G AAc U UUAII c e u A-C0AA UG AAUCu A17G0 A U- A AA UUUCGUGG- 0GCAUC A-GG A C ~~~~~-UGGUCAAC-G U .111G A 0AG- AC U UAA- UA UCACA 0A UG CC- AC U AUA U U CAAAG- UA AC U* ACCC-0CAAGU U ACACAAGAGAUGUCAAUAAC-GGAGOUC UAUU A- U CAAAU 0U CA~C A GU.cU0 C- G 0 A ACCUGUUC UGU C-G A GGC .UGCUAUUGGAAUUUUACAAAC GC ACAC0-UAC GA ,U A~G U AUC A 0UGA-UAu uGU cA A_CGuACU AU A A G3-AAACAU 0CG A U/IAU Gj uUGGA 0- .C0 A0GC GAC AA G GAA GUG/UG A-UGCu.0GAC Ac u: 0GC/A C_GAUGAc C G ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~UUGGGGUAGGGAUC/ UCACGGCGGUCCAu u u 1~~~~.I1**~~ A A UA 1I*- liii C GACCUCOUCCA 0 cGu~~~~~~~~CGCUAGGUUGG A~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~AA CGAU GC u U C U 0 A cAA ~A U C -G U u CU AGUG U -A C C AU A C0 C C-G A A AU0G U A 0 C- G A A AU -A CC U G U A AG G ~ ~~~~A A-UU o A0-CA A U UGA U A-U A0U.0AUA A A C G0UCGA AUCUACGC-GU A A -G U G0 A0c A-U U A uAAGGGG~~A AA G Uz AU AG ~~~~AAA CACGCUU 0 A-U C GA lii 11U U -A 3 UAUAOGGUAAUAUU U0- A _AA UACGCUAAAACAUAUUAUUUAAU 0 U U-AAC IUUUI U G U CA./ o 3 A C 0U AA AC G3CGCu-Acu.GGCG c _U~~~~~C-CG//cGAU GAUACA-UUC / G GA AACC0 A 0 UAA C A 0 GA.Uu A C U GC C 0 A U UC AU-AA A A GcUAU Go-GU AC-GGU*ACC:.GuGA-UCUCC-C- G0-CAu 0 A C C- GA A A U *GC CG A U A CA CGCC 0u ~~~~U C UAAA GFigure 3. Higher-order structure diagram for Chlamydomonas reinhardtii mitochondrial 16S-like rRNA (7). Higher-order structure interactions illustrated and notedas in Fig. 1. [Sequence Accession number is X54860].Figure 2. Higher-order structure diagram for the Eucarya, Phreatamoeba balamuthi nucleocytoplasmic 16S-like rRNA (6). Higher-order structure interactions illustratedand noted as in Fig. 1. [Sequence acccession number is L23799].
    • Nucleic Acids Research, 1994, Vol. 22, No. 17 3507Research benefiting from the secondary structure diagrams inhardcopy format or from the online compendium should cite thisarticle.ACKNOWLEDGEMENTSI wish to thank Mr Simon Damberger for helping establish ourWWW server, the W.M.Keck Foundation for their generoussupport of RNA science on the Boulder campus, and SUNMicrosystems for their timely donation of computer equipment.The author is an Associate in the Program in EvolutionaryBiology of the Canadian Institute ofAdvanced Research. Thiswork was supported by the NIH (GM 48207).REFERENCES1. Gutell R.R., Larsen N., Woese C.R. (1994). Lessons from an EvolvingRibosomal RNA: 16S and 23S rRNA Structure from a ComparativePerspective. Microbiological Reviews. 58,10-26.2. Gutell R.R. (1993). Comparative Studies of RNA: Inferring Higher-OrderStructure from Patterns of Sequence Variation. Current Opinion in StructunalBiology. Section: Nucleic Acids. 3,313-322.3. Gutell R.R., Power A., Hertz G.J., Putz E.J., and Stormo G.D. (1992).Nucleic Acids Res. 20,5785-5795.4. Woese C.R., Kandler O., and Wheelis M.L. (1990). Towards a natural systemof organisms: Proposal for the domains Archaea, Bacteria, and Eucarya.Proc. Natl. Acad. Sci. USA 87,4576-4579.5. Gupta,R., Lanter,J.M. and Woese,C.R. (1983). Sequence of the 16Sribosomal RNA from Halobacteriwn volcanii, an archaebacterium. Science221, 656-659.6. Hinkle,G., Leipe,D.D., Nerad,T.A. and Sogin,M.L. (1994). The unusuallylong small subunit ribosomal RNA ofPhreamamoeba balanuwhi. Nucleic AcidsRes. 22, 465-469.7. Boer,P.H. and Gray,M.W. (1988). Scrambled ribosomal RNA gene piecesin Chlamydomonas reinhardtii mitochondrial DNA. Cell 55, 399-411.