Successfully reported this slideshow.

Future of Research Communication 2011

233 views

Published on

  • Be the first to comment

  • Be the first to like this

Future of Research Communication 2011

  1. 1. The Future of ResearchCommunicationJudith BlakeThe Jackson Laboratory
  2. 2. My PerspectiveFuture open access to digital data will speed discoveryData generation is getting easier, data analysis isgetting harder, we are drowning in dataKey to scientific discourse is the ability to reproduceand verify results - currently difficult for computationalresults that do not include code and data uponpublicationCurrent „academic‟ publication and rewards systemsare inadequate for measuring scientific contributionsDigital data repositories, open accesspublications, electronic journals, and semantic webenhancements will all contribute to the success offuture of science communications Rocky ISBC 12/8/11
  3. 3. Outline1. Improving knowledge communication - Vision: What are the communication functionalities needed? - Technology: What are the tools for doing this?2. Impacting our world - Social Aspects: How do we quantify impact of use/reward system? - Coolness: How do we make it attractive to do/ use?3. Overcoming obstacles -Financial Considerations: How do we make is sustainable? -Getting the ball rolling: How do we start? Rocky ISBC 12/8/11
  4. 4. “Where Computer ScientistsMeet”Elsevier, Wiley, ISI, (Highwire), PLoS, 14 Universities, European Commission, UKRoyal Society Rocky ISBC 12/8/11
  5. 5. The Reasoned Argument Rocky ISBC 12/8/11
  6. 6. Managing Biological Information is Nothing New Roxy Laybourne and others, photo by Chip Clark Rocky ISBC 12/8/11Bird Collections at the Smithsonian Natural History Museum
  7. 7. TCTCTCCCCCGCCCCCCAGGCTCCCCCGGTCGCTCTCCTCCGGCGGTCGCCCGCGCTCGGTGGATGTGGC From the birth of the field of genetics until a decade ago,TGGCAGCTGCCGCCCCCTCCCTCGCTCGCCGCCTGCTCTTCCTCGGCCCTCCGCCTCCTCCCCTCCTCCT it was generally assumedTCTCGTCTTCAGCCGCTCCTCTCGCCGCCGCCTCCACAGCCTGGGCCTCGCCGCGATGCCGGAGAAGAGG its function. In the vast that the parental origin of a gene could have no effect onCCCTTCGAGCGGCTGCCTGCCGATGTCTCCCCCATCAACTACAGCCTTTGCCTCAAGCCCGACTTGCTGG this paradigm has appeared majority of studies carried out during the last 90 years, to hold true. However, with increasingly sophisticated genetic and embryologicalACTTCACCTTCGAGGGCAAGCTGGAGGCCGCCGCCCAGGTGAGGCAGGCGACTAATCAGATTGTGATGAA investigations in the mouse, important exceptions to this rule have been uncoveredTTGTGCTGATATTGATATTATTACAGCTTCATATGCACCAGAAGGAGATGAAGAAATACATGCTACAGGA over the last decade. First, the results of nuclear transplantation experiments carriedTTTAACTATCAGAATGAAGATGAAAAAGTCACCTTGTCTTTCCCTAGTACTCTGCAAACAGGTACGGGAA out with single-cell fertilized embryos have demonstrated an absolute requirement forCCTTAAAGATAGATTTTGTTGGAGAGCTGAATGACAAAATGAAAGGTTTCTATAGAAGTAAATATACTAC both a maternally-derived and a paternally-derived pronculeus to allow full-termCCCTTCTGGAGAGGTGCGCTATGCTGCTGTAACACAGTTTGAGGCTACTGATGCCCGAAGGGCTTTTCCT development (McGrath and Solter, 1983). Second, in animals that receive bothTGCTGGGATGAGCCTGCTATCAAAGCAACTTTTGATATCTCATTGGTTGTTCCTAAAGACAGAGTAGCTT homologs of certain chromosomes or subchromosomal regions from one parent andTATCAAACATGAATGTAATTGACCGGAAACCATACCCTGATGATGAAAATTTAGTGGAAGTGAAGTTTGC not the other (through the mating of translocation heterozygotes as described inCCGCACACCTGTTATGTCTACATATCTGGTGGCATTTGTTGTGGGTGAATATGACTTTGTAGAAACAAGGobserved including enhanced Section 5.2.3), dramatic effects on development can beTCAAAAGATGGTGTGTGTGTCCGTGTTTACACTCCTGTTGGCAAAGCAGAGCAAGGAAAATTTGCGTTAG Kirk, 1985). Third, either of or retarded growth and outright lethality (Cattanach and two deletions that cover a small region of mouse chromosome 17 can be transmittedAGGTTGCTGCTAAAACCTTGCCTTTTTATAAGGACTACTTCAATGTTCCTTATCCTCTACCTAAAATTGATCTCATTGCTATTGCAGACTTTGCAGCTGGTGCCATGGAGAACTGGGGCCTTGTTACTTATAGGGAGACTdeletions cause prenatal normally from a father to his offspring, but these same lethality when they are maternally transmitted (Johnson, 1974; Winking andGCATTGCTTATTGATCCAAAAAATTCCTGTTCTTCATCCCGCCAGTGGGTTGCTCTGGTTGTGGGACATG Silver, 1984). Fourth, similar parent-of-origin effects have been observed on theAACTCGCCCATCAATGGTTTGGAAATCTTGTTACTATGGAATGGTGGACTCATCTTTGGTTAAATGAAGGTTTTGCATCCTGGATTGAATATCTGTGTGTAGACCACTGCTTCCCAGAGTATGATATTTGGACTCAGTTT knock-out allele at the Igf2 phenotypes expressed by animals that carry a targeted locus (DeChiara et al., 1991). Finally, molecular techniques have been used to directlyGTTTCTGCTGATTACACCCGTGCCCAGGAGCTTGACGCCTTAGATAACAGCCATCCTATTGAAGTCAGTG The trouble with facts is that there are so many of demonstrate the expression of transcripts from one parental allele and not the otherTGGGCCATCCATCTGAGGTTGATGAGATATTTGATGCTATATCATATAGCAAAGGTGCATCTGTCATCCG at the Igf2r locus (Barlow et al., 1991) and the H19 locus (Bartolomei et al., 1991). The them.AATGCTGCATGACTACATTGGGGATAAGGACTTTAAGAAAGGAATGAACATGTATTTAACCAAGTTCCAA accumulated data indicate that a subset of mouse genes (on the order of 0.2%) willCAAAAGAATGCTGCCACAGAGGATCTCTGGGAAAGTTTAGAAAATGCTAGTGGTAAACCTATAGCAGCTG The Gentle Reader (1903) Samuel Crothers: function differently in normal embryos depending on whether they have beenGTTTCTGCTGATTACACCCGTGCCCAGGAGCTTGACGCCTTAGATAACAGCCATCCTATTGAAGTCAGTG inherited through the male or the female gamete, such that one allele will be expressedTGGGCCATCCATCTGAGGTTGATGAGATATTTGATGCTATATCATATAGCAAAGGTGCATCTGTCATCCG and the other will be silent. Genomic imprinting is the term that has been coined toAATGCTGCATGACTACATTGGGGATAAGGACTTTAAGAAAGGAATGAACATGTATTTAACCAAGTTCCAA by a gene varies depending describe this situation in which the phenotype expressed on its parental origin (Sapienza, 1989). Further experiments have demonstratedCAAAAGAATGCTGCCACAGAGGATCTCTGGGAAAGTTTAGAAAATGCTAGTGGTAAACCTATAGCAGCTG that, in general, the "imprint" is erased and regenerated during gametogenesis so that the function of an imprintable gene is fully determined by the sex of its Rocky ISBC 12/8/11 progenitor alone, and not by earlier ancestors.
  8. 8. Manual (mostly) curation of the biomedical literature Rocky ISBC 12/8/11
  9. 9. The knowledge is in the details Curators use controlled terms from structured vocabularies (ontologies) to annotate complex biological systems described in the literature Rocky ISBC 12/8/11
  10. 10. Crash Blossoms and other semantic ambiguities translating what we say into what we mean: data, words and knowledge “Violinist Linked to JAL Crash Blossoms” “Squad Helps Dog Bite“MacArthur Flies Back toVictim”Front” “Red Tape Holds Up New Bridge.” Rocky ISBC 12/8/11
  11. 11. Today there are many biomedical ontologies… Open Biomedical Ontologies http://www.obofoundry.org/ The „s link to the term request trackers for the listed ontologies. Rocky ISBC 12/8/11
  12. 12. Something very important and very weird is happening to the book rightnow: It‟s shedding its papery corpus and transmigrating into a bodilessdigital form, right before our eyes. We‟re witnessing the bibliographicalequivalent of the rapture. If anything we may be lowballing the weirdnessof it all. Rocky ISBC 12/8/11Lev Grossman, NYTimes Book Review Sept
  13. 13. Semantic WebSemantic Web Layer Cake (Berners-Lee, 2000) Rocky ISBC 12/8/11
  14. 14. …..into the FutureThe current back-propagation of biomedical literatureof semantic integration using ontologies is not scalableto necessary level of granularity and context neededA key element of data integration is the mark-up ofdata at the time of generationReasoned Argument communication includesproviding methods and data to enablereproducibility, and requiresopen access to the semantically enricheddiscussion, machine-readable metadata, accessibledatasets, peer review discussions, and possibility oftesting for reproducibility Rocky ISBC 12/8/11
  15. 15. 1 - Improving Knowledge CommunicationWhat are functionalities needed detail methods, both wet and dry provide data with appropriate metadata support interactive results, i.e., tables and figures track metrics of utility, usage, and impactTechnology electronic lab books that are easy and functional data collection and repositories that provide standards and persistence new models for data interconnections real-time metrics available Rocky ISBC 12/8/11
  16. 16. What‟s Changing - 2Peer ReviewJournal Impact (the Myth of Impact Factors)Supplementary Material (i.e., the DATA) missingand or incompleteMetrics of Impact of ResearchPersistence of Data Rocky ISBC 12/8/11
  17. 17. Peer Review-1 – bad review hard to engage expert reviews for multi-component researchThe Scientist Rocky ISBC 12/8/11
  18. 18. Large computation analysis require multiple coordinated reviews Rocky ISBC 12/8/11Slide from Carol Bult
  19. 19. Peer Review – bad review 2Computation analysis verity depends on data input Ascertainment bias refers to a systematic distortion in measuring the true frequency of Faculty of way in which 12/8/1 a phenomenon due to the Rocky ISBC the 1000 1 data are collected.
  20. 20. We need to enable reproducibility Rocky ISBC 12/8/11
  21. 21. Rocky ISBC 12/8/11
  22. 22. Research data is simply not available 50 highest impact research journals 1st 10 original research articles of 2009 88% of journals had „some‟ statement on sharing of data 50% of articles did not meet journal standards 9% of articles in full compliance algorithms and meta-date required for reproducibility not required by any journal Rocky ISBC 12/8/11Alsheikh-Ali et al., PLoS One 2011;6(9):e24357. Epub 2011Sep 7.
  23. 23. Changing Incentives to Publish - 1 Rocky ISBC 12/8/11
  24. 24. Changing Incentives to Publish - 2 Nature Medicine 16, 744 (2010) doi:10.1038/nm0710-744 Rocky ISBC 12/8/11
  25. 25. 2 - Impacting Our WorldOpen Access to data within supportiveenvironment accelerates knowledgediscoverySocial Aspects: How do we quantify impact of use/reward system?Coolness: How do we make it attractive to do/ use? Rocky ISBC 12/8/11
  26. 26. Sharing Data – Crowd Sourcing Rocky ISBC 12/8/11
  27. 27. Interactive Communication Imbedded links to data for figures Immediate access to referenced material Interactive community Blogs and commentary Analytics of impact Rocky ISBC 12/8/11
  28. 28. Initiatives to Access Datauvm biomedical figuresearch Rocky ISBC 12/8/11
  29. 29. Interactive PublicationsJonathan Eisens Blogspot – 9/6/11 Rocky ISBC 12/8/11
  30. 30. Metrics of Paper Impact -1 Rocky ISBC 12/8/11
  31. 31. 3 – Overcoming Obstacles New Publication Models Data Preservation – Rocky ISBC 12/8/11
  32. 32. publish your data – Rocky ISBC 12/8/11datadryad.org
  33. 33. Key PointsCommunication of research methods, data and results ischanging.Access to research is limited outside northern hemisphere -institutional access missing – thus limiting the globalization ofscience.Utility of research depends on inter-connections and access todata and results; cloud-sourcing of science imminent.The reward mechanism (tenure /cash) via publication record ischanging, but slowly for most of us.The business model of scientific publishing is under great stress.Government investment mechanisms for support and sharing ofscience endeavors are under intense discussion.New research communication mechanisms are coming; someare already here. Rocky ISBC 12/8/11
  34. 34. SummaryWe must continue to support the Reasoned Argument - in context of massive amounts of digital data, this includes comprehensive data access to maximize data integration and enable reproducibilityThe necessary upheaval in scientific communicationrequires both technological and sociologicalinnovationsYOU can be part of this sea change in researchcommunication Rocky ISBC 12/8/11
  35. 35. FoRCe Workshop Mouse Genome Informatics Gene Ontology Consortium Rocky ISBC 12/8/11
  36. 36. AcknowledgementsMGI PIsCarol Bult, Janan Eppig, Jim Kadin, Joel Richardson, Martin RingwaldGO Consortium PIs and CouncilMichael Ashburner, Mike Cherry, Suzanna Lewis, Paul Thomas, Paul Sternberg;Rolf Apweiler, Rex Chisholm, Eva HualaGO @ MGIAlex Diehl, Mary Dolan, David Hill,Li Ni, Harold Drabkin, Li Ni,Dmitry SitnikovFunding: NIH-NHGRI P-41 grants to MGI and GOC; GM080646 toPRO Rocky ISBC 12/8/11

×