SlideShare a Scribd company logo
1 of 42
Toekomstvisie op ICT in de
gezondheidszorg
Prof. Dr. Bart De Moor
Care for Innovation
Healthcare Conference
12 November 2013, Affligem

www.esat.kuleuven.be/stadius

www.kuleuven.be/iminds/fh
Contents
• Disruptive science and technology
• 3P/4P Medicine
– Preventive, Predictive, Personalized, Participatory
– Patients, Professionals, Policy Makers

• Exemplary cases
• Future Trends
www: max 19 clicks !
1 million = 1 000 000
1 billion = 1 000 000 000
1 trillion = 1 000 000 000 000
1 quadrillion =
1 000 000 000 000 000

1 kB = 1 000
1 MB = 1 000 000
1 GB = 1 000 000 000
1 TB = 1 000 000 000 000
1 PB = 1 000 000 000 000 000

1 TB
= large university library
= 212 DVD discs
= 1430 CDs
= 3 year music in CD quality
Connectivity
We are always

CONNECTED
and FAST!

Throughput NOT sufficient for
moving around Big Data
5
Tsunami of data from progress in technology

GS-FLX Roche
Applied Science 454

Sequencers
Computer Tomography

Magnetic resonance

Microarrays
(DNA chips)

ACACATTAAATCTTATATGC
TAAAACTAGGTCTCGTTTTA
GGGATGTTTATAACCATCTT
TGAGATTATTGATGCATGGT
TATTGGTTAGAAAAAATATA
CGCTTGTTTTTCTTTCCTAG
GTTGATTGACTCATACATGT
GTTTCATTGAGGAAGGAAC
TTAACAAAACTGCACTTTTT
TCAACGTCACAGCTACTTTA
AAAGTGATCAAAGTATATCA
AGAAAGCTTAATATAAAGAC
ATTTGTTTCAAGGTTTCGTA
AGTGCACAATATCAAGAAG
ACAAAAATGACTAATTTTGT
TTTCAGGAAGCATATATATT
ACACGAACACAAATCTATTT
TTGTAATCAACACCGACCAT
GGTTCGATTACACACATTAA
ATCTTATATGCTAAAACTAG
GTCTCGTTTTAGGGATGTTT
ATAACCATCTTTGAGATTAT
TGATGCATGGTTATTGGTTA
GAAAAAATATACGCTTGTTT
TTCTTTCCTAGGTTGATTGA

Mass spectrometry
Genome data
• Human genome project
– Initial draft: June 2000
– Final draft: April 2003
– 13 year project
– $300 million value
with 2002 technology
• Personal genome
YearΩ
– June 1, 2007
– Genome of James Watson,
co-discoverer of DNA double
helix, is sequenced
• $1.000.000
• Two months

• €1000-genome
– Expected 2012-2020

1,00E+11
1,00E+10
1,00E+09
1,00E+08
1,00E+07
1,00E+06
1,00E+05
1,00E+04
1,00E+03
1,00E+02
1,00E+01
1,00E+00
1,00E-01
1,00E-02
1,00E-03
1,00E-04
1,00E-05
1,00E-06
1,00E-07

Cost per base pair
Genome cost

1990

1995

2000

2002

2005

2007

Cost per base pair

2010

2015

Genome cost

1990

10

3E+10

1995

1

3.000.000.000

2000

0.2

600.000.000

2002

0.09

270.000.000

2005

0.03

90.000.000

2007

0.000333333

1.000.000

2010

3.33333E-06

10000

2015

0.0000001

300

7
index of 20
million
Biomedical
PubMed
records

1 slice
mouse brain
MSI at 10
μm
resolution
81 GigaByte

raw NGS data
of 1 full
genome

sequencing all newborns
by 2020 (125k births /
year)
125 PetaByte / year

1 TeraByte

23 GigaByte

1 kB = 1000
1 MB = 1 000 000
1 GB = 1 000 000 000
1 TB = 1 000 000 000 000
1 PB = 1 000 000 000 000 000
1 small
animal
image
1 CDROM
750
MegaByt
e

1 GigaByte

PACS UZ Leuven
1,6 PetaByte

Genomics core
HiSeq 2000 full
speed exome
sequencing
1 TeraByte /
week

8
Contents
• Disruptive science and technology
• 3P/4P Medicine
– Preventive, Predictive, Personalized, Participatory
– Patients, Professionals, Policy Makers

• Exemplary cases
• Future Trends
ICT tools for decision support
ICT to support 3P decision makers in health care
• Professionals (clinicians, biomedical researchers …)
• exploit data for more effective medicine

• Patient
• patient-centered care for empowered patients

• Policy Maker (mutualities, health insurers, social security,
governments, hospital management …)
• Smart, data-driven, evidence-based health care system policies

10
ICT contributes to P4 medicine
• Personalized: "customized" diagnosis and treatment, right
drug for the right patient at the right time

• Preventive: prevention and early diagnosis
• Predictive: determine risk profiles, predict progression and
outcome

• Participatory: correct and complete information for the
patient to participate in the decision process, selfmanagement

11
Rationales for ICT & Health
-Improve quality performance of health decision/diagnosis systems
-Support individual medical doctor
-Avoid/decrease number of medicial errors
-Web portal for Evidence Based Medicine
-Information sharing among doctors
-avoid/monitor patient (s)hopping behavior
-Global Medical File per patient
-Interoperability

-Deal with ‘empowerment of the patient’: Patient-centric health care
-Medical care in 4P: personalized, preventive, predictive, participatory
-Increasing trend for ‘customized’’personalized’ medicine
-Improve transparancy and consistency
-Deal/cope with ‘professional’ (chronical) patients (heart, diabetes, cancer,…)
-Improve patient mobility
-Cost effectiveness of the health care system
-Ageing population:
-EU 2050: 65+  +70%; 80+  +180%
-Monitor overconsumption
-Improve transparancy
-Detect abnormalities in diagnosis/therapy/…
-Cope with tsunami of available information and data (clinical, population, ….)
Contents
• Disruptive science and technology
• 3P/4P Medicine
– Preventive, Predictive, Personalized, Participatory
– Patients, Professionals, Policy Makers

• Exemplary cases
• Future Trends
NXT_SLEEP: Next generation sleep
monitoring platform

14
FallRisk: Intelligent services in view of prevention,
risk evaluation and detection of fall incidents

15
Blood Glucose Control @ ICU
 10 mio adult ICU patients / year (EU + US) (1-2 bio $ market)
 Intensive Care Unit UZ Leuven studies: Tight Glycemic Control (TGC) in
intensive care unit lowers mortality

 LOGIC-Insulin: semi-automatic control system that advises nurse on
insulin dosage and blood sampling interval aiming at TGC and avoiding
hypoglycemia
 clinical trial: compared with expert nurses, LOGIC-Insulin showed
improved efficacy of TGC without increasing rate of hypoglycemia
 multicentre clinical trial Q3 2013; spin-off in preparation

16
IOTA app: ovarian tumour malignancy:
population based / standardized

IOTA Models:

Standardize ultrasonographic endometrial tumor
analysis
models giving an indication of the probability of
malignancy of an ovarian tumour based on 6 to 12
observed parameters
IOTA app available in iTunes app store and on
http://homes.esat.kuleuven.be/~sistawww/biomed/iota/
17
IOTA app: Clinical Decision Support
 goal = making it easier to diagnose ovarian cancer
 help clinicians take decisions on diagnosis, prognosis and therapy response
 make use of patient data ánd population information (patient biobank &
database, literature …)

 build mathematical model on data and use this model to predict patient
outcome: formalized way of analyzing biomedical data instead of
interpretation of clinical parameters based on a clinician’s expert knowledge
 model method can be varied: logistic regression, artifical neural networks,
Support Vector Machines (SVM), Bayesian networks …
Patient history
Tumor
characteristics

Clinician

Ultrasound
characteristics
Tumor markers

Diagnosis

Prognosis

Model

Response to
therapy
IOTA – performance comparison
Performance of an expert

Performance of
IOTA models

Performance of
non-experts

Performance of
old models
Microarrays – DNA-chips
Test Ref.

High Low
Low

High

High High

Low

Low
Genetic classification of leukemia
12600 genes / 72 patients / 3 types of leukemia (AML/ ALL/MLL)
Data matrix

Find the pattern

Hidden pattern

Pattern validation
18 / 21 patients with 87 gene fingerprint for AML

19 / 25 patients with 80 gene fingerprint for ALL

14 / 17 patients with 62 gene fingerprint for MLL
ALL/AML/MLL biomarkers
PCA

© Armstrong SA et al. Nat Genet. 2002 Jan;30(1):41-7.

12 600 genes
72 patients:
- 28 Acute Lymphoblastic Leukemia (ALL)
- 24 Acute Myeloid Leukemia (AML)
- 20 Mixed Linkage Leukemia (MLL)
3 patients for each class used as test set
Aerts et al, Nature Biotechnology, 2006
24
25
26
Variant prioritization by genomic data fusion:
including disease phenotypes

Figure – Classification scenarios. Receiver-operator (A and C)
and Precision-Recall (B and D) curves for five classifiers tested
against test sets comparing disease-causing variants to either
rare non-disease-causing variants (A and B) or common
polymorphisms (C and D).

based on Random Forests
20x more accurate than state of the art

Sifrim, Popovic et al, Nature Methods, 2013d
Mass Spectral Imaging
•

Mass spectral imaging allows
•
•
•

•

Screening and mapping of hundreds of biomolecules in a complex organic tissue
section
Does not require any prior information nor labeling
Visualization of the spatial distribution of these molecules

Computation complexity
•
•

The structure of the generated data is complex
Large size and high dimensionality

in collaboration with SyBioMa, KU Leuven Facility
for Systems Biology based Mass Spectrometry,
MIRC KU Leuven & Caprioli Lab (Vanderbilt
University, VS)
Contents
• Disruptive science and technology
• 3P/4P Medicine
– Preventive, Predictive, Personalized, Participatory
– Patients, Professionals, Policy Makers

• Exemplary cases
• Future Trends
Moore’s law: Computing power doubles
every 18 months (56 % growth rate)
‘Understand’ ?

6 10 9

Operations/second

5 10 9

LUI

4 10 9

3D games
3 10

9

2 10 9

1 10 9

Bookkeeping
0
1975

1980

Audio

1985

1990

Video

1995

Year

2000

2005

2010
Body area networks

EEG

POTS

Vision

www Network

positioning
glucose
Cellular

Transducer
Nodes
Hearing
ECG
Blood
pressure

DNA
protein

Implants

WLAN

Personal
Assistant
31
1953 Crick and Watson: DNA Double Helix

2000 Venter, Collins: Humane genome
E D. Green et al. Nature 470, 204-213 (2011) doi:10.1038/nature09764

Towards effective
genomic medicine
building on expertise in
big data & machine
learning
BENCH is used in ca. 50 accredited
genetic labs worldwide
Heverlee + US office

routine diagnostics

tools for non-IT users

first diagnostics grade solution
for Next Generation
Sequencing data based
diagnostics in the world

originating from research in
rare genetic disorders in close
collaboration with Centre
Human Genetics UZ Leuven 34
Systems biology: ‘reverse engineering’

‘high throughput ‘data

genome

transcriptome

proteome

metabolome

interactome
35
Zebrafish Neural Circuits
 understand dynamical behaviour of neural circuits in Zebrafish
through system identification
u

y = f (u )

y

Input

RAW STIMULUS

Output

BRAIN

Model

Identification
Algorithm

REACTION

-

in collaboration
with NERF
Signal Processing and Classification for Magnetic
Resonance Spectroscopy Applied to Brain Tumor
Diagnosis
Single-voxel MRS

MRS quantification

NAA

Myo

Cr

PCho

Glu

Lac

Lip1

Lip2

Ala

Glc

Metabolite
concentrations

Tau

Biomarker
of disease

Metabolite maps
Multi-voxel MRS

MRS quantification
using spatial information
Seizure detection incorporating structural
information from the multichannel EEG

Representation of EEG data in
higher order arrays:

features
channels

frequency

channels

features

channels

channels

time

Classifier matrix

Goal: Exploit the inherent structure
of the EEG signals using novel matrix
and tensor-based machine learning
solutions:
– Nuclear norm regularization
– Tensorial kernels
Collaboration IMEC/NERF:
neuroprobes
MULTI-FUNCTIONAL INTEGRATED
NEUROPROBES

… ADVANCED & AUTOMATED
MULTICHANNEL SIGNAL
PROCESSING..

…. INTEGRATED END-USER FEEDBACK
Synthetic biology: design new functional life
Bacterium detecting cancer cells
Output
Input
Reset
Memory

Filter
Cell Death
InverTimer

http://2013.igem.org/Team:KU_Leuven
Obama

http://www.whitehouse.gov/blog/09/04/27/The-Necessity-of-Science/

…
The Recovery Act will support the long overdue step of computerizing America's medical records, to reduce the
duplication, waste and errors that cost billions of dollars and thousands of lives. But it's important to note, these
records also hold the potential of offering patients the chance to be more active participants in the prevention and
treatment of their diseases. We must maintain patient control over these records and respect their privacy. At the
same time, we have the opportunity to offer billions and billions of anonymous data points to medical researchers
who may find in this information evidence that can help us better understand disease.
….
Because of recent progress –- not just in biology, genetics and medicine, but also in physics, chemistry, computer
science, and engineering –- we have the potential to make enormous progress against diseases in the coming
decades.
….

41
Decision Support Analytics
for Professionals, Patients & Policy makers

bart.demoor@esat.kuleuven.be

www.esat.kuleuven.be/stadius

www.kuleuven.be/iminds/fh

More Related Content

What's hot

Evolution 2013: Prof. Dr. Georges De Moor, EuroRec on Liberating Health Data ...
Evolution 2013: Prof. Dr. Georges De Moor, EuroRec on Liberating Health Data ...Evolution 2013: Prof. Dr. Georges De Moor, EuroRec on Liberating Health Data ...
Evolution 2013: Prof. Dr. Georges De Moor, EuroRec on Liberating Health Data ...Life Sciences Network marcus evans
 
From Bits to Bedside: Translating Big Data into Precision Medicine and Digita...
From Bits to Bedside: Translating Big Data into Precision Medicine and Digita...From Bits to Bedside: Translating Big Data into Precision Medicine and Digita...
From Bits to Bedside: Translating Big Data into Precision Medicine and Digita...Dexter Hadley
 
Data Standards in Radiomics Research
Data Standards in Radiomics ResearchData Standards in Radiomics Research
Data Standards in Radiomics ResearchAndrey Fedorov
 
How Technologies can help us comply
How Technologies can help us complyHow Technologies can help us comply
How Technologies can help us comply3GDR
 
Twenty Years of Whole Slide Imaging - the Coming Phase Change
Twenty Years of Whole Slide Imaging - the Coming Phase ChangeTwenty Years of Whole Slide Imaging - the Coming Phase Change
Twenty Years of Whole Slide Imaging - the Coming Phase ChangeJoel Saltz
 
From Digitally Enabled Genomic Medicine to Personalized Healthcare
From Digitally Enabled Genomic Medicineto Personalized HealthcareFrom Digitally Enabled Genomic Medicineto Personalized Healthcare
From Digitally Enabled Genomic Medicine to Personalized HealthcareLarry Smarr
 
Frontiers of Predictive Oncology and Computing
Frontiers of Predictive Oncology and ComputingFrontiers of Predictive Oncology and Computing
Frontiers of Predictive Oncology and ComputingWarren Kibbe
 
Big Databases and Outcome Research - Opportunities and Challenges for Radiati...
Big Databases and Outcome Research - Opportunities and Challenges for Radiati...Big Databases and Outcome Research - Opportunities and Challenges for Radiati...
Big Databases and Outcome Research - Opportunities and Challenges for Radiati...Andre Dekker
 
Big Data Challenges for Real-Time Personalized Medicine
Big Data Challenges for Real-Time Personalized MedicineBig Data Challenges for Real-Time Personalized Medicine
Big Data Challenges for Real-Time Personalized MedicineSAP Technology
 
Information Technology and Radiology: challenges and future perspectives
Information Technology and Radiology: challenges and future perspectivesInformation Technology and Radiology: challenges and future perspectives
Information Technology and Radiology: challenges and future perspectivesErik R. Ranschaert, MD, PhD
 
Genomics and Computation in Precision Medicine March 2017
Genomics and Computation in Precision Medicine March 2017Genomics and Computation in Precision Medicine March 2017
Genomics and Computation in Precision Medicine March 2017Warren Kibbe
 
CI4CC Cancer Informatics Perspectives
CI4CC Cancer Informatics PerspectivesCI4CC Cancer Informatics Perspectives
CI4CC Cancer Informatics PerspectivesWarren Kibbe
 
Radiomics Data Management, Computation, and Analysis for QIN F2F 2016
Radiomics Data Management, Computation, and Analysis for QIN F2F 2016Radiomics Data Management, Computation, and Analysis for QIN F2F 2016
Radiomics Data Management, Computation, and Analysis for QIN F2F 2016Ashish Sharma
 
Professor Harrison Bai, Artificial Intelligence Applications in Radiology_mHe...
Professor Harrison Bai, Artificial Intelligence Applications in Radiology_mHe...Professor Harrison Bai, Artificial Intelligence Applications in Radiology_mHe...
Professor Harrison Bai, Artificial Intelligence Applications in Radiology_mHe...Levi Shapiro
 
Cancer moonshot and data sharing
Cancer moonshot and data sharingCancer moonshot and data sharing
Cancer moonshot and data sharingWarren Kibbe
 
Radiomics: Novel Paradigm of Deep Learning for Clinical Decision Support towa...
Radiomics: Novel Paradigm of Deep Learning for Clinical Decision Support towa...Radiomics: Novel Paradigm of Deep Learning for Clinical Decision Support towa...
Radiomics: Novel Paradigm of Deep Learning for Clinical Decision Support towa...Wookjin Choi
 
Enabling Translational Medicine with e-Science
Enabling Translational Medicine with e-ScienceEnabling Translational Medicine with e-Science
Enabling Translational Medicine with e-ScienceOla Spjuth
 
Dekker trog - radiomics for oncology - 2017
Dekker   trog  - radiomics for oncology - 2017Dekker   trog  - radiomics for oncology - 2017
Dekker trog - radiomics for oncology - 2017Andre Dekker
 
E-book Thesis Sara Carvalho
E-book Thesis  Sara CarvalhoE-book Thesis  Sara Carvalho
E-book Thesis Sara CarvalhoSara Carvalho
 

What's hot (20)

Evolution 2013: Prof. Dr. Georges De Moor, EuroRec on Liberating Health Data ...
Evolution 2013: Prof. Dr. Georges De Moor, EuroRec on Liberating Health Data ...Evolution 2013: Prof. Dr. Georges De Moor, EuroRec on Liberating Health Data ...
Evolution 2013: Prof. Dr. Georges De Moor, EuroRec on Liberating Health Data ...
 
From Bits to Bedside: Translating Big Data into Precision Medicine and Digita...
From Bits to Bedside: Translating Big Data into Precision Medicine and Digita...From Bits to Bedside: Translating Big Data into Precision Medicine and Digita...
From Bits to Bedside: Translating Big Data into Precision Medicine and Digita...
 
Data Standards in Radiomics Research
Data Standards in Radiomics ResearchData Standards in Radiomics Research
Data Standards in Radiomics Research
 
How Technologies can help us comply
How Technologies can help us complyHow Technologies can help us comply
How Technologies can help us comply
 
Twenty Years of Whole Slide Imaging - the Coming Phase Change
Twenty Years of Whole Slide Imaging - the Coming Phase ChangeTwenty Years of Whole Slide Imaging - the Coming Phase Change
Twenty Years of Whole Slide Imaging - the Coming Phase Change
 
From Digitally Enabled Genomic Medicine to Personalized Healthcare
From Digitally Enabled Genomic Medicineto Personalized HealthcareFrom Digitally Enabled Genomic Medicineto Personalized Healthcare
From Digitally Enabled Genomic Medicine to Personalized Healthcare
 
Frontiers of Predictive Oncology and Computing
Frontiers of Predictive Oncology and ComputingFrontiers of Predictive Oncology and Computing
Frontiers of Predictive Oncology and Computing
 
Big Databases and Outcome Research - Opportunities and Challenges for Radiati...
Big Databases and Outcome Research - Opportunities and Challenges for Radiati...Big Databases and Outcome Research - Opportunities and Challenges for Radiati...
Big Databases and Outcome Research - Opportunities and Challenges for Radiati...
 
Big data
Big dataBig data
Big data
 
Big Data Challenges for Real-Time Personalized Medicine
Big Data Challenges for Real-Time Personalized MedicineBig Data Challenges for Real-Time Personalized Medicine
Big Data Challenges for Real-Time Personalized Medicine
 
Information Technology and Radiology: challenges and future perspectives
Information Technology and Radiology: challenges and future perspectivesInformation Technology and Radiology: challenges and future perspectives
Information Technology and Radiology: challenges and future perspectives
 
Genomics and Computation in Precision Medicine March 2017
Genomics and Computation in Precision Medicine March 2017Genomics and Computation in Precision Medicine March 2017
Genomics and Computation in Precision Medicine March 2017
 
CI4CC Cancer Informatics Perspectives
CI4CC Cancer Informatics PerspectivesCI4CC Cancer Informatics Perspectives
CI4CC Cancer Informatics Perspectives
 
Radiomics Data Management, Computation, and Analysis for QIN F2F 2016
Radiomics Data Management, Computation, and Analysis for QIN F2F 2016Radiomics Data Management, Computation, and Analysis for QIN F2F 2016
Radiomics Data Management, Computation, and Analysis for QIN F2F 2016
 
Professor Harrison Bai, Artificial Intelligence Applications in Radiology_mHe...
Professor Harrison Bai, Artificial Intelligence Applications in Radiology_mHe...Professor Harrison Bai, Artificial Intelligence Applications in Radiology_mHe...
Professor Harrison Bai, Artificial Intelligence Applications in Radiology_mHe...
 
Cancer moonshot and data sharing
Cancer moonshot and data sharingCancer moonshot and data sharing
Cancer moonshot and data sharing
 
Radiomics: Novel Paradigm of Deep Learning for Clinical Decision Support towa...
Radiomics: Novel Paradigm of Deep Learning for Clinical Decision Support towa...Radiomics: Novel Paradigm of Deep Learning for Clinical Decision Support towa...
Radiomics: Novel Paradigm of Deep Learning for Clinical Decision Support towa...
 
Enabling Translational Medicine with e-Science
Enabling Translational Medicine with e-ScienceEnabling Translational Medicine with e-Science
Enabling Translational Medicine with e-Science
 
Dekker trog - radiomics for oncology - 2017
Dekker   trog  - radiomics for oncology - 2017Dekker   trog  - radiomics for oncology - 2017
Dekker trog - radiomics for oncology - 2017
 
E-book Thesis Sara Carvalho
E-book Thesis  Sara CarvalhoE-book Thesis  Sara Carvalho
E-book Thesis Sara Carvalho
 

Similar to Healthcare Conference 2013 : Toekomstvisie op ICT in de gezondheidszorg - prof. dr. Bart De Moor

ICBO 2014, October 8, 2014
ICBO 2014, October 8, 2014ICBO 2014, October 8, 2014
ICBO 2014, October 8, 2014Warren Kibbe
 
Improving health care outcomes with responsible data science
Improving health care outcomes with responsible data scienceImproving health care outcomes with responsible data science
Improving health care outcomes with responsible data scienceWessel Kraaij
 
Clinical Genomics and Medicine
Clinical Genomics and MedicineClinical Genomics and Medicine
Clinical Genomics and MedicineWarren Kibbe
 
Federal Research & Development for the Florida system Sept 2014
Federal Research & Development for the Florida system Sept 2014 Federal Research & Development for the Florida system Sept 2014
Federal Research & Development for the Florida system Sept 2014 Warren Kibbe
 
Day 2 Big Data panel at the NIH BD2K All Hands 2016 meeting
Day 2 Big Data panel at the NIH BD2K All Hands 2016 meetingDay 2 Big Data panel at the NIH BD2K All Hands 2016 meeting
Day 2 Big Data panel at the NIH BD2K All Hands 2016 meetingWarren Kibbe
 
Super computing 19 Cancer Computing Workshop Keynote
Super computing 19 Cancer Computing Workshop KeynoteSuper computing 19 Cancer Computing Workshop Keynote
Super computing 19 Cancer Computing Workshop KeynoteWarren Kibbe
 
Improving health care outcomes with responsible data science #escience2018
Improving health care outcomes with responsible data science #escience2018Improving health care outcomes with responsible data science #escience2018
Improving health care outcomes with responsible data science #escience2018Wessel Kraaij
 
Health IT Summit Austin 2013 - Presentation "The Impact of All Data on Health...
Health IT Summit Austin 2013 - Presentation "The Impact of All Data on Health...Health IT Summit Austin 2013 - Presentation "The Impact of All Data on Health...
Health IT Summit Austin 2013 - Presentation "The Impact of All Data on Health...Health IT Conference – iHT2
 
Data Science Deep Roots in Healthcare Industry
Data Science Deep Roots in Healthcare IndustryData Science Deep Roots in Healthcare Industry
Data Science Deep Roots in Healthcare IndustryDinesh V
 
Role of data in precision oncology
Role of data in precision oncologyRole of data in precision oncology
Role of data in precision oncologyWarren Kibbe
 
National Cancer Data Ecosystem and Data Sharing
National Cancer Data Ecosystem and Data SharingNational Cancer Data Ecosystem and Data Sharing
National Cancer Data Ecosystem and Data SharingWarren Kibbe
 
Connected Health & Me - Matic Meglic - Nov 24th 2014
Connected Health & Me - Matic Meglic - Nov 24th 2014Connected Health & Me - Matic Meglic - Nov 24th 2014
Connected Health & Me - Matic Meglic - Nov 24th 2014ipposi
 
A Vision for a Cancer Research Knowledge System
A Vision for a Cancer Research Knowledge SystemA Vision for a Cancer Research Knowledge System
A Vision for a Cancer Research Knowledge SystemWarren Kibbe
 
Early diagnosis and prevention enabled by big data   geneva conference final
Early diagnosis and prevention enabled by big data   geneva conference finalEarly diagnosis and prevention enabled by big data   geneva conference final
Early diagnosis and prevention enabled by big data   geneva conference finale-Marefa
 
[DSC MENA 24] Amal_Elgammal_-_QUALITOP_presentation.pptx
[DSC MENA 24] Amal_Elgammal_-_QUALITOP_presentation.pptx[DSC MENA 24] Amal_Elgammal_-_QUALITOP_presentation.pptx
[DSC MENA 24] Amal_Elgammal_-_QUALITOP_presentation.pptxDataScienceConferenc1
 
Big Data in Medicine
Big Data in MedicineBig Data in Medicine
Big Data in MedicineNasir Arafat
 

Similar to Healthcare Conference 2013 : Toekomstvisie op ICT in de gezondheidszorg - prof. dr. Bart De Moor (20)

ICBO 2014, October 8, 2014
ICBO 2014, October 8, 2014ICBO 2014, October 8, 2014
ICBO 2014, October 8, 2014
 
Improving health care outcomes with responsible data science
Improving health care outcomes with responsible data scienceImproving health care outcomes with responsible data science
Improving health care outcomes with responsible data science
 
Clinical Genomics and Medicine
Clinical Genomics and MedicineClinical Genomics and Medicine
Clinical Genomics and Medicine
 
Federal Research & Development for the Florida system Sept 2014
Federal Research & Development for the Florida system Sept 2014 Federal Research & Development for the Florida system Sept 2014
Federal Research & Development for the Florida system Sept 2014
 
16
1616
16
 
Day 2 Big Data panel at the NIH BD2K All Hands 2016 meeting
Day 2 Big Data panel at the NIH BD2K All Hands 2016 meetingDay 2 Big Data panel at the NIH BD2K All Hands 2016 meeting
Day 2 Big Data panel at the NIH BD2K All Hands 2016 meeting
 
Super computing 19 Cancer Computing Workshop Keynote
Super computing 19 Cancer Computing Workshop KeynoteSuper computing 19 Cancer Computing Workshop Keynote
Super computing 19 Cancer Computing Workshop Keynote
 
Dalton
DaltonDalton
Dalton
 
Dalton presentation
Dalton presentationDalton presentation
Dalton presentation
 
Improving health care outcomes with responsible data science #escience2018
Improving health care outcomes with responsible data science #escience2018Improving health care outcomes with responsible data science #escience2018
Improving health care outcomes with responsible data science #escience2018
 
Health IT Summit Austin 2013 - Presentation "The Impact of All Data on Health...
Health IT Summit Austin 2013 - Presentation "The Impact of All Data on Health...Health IT Summit Austin 2013 - Presentation "The Impact of All Data on Health...
Health IT Summit Austin 2013 - Presentation "The Impact of All Data on Health...
 
Data Science Deep Roots in Healthcare Industry
Data Science Deep Roots in Healthcare IndustryData Science Deep Roots in Healthcare Industry
Data Science Deep Roots in Healthcare Industry
 
Role of data in precision oncology
Role of data in precision oncologyRole of data in precision oncology
Role of data in precision oncology
 
National Cancer Data Ecosystem and Data Sharing
National Cancer Data Ecosystem and Data SharingNational Cancer Data Ecosystem and Data Sharing
National Cancer Data Ecosystem and Data Sharing
 
Connected Health & Me - Matic Meglic - Nov 24th 2014
Connected Health & Me - Matic Meglic - Nov 24th 2014Connected Health & Me - Matic Meglic - Nov 24th 2014
Connected Health & Me - Matic Meglic - Nov 24th 2014
 
A Vision for a Cancer Research Knowledge System
A Vision for a Cancer Research Knowledge SystemA Vision for a Cancer Research Knowledge System
A Vision for a Cancer Research Knowledge System
 
Early diagnosis and prevention enabled by big data   geneva conference final
Early diagnosis and prevention enabled by big data   geneva conference finalEarly diagnosis and prevention enabled by big data   geneva conference final
Early diagnosis and prevention enabled by big data   geneva conference final
 
[DSC MENA 24] Amal_Elgammal_-_QUALITOP_presentation.pptx
[DSC MENA 24] Amal_Elgammal_-_QUALITOP_presentation.pptx[DSC MENA 24] Amal_Elgammal_-_QUALITOP_presentation.pptx
[DSC MENA 24] Amal_Elgammal_-_QUALITOP_presentation.pptx
 
Big Data in Medicine
Big Data in MedicineBig Data in Medicine
Big Data in Medicine
 
Precision and Participatory Medicine - MEDINFO 2015 Panel on big data
Precision and Participatory Medicine - MEDINFO 2015 Panel on big dataPrecision and Participatory Medicine - MEDINFO 2015 Panel on big data
Precision and Participatory Medicine - MEDINFO 2015 Panel on big data
 

More from D3 Consutling

MIConnect "Make IoT ideas happen" part 1
MIConnect "Make IoT ideas happen" part 1 MIConnect "Make IoT ideas happen" part 1
MIConnect "Make IoT ideas happen" part 1 D3 Consutling
 
MIConnect "Make IoT ideas happen" part 2 liato presentation
MIConnect "Make IoT ideas happen" part 2 liato presentationMIConnect "Make IoT ideas happen" part 2 liato presentation
MIConnect "Make IoT ideas happen" part 2 liato presentationD3 Consutling
 
Atendi @mic vlaanderen
Atendi @mic vlaanderenAtendi @mic vlaanderen
Atendi @mic vlaanderenD3 Consutling
 
Terugverdienmodellen in de zorg
Terugverdienmodellen in de zorgTerugverdienmodellen in de zorg
Terugverdienmodellen in de zorgD3 Consutling
 
The Power of Sensors in health & healthcare
The Power of Sensors in health & healthcareThe Power of Sensors in health & healthcare
The Power of Sensors in health & healthcareD3 Consutling
 
Mi connect 21 oktober 2014 Assisted Living
Mi connect 21 oktober 2014 Assisted LivingMi connect 21 oktober 2014 Assisted Living
Mi connect 21 oktober 2014 Assisted LivingD3 Consutling
 
The Power of Social in health and healthcare
The Power of Social in health and healthcareThe Power of Social in health and healthcare
The Power of Social in health and healthcareD3 Consutling
 
Je startup financieren: hoe pak je het aan?
Je startup financieren: hoe pak je het aan?Je startup financieren: hoe pak je het aan?
Je startup financieren: hoe pak je het aan?D3 Consutling
 
25/02/2014 e-Recruitment in de Zorg
25/02/2014 e-Recruitment in de Zorg25/02/2014 e-Recruitment in de Zorg
25/02/2014 e-Recruitment in de ZorgD3 Consutling
 
25/02/2014 Natural User Interface - eMenKa
25/02/2014 Natural User Interface - eMenKa25/02/2014 Natural User Interface - eMenKa
25/02/2014 Natural User Interface - eMenKaD3 Consutling
 
Healthcare Conference 2013: Games in Healthcare : Evidence Based Game Design ...
Healthcare Conference 2013: Games in Healthcare : Evidence Based Game Design ...Healthcare Conference 2013: Games in Healthcare : Evidence Based Game Design ...
Healthcare Conference 2013: Games in Healthcare : Evidence Based Game Design ...D3 Consutling
 
Healthcare Conference 2013 : Digital transformation Healthcare - Jo Caudron
Healthcare Conference 2013 : Digital transformation Healthcare - Jo CaudronHealthcare Conference 2013 : Digital transformation Healthcare - Jo Caudron
Healthcare Conference 2013 : Digital transformation Healthcare - Jo CaudronD3 Consutling
 
Healthcare Conference 2013 : Metaforen voor denken, durven, doen, doorzetten ...
Healthcare Conference 2013 : Metaforen voor denken, durven, doen, doorzetten ...Healthcare Conference 2013 : Metaforen voor denken, durven, doen, doorzetten ...
Healthcare Conference 2013 : Metaforen voor denken, durven, doen, doorzetten ...D3 Consutling
 
Healthcare Conference 2013 : Het Federale eHealthplatform - Frank Robben
Healthcare Conference 2013 : Het Federale eHealthplatform - Frank RobbenHealthcare Conference 2013 : Het Federale eHealthplatform - Frank Robben
Healthcare Conference 2013 : Het Federale eHealthplatform - Frank RobbenD3 Consutling
 
Healthcare Conference 2013 : Genes, Clouds and Cancer - dr. Andrew Litt
Healthcare Conference 2013 : Genes, Clouds and Cancer - dr. Andrew LittHealthcare Conference 2013 : Genes, Clouds and Cancer - dr. Andrew Litt
Healthcare Conference 2013 : Genes, Clouds and Cancer - dr. Andrew LittD3 Consutling
 
Serious Games Tom Langhorst
Serious Games Tom LanghorstSerious Games Tom Langhorst
Serious Games Tom LanghorstD3 Consutling
 
Serious Games Claudia Put
Serious Games Claudia PutSerious Games Claudia Put
Serious Games Claudia PutD3 Consutling
 

More from D3 Consutling (20)

MIConnect "Make IoT ideas happen" part 1
MIConnect "Make IoT ideas happen" part 1 MIConnect "Make IoT ideas happen" part 1
MIConnect "Make IoT ideas happen" part 1
 
MIConnect "Make IoT ideas happen" part 2 liato presentation
MIConnect "Make IoT ideas happen" part 2 liato presentationMIConnect "Make IoT ideas happen" part 2 liato presentation
MIConnect "Make IoT ideas happen" part 2 liato presentation
 
Wondzorgcentrum
WondzorgcentrumWondzorgcentrum
Wondzorgcentrum
 
Go maggy placeguru
Go maggy placeguruGo maggy placeguru
Go maggy placeguru
 
Atendi @mic vlaanderen
Atendi @mic vlaanderenAtendi @mic vlaanderen
Atendi @mic vlaanderen
 
Terugverdienmodellen in de zorg
Terugverdienmodellen in de zorgTerugverdienmodellen in de zorg
Terugverdienmodellen in de zorg
 
The Power of Sensors in health & healthcare
The Power of Sensors in health & healthcareThe Power of Sensors in health & healthcare
The Power of Sensors in health & healthcare
 
Mi connect 21 oktober 2014 Assisted Living
Mi connect 21 oktober 2014 Assisted LivingMi connect 21 oktober 2014 Assisted Living
Mi connect 21 oktober 2014 Assisted Living
 
The Power of Social in health and healthcare
The Power of Social in health and healthcareThe Power of Social in health and healthcare
The Power of Social in health and healthcare
 
Je startup financieren: hoe pak je het aan?
Je startup financieren: hoe pak je het aan?Je startup financieren: hoe pak je het aan?
Je startup financieren: hoe pak je het aan?
 
25/02/2014 e-Recruitment in de Zorg
25/02/2014 e-Recruitment in de Zorg25/02/2014 e-Recruitment in de Zorg
25/02/2014 e-Recruitment in de Zorg
 
25/02/2014 Natural User Interface - eMenKa
25/02/2014 Natural User Interface - eMenKa25/02/2014 Natural User Interface - eMenKa
25/02/2014 Natural User Interface - eMenKa
 
Healthcare Conference 2013: Games in Healthcare : Evidence Based Game Design ...
Healthcare Conference 2013: Games in Healthcare : Evidence Based Game Design ...Healthcare Conference 2013: Games in Healthcare : Evidence Based Game Design ...
Healthcare Conference 2013: Games in Healthcare : Evidence Based Game Design ...
 
Healthcare Conference 2013 : Digital transformation Healthcare - Jo Caudron
Healthcare Conference 2013 : Digital transformation Healthcare - Jo CaudronHealthcare Conference 2013 : Digital transformation Healthcare - Jo Caudron
Healthcare Conference 2013 : Digital transformation Healthcare - Jo Caudron
 
Healthcare Conference 2013 : Metaforen voor denken, durven, doen, doorzetten ...
Healthcare Conference 2013 : Metaforen voor denken, durven, doen, doorzetten ...Healthcare Conference 2013 : Metaforen voor denken, durven, doen, doorzetten ...
Healthcare Conference 2013 : Metaforen voor denken, durven, doen, doorzetten ...
 
Healthcare Conference 2013 : Het Federale eHealthplatform - Frank Robben
Healthcare Conference 2013 : Het Federale eHealthplatform - Frank RobbenHealthcare Conference 2013 : Het Federale eHealthplatform - Frank Robben
Healthcare Conference 2013 : Het Federale eHealthplatform - Frank Robben
 
Healthcare Conference 2013 : Genes, Clouds and Cancer - dr. Andrew Litt
Healthcare Conference 2013 : Genes, Clouds and Cancer - dr. Andrew LittHealthcare Conference 2013 : Genes, Clouds and Cancer - dr. Andrew Litt
Healthcare Conference 2013 : Genes, Clouds and Cancer - dr. Andrew Litt
 
Serious Games Tom Langhorst
Serious Games Tom LanghorstSerious Games Tom Langhorst
Serious Games Tom Langhorst
 
Serious Games Claudia Put
Serious Games Claudia PutSerious Games Claudia Put
Serious Games Claudia Put
 
Serious Games FLEGA
Serious Games FLEGASerious Games FLEGA
Serious Games FLEGA
 

Recently uploaded

Book Paid Powai Call Girls Mumbai 𖠋 9930245274 𖠋Low Budget Full Independent H...
Book Paid Powai Call Girls Mumbai 𖠋 9930245274 𖠋Low Budget Full Independent H...Book Paid Powai Call Girls Mumbai 𖠋 9930245274 𖠋Low Budget Full Independent H...
Book Paid Powai Call Girls Mumbai 𖠋 9930245274 𖠋Low Budget Full Independent H...Call Girls in Nagpur High Profile
 
Call Girls Horamavu WhatsApp Number 7001035870 Meeting With Bangalore Escorts
Call Girls Horamavu WhatsApp Number 7001035870 Meeting With Bangalore EscortsCall Girls Horamavu WhatsApp Number 7001035870 Meeting With Bangalore Escorts
Call Girls Horamavu WhatsApp Number 7001035870 Meeting With Bangalore Escortsvidya singh
 
Top Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any Time
Top Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any TimeTop Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any Time
Top Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any TimeCall Girls Delhi
 
Call Girls Faridabad Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Faridabad Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Faridabad Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Faridabad Just Call 9907093804 Top Class Call Girl Service AvailableDipal Arora
 
Call Girls Cuttack Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Cuttack Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Cuttack Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Cuttack Just Call 9907093804 Top Class Call Girl Service AvailableDipal Arora
 
Best Rate (Patna ) Call Girls Patna ⟟ 8617370543 ⟟ High Class Call Girl In 5 ...
Best Rate (Patna ) Call Girls Patna ⟟ 8617370543 ⟟ High Class Call Girl In 5 ...Best Rate (Patna ) Call Girls Patna ⟟ 8617370543 ⟟ High Class Call Girl In 5 ...
Best Rate (Patna ) Call Girls Patna ⟟ 8617370543 ⟟ High Class Call Girl In 5 ...Dipal Arora
 
Manyata Tech Park ( Call Girls ) Bangalore ✔ 6297143586 ✔ Hot Model With Sexy...
Manyata Tech Park ( Call Girls ) Bangalore ✔ 6297143586 ✔ Hot Model With Sexy...Manyata Tech Park ( Call Girls ) Bangalore ✔ 6297143586 ✔ Hot Model With Sexy...
Manyata Tech Park ( Call Girls ) Bangalore ✔ 6297143586 ✔ Hot Model With Sexy...vidya singh
 
Call Girls Bareilly Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Bareilly Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Bareilly Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Bareilly Just Call 9907093804 Top Class Call Girl Service AvailableDipal Arora
 
Pondicherry Call Girls Book Now 9630942363 Top Class Pondicherry Escort Servi...
Pondicherry Call Girls Book Now 9630942363 Top Class Pondicherry Escort Servi...Pondicherry Call Girls Book Now 9630942363 Top Class Pondicherry Escort Servi...
Pondicherry Call Girls Book Now 9630942363 Top Class Pondicherry Escort Servi...Genuine Call Girls
 
Call Girls Siliguri Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Siliguri Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Siliguri Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Siliguri Just Call 9907093804 Top Class Call Girl Service AvailableDipal Arora
 
Call Girls Jabalpur Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Jabalpur Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Jabalpur Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Jabalpur Just Call 9907093804 Top Class Call Girl Service AvailableDipal Arora
 
Call Girls Gwalior Just Call 8617370543 Top Class Call Girl Service Available
Call Girls Gwalior Just Call 8617370543 Top Class Call Girl Service AvailableCall Girls Gwalior Just Call 8617370543 Top Class Call Girl Service Available
Call Girls Gwalior Just Call 8617370543 Top Class Call Girl Service AvailableDipal Arora
 
The Most Attractive Hyderabad Call Girls Kothapet 𖠋 6297143586 𖠋 Will You Mis...
The Most Attractive Hyderabad Call Girls Kothapet 𖠋 6297143586 𖠋 Will You Mis...The Most Attractive Hyderabad Call Girls Kothapet 𖠋 6297143586 𖠋 Will You Mis...
The Most Attractive Hyderabad Call Girls Kothapet 𖠋 6297143586 𖠋 Will You Mis...chandars293
 
Premium Bangalore Call Girls Jigani Dail 6378878445 Escort Service For Hot Ma...
Premium Bangalore Call Girls Jigani Dail 6378878445 Escort Service For Hot Ma...Premium Bangalore Call Girls Jigani Dail 6378878445 Escort Service For Hot Ma...
Premium Bangalore Call Girls Jigani Dail 6378878445 Escort Service For Hot Ma...tanya dube
 
Call Girls Tirupati Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Tirupati Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Tirupati Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Tirupati Just Call 9907093804 Top Class Call Girl Service AvailableDipal Arora
 
💎VVIP Kolkata Call Girls Parganas🩱7001035870🩱Independent Girl ( Ac Rooms Avai...
💎VVIP Kolkata Call Girls Parganas🩱7001035870🩱Independent Girl ( Ac Rooms Avai...💎VVIP Kolkata Call Girls Parganas🩱7001035870🩱Independent Girl ( Ac Rooms Avai...
💎VVIP Kolkata Call Girls Parganas🩱7001035870🩱Independent Girl ( Ac Rooms Avai...Taniya Sharma
 
Top Rated Bangalore Call Girls Ramamurthy Nagar ⟟ 9332606886 ⟟ Call Me For G...
Top Rated Bangalore Call Girls Ramamurthy Nagar ⟟  9332606886 ⟟ Call Me For G...Top Rated Bangalore Call Girls Ramamurthy Nagar ⟟  9332606886 ⟟ Call Me For G...
Top Rated Bangalore Call Girls Ramamurthy Nagar ⟟ 9332606886 ⟟ Call Me For G...narwatsonia7
 
Call Girls Coimbatore Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Coimbatore Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Coimbatore Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Coimbatore Just Call 9907093804 Top Class Call Girl Service AvailableDipal Arora
 
Top Rated Hyderabad Call Girls Erragadda ⟟ 6297143586 ⟟ Call Me For Genuine ...
Top Rated  Hyderabad Call Girls Erragadda ⟟ 6297143586 ⟟ Call Me For Genuine ...Top Rated  Hyderabad Call Girls Erragadda ⟟ 6297143586 ⟟ Call Me For Genuine ...
Top Rated Hyderabad Call Girls Erragadda ⟟ 6297143586 ⟟ Call Me For Genuine ...chandars293
 
Call Girls Ooty Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Ooty Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Ooty Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Ooty Just Call 9907093804 Top Class Call Girl Service AvailableDipal Arora
 

Recently uploaded (20)

Book Paid Powai Call Girls Mumbai 𖠋 9930245274 𖠋Low Budget Full Independent H...
Book Paid Powai Call Girls Mumbai 𖠋 9930245274 𖠋Low Budget Full Independent H...Book Paid Powai Call Girls Mumbai 𖠋 9930245274 𖠋Low Budget Full Independent H...
Book Paid Powai Call Girls Mumbai 𖠋 9930245274 𖠋Low Budget Full Independent H...
 
Call Girls Horamavu WhatsApp Number 7001035870 Meeting With Bangalore Escorts
Call Girls Horamavu WhatsApp Number 7001035870 Meeting With Bangalore EscortsCall Girls Horamavu WhatsApp Number 7001035870 Meeting With Bangalore Escorts
Call Girls Horamavu WhatsApp Number 7001035870 Meeting With Bangalore Escorts
 
Top Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any Time
Top Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any TimeTop Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any Time
Top Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any Time
 
Call Girls Faridabad Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Faridabad Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Faridabad Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Faridabad Just Call 9907093804 Top Class Call Girl Service Available
 
Call Girls Cuttack Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Cuttack Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Cuttack Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Cuttack Just Call 9907093804 Top Class Call Girl Service Available
 
Best Rate (Patna ) Call Girls Patna ⟟ 8617370543 ⟟ High Class Call Girl In 5 ...
Best Rate (Patna ) Call Girls Patna ⟟ 8617370543 ⟟ High Class Call Girl In 5 ...Best Rate (Patna ) Call Girls Patna ⟟ 8617370543 ⟟ High Class Call Girl In 5 ...
Best Rate (Patna ) Call Girls Patna ⟟ 8617370543 ⟟ High Class Call Girl In 5 ...
 
Manyata Tech Park ( Call Girls ) Bangalore ✔ 6297143586 ✔ Hot Model With Sexy...
Manyata Tech Park ( Call Girls ) Bangalore ✔ 6297143586 ✔ Hot Model With Sexy...Manyata Tech Park ( Call Girls ) Bangalore ✔ 6297143586 ✔ Hot Model With Sexy...
Manyata Tech Park ( Call Girls ) Bangalore ✔ 6297143586 ✔ Hot Model With Sexy...
 
Call Girls Bareilly Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Bareilly Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Bareilly Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Bareilly Just Call 9907093804 Top Class Call Girl Service Available
 
Pondicherry Call Girls Book Now 9630942363 Top Class Pondicherry Escort Servi...
Pondicherry Call Girls Book Now 9630942363 Top Class Pondicherry Escort Servi...Pondicherry Call Girls Book Now 9630942363 Top Class Pondicherry Escort Servi...
Pondicherry Call Girls Book Now 9630942363 Top Class Pondicherry Escort Servi...
 
Call Girls Siliguri Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Siliguri Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Siliguri Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Siliguri Just Call 9907093804 Top Class Call Girl Service Available
 
Call Girls Jabalpur Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Jabalpur Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Jabalpur Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Jabalpur Just Call 9907093804 Top Class Call Girl Service Available
 
Call Girls Gwalior Just Call 8617370543 Top Class Call Girl Service Available
Call Girls Gwalior Just Call 8617370543 Top Class Call Girl Service AvailableCall Girls Gwalior Just Call 8617370543 Top Class Call Girl Service Available
Call Girls Gwalior Just Call 8617370543 Top Class Call Girl Service Available
 
The Most Attractive Hyderabad Call Girls Kothapet 𖠋 6297143586 𖠋 Will You Mis...
The Most Attractive Hyderabad Call Girls Kothapet 𖠋 6297143586 𖠋 Will You Mis...The Most Attractive Hyderabad Call Girls Kothapet 𖠋 6297143586 𖠋 Will You Mis...
The Most Attractive Hyderabad Call Girls Kothapet 𖠋 6297143586 𖠋 Will You Mis...
 
Premium Bangalore Call Girls Jigani Dail 6378878445 Escort Service For Hot Ma...
Premium Bangalore Call Girls Jigani Dail 6378878445 Escort Service For Hot Ma...Premium Bangalore Call Girls Jigani Dail 6378878445 Escort Service For Hot Ma...
Premium Bangalore Call Girls Jigani Dail 6378878445 Escort Service For Hot Ma...
 
Call Girls Tirupati Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Tirupati Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Tirupati Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Tirupati Just Call 9907093804 Top Class Call Girl Service Available
 
💎VVIP Kolkata Call Girls Parganas🩱7001035870🩱Independent Girl ( Ac Rooms Avai...
💎VVIP Kolkata Call Girls Parganas🩱7001035870🩱Independent Girl ( Ac Rooms Avai...💎VVIP Kolkata Call Girls Parganas🩱7001035870🩱Independent Girl ( Ac Rooms Avai...
💎VVIP Kolkata Call Girls Parganas🩱7001035870🩱Independent Girl ( Ac Rooms Avai...
 
Top Rated Bangalore Call Girls Ramamurthy Nagar ⟟ 9332606886 ⟟ Call Me For G...
Top Rated Bangalore Call Girls Ramamurthy Nagar ⟟  9332606886 ⟟ Call Me For G...Top Rated Bangalore Call Girls Ramamurthy Nagar ⟟  9332606886 ⟟ Call Me For G...
Top Rated Bangalore Call Girls Ramamurthy Nagar ⟟ 9332606886 ⟟ Call Me For G...
 
Call Girls Coimbatore Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Coimbatore Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Coimbatore Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Coimbatore Just Call 9907093804 Top Class Call Girl Service Available
 
Top Rated Hyderabad Call Girls Erragadda ⟟ 6297143586 ⟟ Call Me For Genuine ...
Top Rated  Hyderabad Call Girls Erragadda ⟟ 6297143586 ⟟ Call Me For Genuine ...Top Rated  Hyderabad Call Girls Erragadda ⟟ 6297143586 ⟟ Call Me For Genuine ...
Top Rated Hyderabad Call Girls Erragadda ⟟ 6297143586 ⟟ Call Me For Genuine ...
 
Call Girls Ooty Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Ooty Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Ooty Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Ooty Just Call 9907093804 Top Class Call Girl Service Available
 

Healthcare Conference 2013 : Toekomstvisie op ICT in de gezondheidszorg - prof. dr. Bart De Moor

  • 1. Toekomstvisie op ICT in de gezondheidszorg Prof. Dr. Bart De Moor Care for Innovation Healthcare Conference 12 November 2013, Affligem www.esat.kuleuven.be/stadius www.kuleuven.be/iminds/fh
  • 2. Contents • Disruptive science and technology • 3P/4P Medicine – Preventive, Predictive, Personalized, Participatory – Patients, Professionals, Policy Makers • Exemplary cases • Future Trends
  • 3. www: max 19 clicks !
  • 4. 1 million = 1 000 000 1 billion = 1 000 000 000 1 trillion = 1 000 000 000 000 1 quadrillion = 1 000 000 000 000 000 1 kB = 1 000 1 MB = 1 000 000 1 GB = 1 000 000 000 1 TB = 1 000 000 000 000 1 PB = 1 000 000 000 000 000 1 TB = large university library = 212 DVD discs = 1430 CDs = 3 year music in CD quality
  • 5. Connectivity We are always CONNECTED and FAST! Throughput NOT sufficient for moving around Big Data 5
  • 6. Tsunami of data from progress in technology GS-FLX Roche Applied Science 454 Sequencers Computer Tomography Magnetic resonance Microarrays (DNA chips) ACACATTAAATCTTATATGC TAAAACTAGGTCTCGTTTTA GGGATGTTTATAACCATCTT TGAGATTATTGATGCATGGT TATTGGTTAGAAAAAATATA CGCTTGTTTTTCTTTCCTAG GTTGATTGACTCATACATGT GTTTCATTGAGGAAGGAAC TTAACAAAACTGCACTTTTT TCAACGTCACAGCTACTTTA AAAGTGATCAAAGTATATCA AGAAAGCTTAATATAAAGAC ATTTGTTTCAAGGTTTCGTA AGTGCACAATATCAAGAAG ACAAAAATGACTAATTTTGT TTTCAGGAAGCATATATATT ACACGAACACAAATCTATTT TTGTAATCAACACCGACCAT GGTTCGATTACACACATTAA ATCTTATATGCTAAAACTAG GTCTCGTTTTAGGGATGTTT ATAACCATCTTTGAGATTAT TGATGCATGGTTATTGGTTA GAAAAAATATACGCTTGTTT TTCTTTCCTAGGTTGATTGA Mass spectrometry
  • 7. Genome data • Human genome project – Initial draft: June 2000 – Final draft: April 2003 – 13 year project – $300 million value with 2002 technology • Personal genome YearΩ – June 1, 2007 – Genome of James Watson, co-discoverer of DNA double helix, is sequenced • $1.000.000 • Two months • €1000-genome – Expected 2012-2020 1,00E+11 1,00E+10 1,00E+09 1,00E+08 1,00E+07 1,00E+06 1,00E+05 1,00E+04 1,00E+03 1,00E+02 1,00E+01 1,00E+00 1,00E-01 1,00E-02 1,00E-03 1,00E-04 1,00E-05 1,00E-06 1,00E-07 Cost per base pair Genome cost 1990 1995 2000 2002 2005 2007 Cost per base pair 2010 2015 Genome cost 1990 10 3E+10 1995 1 3.000.000.000 2000 0.2 600.000.000 2002 0.09 270.000.000 2005 0.03 90.000.000 2007 0.000333333 1.000.000 2010 3.33333E-06 10000 2015 0.0000001 300 7
  • 8. index of 20 million Biomedical PubMed records 1 slice mouse brain MSI at 10 μm resolution 81 GigaByte raw NGS data of 1 full genome sequencing all newborns by 2020 (125k births / year) 125 PetaByte / year 1 TeraByte 23 GigaByte 1 kB = 1000 1 MB = 1 000 000 1 GB = 1 000 000 000 1 TB = 1 000 000 000 000 1 PB = 1 000 000 000 000 000 1 small animal image 1 CDROM 750 MegaByt e 1 GigaByte PACS UZ Leuven 1,6 PetaByte Genomics core HiSeq 2000 full speed exome sequencing 1 TeraByte / week 8
  • 9. Contents • Disruptive science and technology • 3P/4P Medicine – Preventive, Predictive, Personalized, Participatory – Patients, Professionals, Policy Makers • Exemplary cases • Future Trends
  • 10. ICT tools for decision support ICT to support 3P decision makers in health care • Professionals (clinicians, biomedical researchers …) • exploit data for more effective medicine • Patient • patient-centered care for empowered patients • Policy Maker (mutualities, health insurers, social security, governments, hospital management …) • Smart, data-driven, evidence-based health care system policies 10
  • 11. ICT contributes to P4 medicine • Personalized: "customized" diagnosis and treatment, right drug for the right patient at the right time • Preventive: prevention and early diagnosis • Predictive: determine risk profiles, predict progression and outcome • Participatory: correct and complete information for the patient to participate in the decision process, selfmanagement 11
  • 12. Rationales for ICT & Health -Improve quality performance of health decision/diagnosis systems -Support individual medical doctor -Avoid/decrease number of medicial errors -Web portal for Evidence Based Medicine -Information sharing among doctors -avoid/monitor patient (s)hopping behavior -Global Medical File per patient -Interoperability -Deal with ‘empowerment of the patient’: Patient-centric health care -Medical care in 4P: personalized, preventive, predictive, participatory -Increasing trend for ‘customized’’personalized’ medicine -Improve transparancy and consistency -Deal/cope with ‘professional’ (chronical) patients (heart, diabetes, cancer,…) -Improve patient mobility -Cost effectiveness of the health care system -Ageing population: -EU 2050: 65+  +70%; 80+  +180% -Monitor overconsumption -Improve transparancy -Detect abnormalities in diagnosis/therapy/… -Cope with tsunami of available information and data (clinical, population, ….)
  • 13. Contents • Disruptive science and technology • 3P/4P Medicine – Preventive, Predictive, Personalized, Participatory – Patients, Professionals, Policy Makers • Exemplary cases • Future Trends
  • 14. NXT_SLEEP: Next generation sleep monitoring platform 14
  • 15. FallRisk: Intelligent services in view of prevention, risk evaluation and detection of fall incidents 15
  • 16. Blood Glucose Control @ ICU  10 mio adult ICU patients / year (EU + US) (1-2 bio $ market)  Intensive Care Unit UZ Leuven studies: Tight Glycemic Control (TGC) in intensive care unit lowers mortality  LOGIC-Insulin: semi-automatic control system that advises nurse on insulin dosage and blood sampling interval aiming at TGC and avoiding hypoglycemia  clinical trial: compared with expert nurses, LOGIC-Insulin showed improved efficacy of TGC without increasing rate of hypoglycemia  multicentre clinical trial Q3 2013; spin-off in preparation 16
  • 17. IOTA app: ovarian tumour malignancy: population based / standardized IOTA Models: Standardize ultrasonographic endometrial tumor analysis models giving an indication of the probability of malignancy of an ovarian tumour based on 6 to 12 observed parameters IOTA app available in iTunes app store and on http://homes.esat.kuleuven.be/~sistawww/biomed/iota/ 17
  • 18. IOTA app: Clinical Decision Support  goal = making it easier to diagnose ovarian cancer  help clinicians take decisions on diagnosis, prognosis and therapy response  make use of patient data ánd population information (patient biobank & database, literature …)  build mathematical model on data and use this model to predict patient outcome: formalized way of analyzing biomedical data instead of interpretation of clinical parameters based on a clinician’s expert knowledge  model method can be varied: logistic regression, artifical neural networks, Support Vector Machines (SVM), Bayesian networks … Patient history Tumor characteristics Clinician Ultrasound characteristics Tumor markers Diagnosis Prognosis Model Response to therapy
  • 19. IOTA – performance comparison Performance of an expert Performance of IOTA models Performance of non-experts Performance of old models
  • 20. Microarrays – DNA-chips Test Ref. High Low Low High High High Low Low
  • 21. Genetic classification of leukemia 12600 genes / 72 patients / 3 types of leukemia (AML/ ALL/MLL) Data matrix Find the pattern Hidden pattern Pattern validation
  • 22. 18 / 21 patients with 87 gene fingerprint for AML 19 / 25 patients with 80 gene fingerprint for ALL 14 / 17 patients with 62 gene fingerprint for MLL
  • 23. ALL/AML/MLL biomarkers PCA © Armstrong SA et al. Nat Genet. 2002 Jan;30(1):41-7. 12 600 genes 72 patients: - 28 Acute Lymphoblastic Leukemia (ALL) - 24 Acute Myeloid Leukemia (AML) - 20 Mixed Linkage Leukemia (MLL) 3 patients for each class used as test set
  • 24. Aerts et al, Nature Biotechnology, 2006 24
  • 25. 25
  • 26. 26
  • 27. Variant prioritization by genomic data fusion: including disease phenotypes Figure – Classification scenarios. Receiver-operator (A and C) and Precision-Recall (B and D) curves for five classifiers tested against test sets comparing disease-causing variants to either rare non-disease-causing variants (A and B) or common polymorphisms (C and D). based on Random Forests 20x more accurate than state of the art Sifrim, Popovic et al, Nature Methods, 2013d
  • 28. Mass Spectral Imaging • Mass spectral imaging allows • • • • Screening and mapping of hundreds of biomolecules in a complex organic tissue section Does not require any prior information nor labeling Visualization of the spatial distribution of these molecules Computation complexity • • The structure of the generated data is complex Large size and high dimensionality in collaboration with SyBioMa, KU Leuven Facility for Systems Biology based Mass Spectrometry, MIRC KU Leuven & Caprioli Lab (Vanderbilt University, VS)
  • 29. Contents • Disruptive science and technology • 3P/4P Medicine – Preventive, Predictive, Personalized, Participatory – Patients, Professionals, Policy Makers • Exemplary cases • Future Trends
  • 30. Moore’s law: Computing power doubles every 18 months (56 % growth rate) ‘Understand’ ? 6 10 9 Operations/second 5 10 9 LUI 4 10 9 3D games 3 10 9 2 10 9 1 10 9 Bookkeeping 0 1975 1980 Audio 1985 1990 Video 1995 Year 2000 2005 2010
  • 31. Body area networks EEG POTS Vision www Network positioning glucose Cellular Transducer Nodes Hearing ECG Blood pressure DNA protein Implants WLAN Personal Assistant 31
  • 32. 1953 Crick and Watson: DNA Double Helix 2000 Venter, Collins: Humane genome
  • 33. E D. Green et al. Nature 470, 204-213 (2011) doi:10.1038/nature09764 Towards effective genomic medicine
  • 34. building on expertise in big data & machine learning BENCH is used in ca. 50 accredited genetic labs worldwide Heverlee + US office routine diagnostics tools for non-IT users first diagnostics grade solution for Next Generation Sequencing data based diagnostics in the world originating from research in rare genetic disorders in close collaboration with Centre Human Genetics UZ Leuven 34
  • 35. Systems biology: ‘reverse engineering’ ‘high throughput ‘data genome transcriptome proteome metabolome interactome 35
  • 36. Zebrafish Neural Circuits  understand dynamical behaviour of neural circuits in Zebrafish through system identification u y = f (u ) y Input RAW STIMULUS Output BRAIN Model Identification Algorithm REACTION - in collaboration with NERF
  • 37. Signal Processing and Classification for Magnetic Resonance Spectroscopy Applied to Brain Tumor Diagnosis Single-voxel MRS MRS quantification NAA Myo Cr PCho Glu Lac Lip1 Lip2 Ala Glc Metabolite concentrations Tau Biomarker of disease Metabolite maps Multi-voxel MRS MRS quantification using spatial information
  • 38. Seizure detection incorporating structural information from the multichannel EEG Representation of EEG data in higher order arrays: features channels frequency channels features channels channels time Classifier matrix Goal: Exploit the inherent structure of the EEG signals using novel matrix and tensor-based machine learning solutions: – Nuclear norm regularization – Tensorial kernels
  • 39. Collaboration IMEC/NERF: neuroprobes MULTI-FUNCTIONAL INTEGRATED NEUROPROBES … ADVANCED & AUTOMATED MULTICHANNEL SIGNAL PROCESSING.. …. INTEGRATED END-USER FEEDBACK
  • 40. Synthetic biology: design new functional life Bacterium detecting cancer cells Output Input Reset Memory Filter Cell Death InverTimer http://2013.igem.org/Team:KU_Leuven
  • 41. Obama http://www.whitehouse.gov/blog/09/04/27/The-Necessity-of-Science/ … The Recovery Act will support the long overdue step of computerizing America's medical records, to reduce the duplication, waste and errors that cost billions of dollars and thousands of lives. But it's important to note, these records also hold the potential of offering patients the chance to be more active participants in the prevention and treatment of their diseases. We must maintain patient control over these records and respect their privacy. At the same time, we have the opportunity to offer billions and billions of anonymous data points to medical researchers who may find in this information evidence that can help us better understand disease. …. Because of recent progress –- not just in biology, genetics and medicine, but also in physics, chemistry, computer science, and engineering –- we have the potential to make enormous progress against diseases in the coming decades. …. 41
  • 42. Decision Support Analytics for Professionals, Patients & Policy makers bart.demoor@esat.kuleuven.be www.esat.kuleuven.be/stadius www.kuleuven.be/iminds/fh

Editor's Notes

  1. data tsunami (hoeveelheid + nood aan interpretatie) decision makers evenzeer van toepassing in andere domeinen (logistiek, milieu…)transferzone‘support’ want niet louter analyse‘support’ want we nemen de beslissing niet voor hen, het is ondersteunend, verantwoordelijkheid blijft bij 3Ps
  2. So, where the ultra connected and the ultra personal – all the things you can measure or register about yourself – come together, the future of health care is made possible.We can tap into the whole of medical knowledge to find the perfect solution for you.At this point, something called ‘P4 medicine’ becomes possible.Personalized: "customized" diagnosis and treatment Preventive: prevention is always better than curation, tailored to specific patientsPredictive: precise predictions with modern technology, determine risk profiles, predict progression and outcomeParticipatory: correct and complete information to participate in the decision processBut to make this possible, it’s very important that we share our data. ‘You share, we care’. Because only by using this whole of data and knowledge, we can improve health care.There are a lot of challenges to enable this shift in health care, such as security and privacy issues when handling health care data, networks and connections, etc…The big challenge we see here and where the future health department is working on is : how make use of all the DATA in this system?
  3. Publication: LOGIC-InsulinAlgorithm–Guided Versus Nurse-DirectedBlood Glucose ControlDuringCriticalIllness. Van Herpe et al. Diabetes Care. PublishAhead of Print, published online September 6, 2012Tom Van Herpe Leuven studies (2001,2006,2009): Tight Glycemic Control (TGC) in intensive care unit lowers mortality Follow-up multi-centre studies: No confirmation Multiple reasons: not reaching target BG overlap BG between study groups underpowered continuous/bolus insulin infusion inaccurate glucose monitoring tools arterial/venous/capillary blood sampling sites strict ‘if-then’ algorithmLOGIC-Insulin control system:semi-automatic control system that advises the nurse on insulin dosage and blood sampling interval aiming at TGC and avoiding low blood glucose values (hypoglycemia)Collaboration ESAT and ICU Gasthuisberg LOGIC-I clinical trial To demonstrate the non-inferiority (equivalence) of the computer algorithm (LOGIC-Insulin) against standard nurse-directed protocolSingle-centre (University Hospitals Leuven) Compared with expert nurses, LOGIC-Insulin improved efficacy of TGC without increasing rate of hypoglycemia.
  4. Pathologies:ALS, liver and kidney cancer, technique generally applicable to different pathologiesChallenges:Very large datasets (up to tens of GBs for a single experiment)Complex data with high dimensionalityMass spectral imaging allows:Screening and mapping of hundreds of biomolecules in a complex organic tissue section.Does not require any prior information nor labeling.Visualization of the spatial distribution of these molecules.Computation complexity:The structure of the generated data is complex.Large size and high dimensionalityCollaborations:MIRC (KU Leuven, IBBT), Caprioli Lab (Vanderbilt University, VS)
  5. One of the main research lines of the SISTA research group is personal genomics. When the human genome was first sequenced, it took 13 years and 3 billion dollar. Now, you can have your own personal genome for 1000 euro and in only a few days. Having this information at hand poses tremendous opportunities. But it’s like looking for a needle in a hay stack, since most of the information in our genome is noise, or we just don’t know yet what it means. Cartagenia builds software to find and interpret the variations in the genome causing genetic disorders.Selected SISTA-bioi publicationsAnnotate-It- Annotate-it: a Swiss-knife approach to annotation, analysis and interpretation of single nucleotide variation in human disease. Sifrim A, Van Houdt JK, Tranchevent LC, Nowakowska B, Sakai R, Pavlopoulos GA, Devriendt K, Vermeesch JR, Moreau Y, Aerts J.Genome Med. 2012 Sep 26;4(9):73. [Epub ahead of print] PMID: 23013645 [PubMed - as supplied by publisher]- Heterozygous missense mutations in SMARCA2 cause Nicolaides-Baraitser syndrome. Van Houdt JK, Nowakowska BA, Sousa SB, van Schaik BD, Seuntjens E, Avonce N, Sifrim A, Abdul-Rahman OA, van den Boogaard MJ, Bottani A, Castori M, Cormier-Daire V, Deardorff MA, Filges I, Fryer A, Fryns JP, Gana S, Garavelli L, Gillessen-Kaesbach G, Hall BD, Horn D, Huylebroeck D, Klapecki J, Krajewska-Walasek M, Kuechler A, Lines MA, Maas S, Macdermot KD, McKee S, Magee A, de Man SA, Moreau Y, Morice-Picard F, Obersztyn E, Pilch J, Rosser E, Shannon N, Stolte-Dijkstra I, Van Dijck P, Vilain C, Vogels A, Wakeling E, Wieczorek D, Wilson L, Zuffardi O, van Kampen AH, Devriendt K, Hennekam R, Vermeesch JR. Nat Genet. 2012 Feb 26;44(4):445-9, S1. doi: 10.1038/ng.1105. PMID: 22366787 [PubMed - indexed for MEDLINE]Endeavour- Moreau Y, Tranchevent LC. (2012) Computational tools for prioritizing candidate genes: boosting disease gene discovery, Nat Rev Genet.- Thienpont B, Zhang L, Postma AV, Breckpot J, Tranchevent LC, Van Loo P, Møllgård K, Tommerup N, Bache I, Tümer Z, van Engelen K, Menten B, Mortier G, Waggoner D, Gewillig M, Moreau Y, Devriendt K, Larsen LA. (2010) Haploinsufficiency of TAB2 causes congenital heart defects in humans. Am J Hum Genet.- Aerts S, Vilain S, Hu S, Tranchevent LC, Barriot R, Yan J, Moreau Y, Hassan BA, Quan XJ. (2009) Integrating computational biology and forward genetics in Drosophila. PLoS Genet.- Aerts S, Lambrechts D, Maity S, Van Loo P, Coessens B, De Smet F, Tranchevent LC, De Moor B, Marynen P, Hassan B, Carmeliet P, Moreau Y. (2006) Gene prioritization through genomic data fusion, Nat Biotechnol.PINTANitschet al., NucleicAcidsResearch(2011); Nitschet al., BMC Bioinformatics(2010); Nitschet al., PLoS ONE (2009).CHDWikiBarriot R et al., Collaboratively charting the gene-to-phenotype network of human congenital heart defects. Genome Med. 2010 Mar 1;2(3):16homes.esat.kuleuven.be/~bioiuser/chdwiki/OtherThijs G, Lescot M, Marchal K, Rombauts S, De Moor B, Rouzé P, Moreau Y. A higher-order background model improves the detection of promoter regulatory elements by Gibbs sampling. Bioinformatics. 2001 Dec;17(12):1113-22. PubMed PMID: 11751219 (citations: 216)Lage K, Karlberg EO, Størling ZM, Olason PI, Pedersen AG, Rigina O, Hinsby AM, Tümer Z, Pociot F, Tommerup N, Moreau Y, Brunak S. A human phenome-interactome network of protein complexes implicated in genetic disorders. Nat Biotechnol. 2007 Mar;25(3):309-16. PubMed PMID: 17344885 (citations: 241)Vanneste E, Voet T, Le Caignec C, Ampe M, Konings P, Melotte C, Debrock S, Amyere M, Vikkula M, Schuit F, Fryns JP, Verbeke G, D'Hooghe T, Moreau Y, Vermeesch JR. Chromosome instability is common in human cleavage-stage embryos. Nat Med. 2009 May;15(5):577-83. Epub 2009 Apr 26. PubMed PMID: 19396175 (citations: 96)Firth HV, Richards SM, Bevan AP, Clayton S, Corpas M, Rajan D, Van Vooren S, Moreau Y, Pettett RM, Carter NP. DECIPHER: Database of Chromosomal Imbalance and Phenotype in Humans Using Ensembl Resources. Am J Hum Genet. 2009 Apr;84(4):524-33. Epub 2009 Apr 2. PubMed PMID: 19344873; PubMed Central PMCID: PMC2667985 (citations: 64)Le Caignec C, Spits C, Sermon K, De Rycke M, Thienpont B, Debrock S, Staessen C, Moreau Y, Fryns JP, Van Steirteghem A, Liebaers I, Vermeesch JR. Single-cell chromosomal imbalances detection by array CGH. Nucleic Acids Res. 2006 May 12;34(9):e68. PubMed PMID: 16698960 (citations: 80)
  6. Mauricio AgudeloKeywordsNeural circuits System identification Machine learningZebrafishClusteringResearch Objectives: The aim of this research is to characterize and understand the dynamical behavior of neural circuits by using first principles modeling and System identification techniques. This consists of a theoretical work on understanding and modeling neural data, as well as experimental validation of the hypotheses driven by theoretical work on living brains.Challenges (workpackages): Identification of functional modules within the zebrafish brain. Characterization of the dynamical behavior of the functional modules using system identification techniques. Investigation of three types of generalization properties of the developed models, namely transferability to other circuits, modularity and expansion of circuits.