SlideShare a Scribd company logo
1 of 35
© The Children's Mercy Hospital, 2014. 11/14
Center for Genomic MedicineCenter for Genomic Medicine
Joshua E. Petrikin, MDJoshua E. Petrikin, MD
Director of Neonatal GenomicsDirector of Neonatal Genomics
Genomic Medicine in the NICUGenomic Medicine in the NICU
© The Children's Mercy Hospital, 2014. 03/14
2
© The Children's Mercy Hospital, 2014. 11/14
DisclosuresDisclosures
• I have no conflicts of interest to
disclose
• I will not be discussing off label
medication uses
© The Children's Mercy Hospital, 2014. 03/14
3
© The Children's Mercy Hospital, 2014. 11/14
OverviewOverview
• Discuss past and current genetic
testing
• Define Genomic Medicine
• Speculate on future directions for
genomics
• Elucidate some ethical considerations
in Neonatal genomic testing
© The Children's Mercy Hospital, 2014. 03/14
4
© The Children's Mercy Hospital, 2014. 11/14
Genetic TestingGenetic Testing
• The analysis of human DNA, RNA,
chromosomes, proteins, and certain
metabolites in order to detect heritable
disease-related genotypes, mutations,
phenotypes or karyotypes for clinical
purposes.
• Prenatal, newborn, and carrier screening
included.
© The Children's Mercy Hospital, 2014. 03/14
5
© The Children's Mercy Hospital, 2014. 11/14
http://www.indiana.edu/~oso/lessons/Genetics/MyFamily2.html
© The Children's Mercy Hospital, 2014. 03/14
6
© The Children's Mercy Hospital, 2014. 11/14
Genetic Testing:Genetic Testing:
Chromosome KaryotypeChromosome Karyotype
© The Children's Mercy Hospital, 2014. 03/14
7
© The Children's Mercy Hospital, 2014. 11/14
ExampleExample
Patient #1 is a 10 year old girl with short stature and a broad neckPatient #1 is a 10 year old girl with short stature and a broad neck
© The Children's Mercy Hospital, 2014. 03/14
8
© The Children's Mercy Hospital, 2014. 11/14
Microarrays aka “CHIPS”
• Short oligos are
attached to a solid
support
(microarray).
• Hybridize with
fluorescently
labeled PCR
products
containing SNP of
interest.
• Can analyze many
mutations at once
• Currently > 740k
SNP per chip
© The Children's Mercy Hospital, 2014. 03/14
9
© The Children's Mercy Hospital, 2014. 11/14
Array-CGH
(comparative genomic hybridization)
© The Children's Mercy Hospital, 2014. 03/14
10
© The Children's Mercy Hospital, 2014. 11/14
Deletion on array
Muscular Dystrophy
• Since 65-85% of cases
are due to deletions,
start with deletion
testing.
• The lab we use for
dystrophin deletion
testing uses an “exon
array” with high density
probes spanning entire
dystrophin gene.
• Case 4 patient has a
deletion including
exons 44-48 (not shown
here).
• If no deletion
detectable, sequence
entire DMD gene (79
exons!).
© The Children's Mercy Hospital, 2014. 03/14
11
© The Children's Mercy Hospital, 2014. 11/14
Genomic MedicineGenomic Medicine
• A structured approach
to disease diagnosis &
management that
prominently features
genome sequence
information.
• Decoding Genomes to
diagnose diseases better
and help choose the best
treatments
© The Children's Mercy Hospital, 2014. 03/14
12
© The Children's Mercy Hospital, 2014. 11/14
Monogenic DiseasesMonogenic Diseases
J Clin Invest. 2008;118:1590-1605. doi:10.1172/JCI34772.
© The Children's Mercy Hospital, 2014. 03/14
13
© The Children's Mercy Hospital, 2014. 11/14
7,700 monogenic diseases7,700 monogenic diseases
• 4,174 causal genes known
• Affect 4% of children
• Cause 20% of infant deaths
• Cause 17% of pediatric hospitalizations
• Genome Variants determine phenotype
• Genome variants = individual changes in the DNA
sequence from “normal”
• Proving ground for genomic medicine
• 20 year experience with sequence-based diagnosis
• 1-gene-at-a-time
• Slow (months – years)
• Expensive ($2500 - $10,000)
• Requires right gene to be nominated
© The Children's Mercy Hospital, 2014. 03/14
14
© The Children's Mercy Hospital, 2014. 11/14
Neonatal Intensive CareNeonatal Intensive Care
• 4.1 million babies born in US / year
• 1 in 20 admitted to NICU
• 220,000 (5.4%) NICU admissions/year
• 30% due to congenital abnormalities
• 19,000 neonatal deaths/year
• 6.8/1000
• 22% due to congenital abnormalities
• $3,000 - $8,000 per day
© The Children's Mercy Hospital, 2014. 03/14
15
© The Children's Mercy Hospital, 2014. 11/14
Neonatal Diseases are UniqueNeonatal Diseases are Unique
• Emergencies
• Rapid results can guide management
• Largely stereotyped presentation
• Broad differential diagnosis workups
• Considerable genetic heterogeneity
• Molecular diagnoses almost never made
© The Children's Mercy Hospital, 2014. 03/14
16
© The Children's Mercy Hospital, 2014. 11/14
Neonatal Genomic Medicine
NICU
$3,000 - $8,000 per day
Rapid Genome Sequence
• Test for things too rare and/or
heterogeneous to be considered
• Identification of genotype before
phenotype fully manifests
• Diagnose or rule out known
mutations
• Reduce unnecessary tests &
empiric therapies
• Improve prognostic assessment,
genetic counseling
• Unique opportunity to intervene
before irreversible disease
processes manifests with
irreversible symptoms
© The Children's Mercy Hospital, 2014. 03/14
17
© The Children's Mercy Hospital, 2014. 11/14
Genomic Sequencing – Sanger
© The Children's Mercy Hospital, 2014. 03/14
18
© The Children's Mercy Hospital, 2014. 11/14
Human GenomeHuman Genome
3.2 billion base pairs, 6.4 billion nt
Equal to typing 60 words/min x 8hrs/day x 50 years
20,000 genes (just 2% of genome)
which encode 100,000 proteins
7700 Monogenic diseases
© The Children's Mercy Hospital, 2014. 03/14
19
© The Children's Mercy Hospital, 2014. 11/14
© The Children's Mercy Hospital, 2014. 03/14
20
© The Children's Mercy Hospital, 2014. 11/14
Primary Analysis – Base CallingPrimary Analysis – Base Calling
• In Illumina sequencing, each sequencing cycle produces 4 images, one for
each base, where clusters that show that base are lit up
• Base calling done by
• detecting the coordinates of each cluster
• measuring the intensity of the signal at each cluster for each base
• determining which base has the strongest signal
• strength of call results in a quality score for each base
Whiteford N
et al.
Bioinformatics
2009;25:
2194-2199
http://www.
clinchem.or
g/content/5
5/4/641/F4.l
arge.jpg
© The Children's Mercy Hospital, 2014. 03/14
21
© The Children's Mercy Hospital, 2014. 11/14
Shotgun SequencingShotgun Sequencing
• Shotgun sequencing techniques rely on breaking long strands of DNA
into fragments and then sequencing them individually
• NextGen Sequencing is massively parallel, ultra high throughput
• HiSeq 2500 run produces 1 trillion base pairs in 8 billion 125 bp reads
• Interpreting an individual’s DNA sequence means taking all the pieces
and putting them together into some meaningful context
© The Children's Mercy Hospital, 2014. 03/14
22
© The Children's Mercy Hospital, 2014. 11/14
Sequence Alignment – Read MappingSequence Alignment – Read Mapping
AGCTATTTATGACCATGATTTTTCTTTTTTTATTTTTTCCATATAAGATAAGATGGAGACGGTCTTTTCTTGTGAGTCTGTTTTTCTGTATTCA
AGCTATTTATGACCATGATTTTTCTTTTTTTATTTTTTCCATATAAGATA
TTTATGACCATGATTTTTCTTTTTTTATTTTTTCCATATAAGATAAGATG
GACCATGATTTTTCTTTTTTTATTTTTTCCATNTAAGATAAGATGGAGAC
TGATTTTTCTTTTTTTATTTTTTCCATATAAGATAAGATNGAGACGGTCT
TTTCTTTTTTTATTTTTTCCATATAAGATCAGATGAAGACGGTCTTTTCTTG
CCATATAAGATAAGATGGAGACGGTCTTTTCTTGTGAGTCTGTTTTTCTG
TATAAGATAAGATGGAGACGGTCTTTTCTTGTGAGTCTGTTTTTCTGTAT
TAAGATAAGATGGAGACGGTCTTTTCTTGTGAGTCTGTTTTTCTGTATTC
• Most human sequence analysis is done by mapping reads to the
human reference genome
• Alignment results are stored in a compact standard file format called
Sequence Alignment Map (SAM) or its binary version BAM
• Each alignment records:
• read position in reference (e.g. chr10:1000-1125)
• mismatch between read and reference
• strand read aligned to
• mapping quality score
© The Children's Mercy Hospital, 2014. 03/14
23
© The Children's Mercy Hospital, 2014. 11/14
Alignment Visualization in theAlignment Visualization in the
Integrative Genomics Viewer (IGV)Integrative Genomics Viewer (IGV)
• Red reads pointing right aligned to the forward strand
• Blue reads pointing left aligned to the complement strand
© The Children's Mercy Hospital, 2014. 03/14
24
© The Children's Mercy Hospital, 2014. 11/14
SubstitutionsSubstitutions
© The Children's Mercy Hospital, 2014. 03/14
25
© The Children's Mercy Hospital, 2014. 11/14
DeletionsDeletions
© The Children's Mercy Hospital, 2014. 03/14
26
© The Children's Mercy Hospital, 2014. 11/14
Infant CMH487
Diagnosis!
Bioinformatic Filter 5
© The Children's Mercy Hospital, 2014. 03/14
27
© The Children's Mercy Hospital, 2014. 11/14
Newborn TestingNewborn Testing
• ““If medical or psychosocial benefits of
genetic test will not accrue until adulthood,
as in case of carrier status or adult-onset
diseases, genetic testing should be
deferred…”
• Guides gene analysis/interpretation
• Do not analyze newborns for carrier status or
adult conditions or off-target diseases
© The Children's Mercy Hospital, 2014. 03/14
28
© The Children's Mercy Hospital, 2014. 11/14
SecondarySecondary Findings
• Also called incidental or unanticipated
findings
• Highly likely, if not inevitable, whenever
WGS/WES is performed
• Examples include:
• finding of a previously unsuspected high risk of
future disease
• discovery of a disorder in an asymptomatic
individual
• detection of carrier status
© The Children's Mercy Hospital, 2014. 03/14
29
© The Children's Mercy Hospital, 2014. 11/14
Incidental Findings inIncidental Findings in
Neonates?Neonates?
• Mandate to avoid violating a child’s right to
an open future?
• Considerations
• Parents of critically-ill children “just tell me where
to sign”
• Feasibility of reporting secondary findings -
accuracy, expectations, defining the scope
• Impacts:
• Test design (SSAGA)
• Consent
• Communication of results
© The Children's Mercy Hospital, 2014. 03/14
30
© The Children's Mercy Hospital, 2014. 11/14
Francis Collins, Director of the NIH,Francis Collins, Director of the NIH,
Wall Street Journal, July 8, 2014
 "Over the course of the next few decades,
the availability of cheap, efficient DNA
sequencing technology will lead to a
medical landscape in which each baby's
genome is sequenced, and that
information is used to shape a lifetime of
personalized strategies for disease
prevention, detection and treatment."
© The Children's Mercy Hospital, 2014. 03/14
31
© The Children's Mercy Hospital, 2014. 11/14
Not quite inexpensive
enough for generalized
newborn screening—
but right up there for
diagnosis of ill infants
in the NICU
© The Children's Mercy Hospital, 2014. 03/14
32
© The Children's Mercy Hospital, 2014. 11/14
Adapted from Sir George Poste,
circa1999
© The Children's Mercy Hospital, 2014. 03/14
33
© The Children's Mercy Hospital, 2014. 11/14
Take Home PointsTake Home Points
• Genomic Medicine hold promise, but is
not the final answer
• Proteinomics, metabolomics, epigenetics
• WGS compares most of a patient’s
genome against a reference genome
• Deletions, insertions, triplet repeats
centrimeric anomalies undetected
• The focus on care will shift from disease
centered to patientcentered
© The Children's Mercy Hospital, 2014. 03/14
34
© The Children's Mercy Hospital, 2014. 11/14
Take Home PointsTake Home Points
• Whole genome sequencing is not ready for
prime time use for newborn screening
• Don’t invest in WGS equipment and
bioinformatics tools yet
• Ethical questions arise as to the use of WGS
for NBS
• Adult onset disorders
• Variants of unknown significance
• Paternity
© The Children's Mercy Hospital, 2014. 03/14
35
© The Children's Mercy Hospital, 2014. 11/14
Children’s Mercy Hospital
Center for Pediatric Genomic Medicine
Supported By
Clements
Foundation
Marion Merrell Dow
Foundation
National Institutes of
Health
WT Kemper
Foundation
Patton Trust
Director Dr. Stephen Kingsmore

More Related Content

What's hot

Session 6C - MHS Vision
Session 6C - MHS VisionSession 6C - MHS Vision
Session 6C - MHS Vision
MedXellence
 
Kirsten Edwards_CV_Physician_Assistant
Kirsten Edwards_CV_Physician_AssistantKirsten Edwards_CV_Physician_Assistant
Kirsten Edwards_CV_Physician_Assistant
Kirsten Edwards
 
Cloud envision ivf electronic medical records
Cloud envision ivf electronic medical recordsCloud envision ivf electronic medical records
Cloud envision ivf electronic medical records
arunsahayakumar
 

What's hot (18)

Newborn screening
Newborn screeningNewborn screening
Newborn screening
 
Ehdi summit ppt
Ehdi summit pptEhdi summit ppt
Ehdi summit ppt
 
Session 6C - MHS Vision
Session 6C - MHS VisionSession 6C - MHS Vision
Session 6C - MHS Vision
 
RDD Conf Day 2: Pediatric Vasculitis Initiative, David Cabral, British Columb...
RDD Conf Day 2: Pediatric Vasculitis Initiative, David Cabral, British Columb...RDD Conf Day 2: Pediatric Vasculitis Initiative, David Cabral, British Columb...
RDD Conf Day 2: Pediatric Vasculitis Initiative, David Cabral, British Columb...
 
Kuwait Newborn Screening Annual report 2015
Kuwait Newborn Screening Annual report  2015Kuwait Newborn Screening Annual report  2015
Kuwait Newborn Screening Annual report 2015
 
HoMeS: Home Medication Support
HoMeS: Home Medication SupportHoMeS: Home Medication Support
HoMeS: Home Medication Support
 
Newborn Screening Bootcamp
Newborn Screening BootcampNewborn Screening Bootcamp
Newborn Screening Bootcamp
 
Action Meningitis in Malawi
Action Meningitis in MalawiAction Meningitis in Malawi
Action Meningitis in Malawi
 
Reliability, accuracy and cost effectiveness of prenatal screening
Reliability, accuracy and cost effectiveness of prenatal screeningReliability, accuracy and cost effectiveness of prenatal screening
Reliability, accuracy and cost effectiveness of prenatal screening
 
Newborn hearing screeing_UAPS & LPS _APR 2017
Newborn hearing screeing_UAPS & LPS _APR 2017Newborn hearing screeing_UAPS & LPS _APR 2017
Newborn hearing screeing_UAPS & LPS _APR 2017
 
Safer, Faster, Better
Safer, Faster, BetterSafer, Faster, Better
Safer, Faster, Better
 
The ‘Impossibility’ of Working in the Current NHS
The ‘Impossibility’ of Working in the Current NHSThe ‘Impossibility’ of Working in the Current NHS
The ‘Impossibility’ of Working in the Current NHS
 
Newborn Screening Programs in Utah
Newborn Screening Programs in UtahNewborn Screening Programs in Utah
Newborn Screening Programs in Utah
 
Cheryl Howley resume
Cheryl Howley resumeCheryl Howley resume
Cheryl Howley resume
 
Medical Information Retrieval Workshop Keynote (MedIR@SIGIR2014)
Medical Information Retrieval Workshop Keynote (MedIR@SIGIR2014)Medical Information Retrieval Workshop Keynote (MedIR@SIGIR2014)
Medical Information Retrieval Workshop Keynote (MedIR@SIGIR2014)
 
Annual2018 kuwait newborn screening
Annual2018 kuwait newborn screening Annual2018 kuwait newborn screening
Annual2018 kuwait newborn screening
 
Kirsten Edwards_CV_Physician_Assistant
Kirsten Edwards_CV_Physician_AssistantKirsten Edwards_CV_Physician_Assistant
Kirsten Edwards_CV_Physician_Assistant
 
Cloud envision ivf electronic medical records
Cloud envision ivf electronic medical recordsCloud envision ivf electronic medical records
Cloud envision ivf electronic medical records
 

Viewers also liked

Microsoft power point ยีนและโครโมโซม
Microsoft power point   ยีนและโครโมโซมMicrosoft power point   ยีนและโครโมโซม
Microsoft power point ยีนและโครโมโซม
Thanyamon Chat.
 
Congenital cyanotic heart disease approach
Congenital cyanotic heart disease approachCongenital cyanotic heart disease approach
Congenital cyanotic heart disease approach
Varsha Shah
 
Congenital heart disease (chd)
Congenital heart disease (chd)Congenital heart disease (chd)
Congenital heart disease (chd)
Girmawi-Mekelle
 

Viewers also liked (12)

Therapeutic cooling during neonatal transport
Therapeutic cooling during neonatal transportTherapeutic cooling during neonatal transport
Therapeutic cooling during neonatal transport
 
Integrating Genomic Medicine into Patient Care with Trish Brown, MS, CGC
Integrating Genomic Medicine into Patient Care with Trish Brown, MS, CGCIntegrating Genomic Medicine into Patient Care with Trish Brown, MS, CGC
Integrating Genomic Medicine into Patient Care with Trish Brown, MS, CGC
 
Human Genom Project, NCBI, Blast
Human Genom Project, NCBI, BlastHuman Genom Project, NCBI, Blast
Human Genom Project, NCBI, Blast
 
Genes in psychiatry
Genes in psychiatryGenes in psychiatry
Genes in psychiatry
 
2013 03 genomic medicine slides
2013 03 genomic medicine slides2013 03 genomic medicine slides
2013 03 genomic medicine slides
 
Direct To Consumer Genomics and the Future of Healthcare
Direct To Consumer Genomics and the Future of HealthcareDirect To Consumer Genomics and the Future of Healthcare
Direct To Consumer Genomics and the Future of Healthcare
 
Genetics of Congenital Heart Disease
Genetics of Congenital Heart DiseaseGenetics of Congenital Heart Disease
Genetics of Congenital Heart Disease
 
The Knowns and Unknowns: Genetic Testing and Congenital Heart Disease by Kirs...
The Knowns and Unknowns: Genetic Testing and Congenital Heart Disease by Kirs...The Knowns and Unknowns: Genetic Testing and Congenital Heart Disease by Kirs...
The Knowns and Unknowns: Genetic Testing and Congenital Heart Disease by Kirs...
 
Microsoft power point ยีนและโครโมโซม
Microsoft power point   ยีนและโครโมโซมMicrosoft power point   ยีนและโครโมโซม
Microsoft power point ยีนและโครโมโซม
 
Genomic Medicine: Personalized Care for Just Pennies
Genomic Medicine: Personalized Care for Just PenniesGenomic Medicine: Personalized Care for Just Pennies
Genomic Medicine: Personalized Care for Just Pennies
 
Congenital cyanotic heart disease approach
Congenital cyanotic heart disease approachCongenital cyanotic heart disease approach
Congenital cyanotic heart disease approach
 
Congenital heart disease (chd)
Congenital heart disease (chd)Congenital heart disease (chd)
Congenital heart disease (chd)
 

Similar to Genomic Medicine in the NICU

Prenatal Genetic Screening with VarSeq
Prenatal Genetic Screening with VarSeqPrenatal Genetic Screening with VarSeq
Prenatal Genetic Screening with VarSeq
Golden Helix
 
rgh-portfolio-brochure
rgh-portfolio-brochurergh-portfolio-brochure
rgh-portfolio-brochure
Tristan Orpin
 
Gene screen technology
Gene screen technologyGene screen technology
Gene screen technology
Miriya Johnson
 
Toward Universal HIV Testing:Is the CDC Recommendation of “Opt-out” Screening...
Toward Universal HIV Testing:Is the CDC Recommendation of “Opt-out” Screening...Toward Universal HIV Testing:Is the CDC Recommendation of “Opt-out” Screening...
Toward Universal HIV Testing:Is the CDC Recommendation of “Opt-out” Screening...
CDC NPIN
 
qpcr 1 s2.0-s0015028213005499-main (1)
qpcr           1 s2.0-s0015028213005499-main (1)qpcr           1 s2.0-s0015028213005499-main (1)
qpcr 1 s2.0-s0015028213005499-main (1)
鋒博 蔡
 
1 s2.0-s0015028213005499-main (1)
1 s2.0-s0015028213005499-main (1)1 s2.0-s0015028213005499-main (1)
1 s2.0-s0015028213005499-main (1)
鋒博 蔡
 

Similar to Genomic Medicine in the NICU (20)

Nbs manual 28-6-2015
Nbs manual 28-6-2015 Nbs manual 28-6-2015
Nbs manual 28-6-2015
 
Nbs manual 28-6-2015
Nbs manual 28-6-2015 Nbs manual 28-6-2015
Nbs manual 28-6-2015
 
Clinical Decision Making with Machine Learning
Clinical Decision Making with Machine LearningClinical Decision Making with Machine Learning
Clinical Decision Making with Machine Learning
 
Using Genomic Sequencing & HPC to Help Save the Lives of Critically Ill Children
Using Genomic Sequencing & HPC to Help Save the Lives of Critically Ill ChildrenUsing Genomic Sequencing & HPC to Help Save the Lives of Critically Ill Children
Using Genomic Sequencing & HPC to Help Save the Lives of Critically Ill Children
 
Prenatal Genetic Screening with VarSeq
Prenatal Genetic Screening with VarSeqPrenatal Genetic Screening with VarSeq
Prenatal Genetic Screening with VarSeq
 
rgh-portfolio-brochure
rgh-portfolio-brochurergh-portfolio-brochure
rgh-portfolio-brochure
 
Story to Sepsis Screen: A Journey in the Details by Elizabeth R. Alpern, MD, ...
Story to Sepsis Screen: A Journey in the Details by Elizabeth R. Alpern, MD, ...Story to Sepsis Screen: A Journey in the Details by Elizabeth R. Alpern, MD, ...
Story to Sepsis Screen: A Journey in the Details by Elizabeth R. Alpern, MD, ...
 
Prenatal screening.pptx
Prenatal screening.pptxPrenatal screening.pptx
Prenatal screening.pptx
 
LATCH SCORE.pptx
LATCH SCORE.pptxLATCH SCORE.pptx
LATCH SCORE.pptx
 
Genetic counselling
Genetic counselling Genetic counselling
Genetic counselling
 
The Generation study by Alice Tuff-Lacey
The Generation study by Alice Tuff-LaceyThe Generation study by Alice Tuff-Lacey
The Generation study by Alice Tuff-Lacey
 
GENETIC ADVANCE 2.pptx
GENETIC ADVANCE 2.pptxGENETIC ADVANCE 2.pptx
GENETIC ADVANCE 2.pptx
 
Gene screen technology
Gene screen technologyGene screen technology
Gene screen technology
 
Toward Universal HIV Testing:Is the CDC Recommendation of “Opt-out” Screening...
Toward Universal HIV Testing:Is the CDC Recommendation of “Opt-out” Screening...Toward Universal HIV Testing:Is the CDC Recommendation of “Opt-out” Screening...
Toward Universal HIV Testing:Is the CDC Recommendation of “Opt-out” Screening...
 
Pulse Oximetry Screening for Detecting Critical Congenital Heart Disease
Pulse Oximetry Screening for Detecting Critical Congenital Heart DiseasePulse Oximetry Screening for Detecting Critical Congenital Heart Disease
Pulse Oximetry Screening for Detecting Critical Congenital Heart Disease
 
Pulse Oximetry Screening for Detecting Critical Congenital Heart Disease
Pulse Oximetry Screening for Detecting Critical Congenital Heart DiseasePulse Oximetry Screening for Detecting Critical Congenital Heart Disease
Pulse Oximetry Screening for Detecting Critical Congenital Heart Disease
 
qpcr 1 s2.0-s0015028213005499-main (1)
qpcr           1 s2.0-s0015028213005499-main (1)qpcr           1 s2.0-s0015028213005499-main (1)
qpcr 1 s2.0-s0015028213005499-main (1)
 
1 s2.0-s0015028213005499-main (1)
1 s2.0-s0015028213005499-main (1)1 s2.0-s0015028213005499-main (1)
1 s2.0-s0015028213005499-main (1)
 
Neonatal Jaundice NICE 2015.pptx
Neonatal Jaundice NICE 2015.pptxNeonatal Jaundice NICE 2015.pptx
Neonatal Jaundice NICE 2015.pptx
 
Hepatitis C Infection – Screening, Treatment and (as) Prevention in the Comm...
Hepatitis C Infection  – Screening, Treatment and (as) Prevention in the Comm...Hepatitis C Infection  – Screening, Treatment and (as) Prevention in the Comm...
Hepatitis C Infection – Screening, Treatment and (as) Prevention in the Comm...
 

Recently uploaded

9316020077📞Goa Call Girls Numbers, Call Girls Whatsapp Numbers Goa
9316020077📞Goa  Call Girls  Numbers, Call Girls  Whatsapp Numbers Goa9316020077📞Goa  Call Girls  Numbers, Call Girls  Whatsapp Numbers Goa
9316020077📞Goa Call Girls Numbers, Call Girls Whatsapp Numbers Goa
russian goa call girl and escorts service
 
Call Girls Service Faridabad 📲 9999965857 ヅ10k NiGhT Call Girls In Faridabad
Call Girls Service Faridabad 📲 9999965857 ヅ10k NiGhT Call Girls In FaridabadCall Girls Service Faridabad 📲 9999965857 ヅ10k NiGhT Call Girls In Faridabad
Call Girls Service Faridabad 📲 9999965857 ヅ10k NiGhT Call Girls In Faridabad
gragmanisha42
 
Chandigarh Call Girls 👙 7001035870 👙 Genuine WhatsApp Number for Real Meet
Chandigarh Call Girls 👙 7001035870 👙 Genuine WhatsApp Number for Real MeetChandigarh Call Girls 👙 7001035870 👙 Genuine WhatsApp Number for Real Meet
Chandigarh Call Girls 👙 7001035870 👙 Genuine WhatsApp Number for Real Meet
priyashah722354
 
VIP Call Girl Sector 88 Gurgaon Delhi Just Call Me 9899900591
VIP Call Girl Sector 88 Gurgaon Delhi Just Call Me 9899900591VIP Call Girl Sector 88 Gurgaon Delhi Just Call Me 9899900591
VIP Call Girl Sector 88 Gurgaon Delhi Just Call Me 9899900591
adityaroy0215
 
Ozhukarai Call Girls 👙 6297143586 👙 Genuine WhatsApp Number for Real Meet
Ozhukarai Call Girls 👙 6297143586 👙 Genuine WhatsApp Number for Real MeetOzhukarai Call Girls 👙 6297143586 👙 Genuine WhatsApp Number for Real Meet
Ozhukarai Call Girls 👙 6297143586 👙 Genuine WhatsApp Number for Real Meet
Call Girls Service
 
Call Girl Amritsar ❤️♀️@ 8725944379 Amritsar Call Girls Near Me ❤️♀️@ Sexy Ca...
Call Girl Amritsar ❤️♀️@ 8725944379 Amritsar Call Girls Near Me ❤️♀️@ Sexy Ca...Call Girl Amritsar ❤️♀️@ 8725944379 Amritsar Call Girls Near Me ❤️♀️@ Sexy Ca...
Call Girl Amritsar ❤️♀️@ 8725944379 Amritsar Call Girls Near Me ❤️♀️@ Sexy Ca...
Sheetaleventcompany
 
VIP Call Girls Noida Jhanvi 9711199171 Best VIP Call Girls Near Me
VIP Call Girls Noida Jhanvi 9711199171 Best VIP Call Girls Near MeVIP Call Girls Noida Jhanvi 9711199171 Best VIP Call Girls Near Me
VIP Call Girls Noida Jhanvi 9711199171 Best VIP Call Girls Near Me
mriyagarg453
 
Call Girls Service Anantapur 📲 6297143586 Book Now VIP Call Girls in Anantapur
Call Girls Service Anantapur 📲 6297143586 Book Now VIP Call Girls in AnantapurCall Girls Service Anantapur 📲 6297143586 Book Now VIP Call Girls in Anantapur
Call Girls Service Anantapur 📲 6297143586 Book Now VIP Call Girls in Anantapur
gragmanisha42
 
Ernakulam Call Girls 👙 6297143586 👙 Genuine WhatsApp Number for Real Meet
Ernakulam Call Girls 👙 6297143586 👙 Genuine WhatsApp Number for Real MeetErnakulam Call Girls 👙 6297143586 👙 Genuine WhatsApp Number for Real Meet
Ernakulam Call Girls 👙 6297143586 👙 Genuine WhatsApp Number for Real Meet
Call Girls Chandigarh
 
Chandigarh Escorts, 😋9988299661 😋50% off at Escort Service in Chandigarh
Chandigarh Escorts, 😋9988299661 😋50% off at Escort Service in ChandigarhChandigarh Escorts, 😋9988299661 😋50% off at Escort Service in Chandigarh
Chandigarh Escorts, 😋9988299661 😋50% off at Escort Service in Chandigarh
Sheetaleventcompany
 
raisen Call Girls 👙 6297143586 👙 Genuine WhatsApp Number for Real Meet
raisen Call Girls 👙 6297143586 👙 Genuine WhatsApp Number for Real Meetraisen Call Girls 👙 6297143586 👙 Genuine WhatsApp Number for Real Meet
raisen Call Girls 👙 6297143586 👙 Genuine WhatsApp Number for Real Meet
Call Girls Service
 
Call Girls Service In Goa 💋 9316020077💋 Goa Call Girls By Russian Call Girl...
Call Girls Service In Goa  💋 9316020077💋 Goa Call Girls  By Russian Call Girl...Call Girls Service In Goa  💋 9316020077💋 Goa Call Girls  By Russian Call Girl...
Call Girls Service In Goa 💋 9316020077💋 Goa Call Girls By Russian Call Girl...
russian goa call girl and escorts service
 
Punjab❤️Call girls in Mohali ☎️7435815124☎️ Call Girl service in Mohali☎️ Moh...
Punjab❤️Call girls in Mohali ☎️7435815124☎️ Call Girl service in Mohali☎️ Moh...Punjab❤️Call girls in Mohali ☎️7435815124☎️ Call Girl service in Mohali☎️ Moh...
Punjab❤️Call girls in Mohali ☎️7435815124☎️ Call Girl service in Mohali☎️ Moh...
Sheetaleventcompany
 

Recently uploaded (20)

❤️♀️@ Jaipur Call Girl Agency ❤️♀️@ Manjeet Russian Call Girls Service in Jai...
❤️♀️@ Jaipur Call Girl Agency ❤️♀️@ Manjeet Russian Call Girls Service in Jai...❤️♀️@ Jaipur Call Girl Agency ❤️♀️@ Manjeet Russian Call Girls Service in Jai...
❤️♀️@ Jaipur Call Girl Agency ❤️♀️@ Manjeet Russian Call Girls Service in Jai...
 
9316020077📞Goa Call Girls Numbers, Call Girls Whatsapp Numbers Goa
9316020077📞Goa  Call Girls  Numbers, Call Girls  Whatsapp Numbers Goa9316020077📞Goa  Call Girls  Numbers, Call Girls  Whatsapp Numbers Goa
9316020077📞Goa Call Girls Numbers, Call Girls Whatsapp Numbers Goa
 
Call Girls Service Faridabad 📲 9999965857 ヅ10k NiGhT Call Girls In Faridabad
Call Girls Service Faridabad 📲 9999965857 ヅ10k NiGhT Call Girls In FaridabadCall Girls Service Faridabad 📲 9999965857 ヅ10k NiGhT Call Girls In Faridabad
Call Girls Service Faridabad 📲 9999965857 ヅ10k NiGhT Call Girls In Faridabad
 
Chandigarh Call Girls 👙 7001035870 👙 Genuine WhatsApp Number for Real Meet
Chandigarh Call Girls 👙 7001035870 👙 Genuine WhatsApp Number for Real MeetChandigarh Call Girls 👙 7001035870 👙 Genuine WhatsApp Number for Real Meet
Chandigarh Call Girls 👙 7001035870 👙 Genuine WhatsApp Number for Real Meet
 
VIP Call Girl Sector 88 Gurgaon Delhi Just Call Me 9899900591
VIP Call Girl Sector 88 Gurgaon Delhi Just Call Me 9899900591VIP Call Girl Sector 88 Gurgaon Delhi Just Call Me 9899900591
VIP Call Girl Sector 88 Gurgaon Delhi Just Call Me 9899900591
 
❤️♀️@ Jaipur Call Girls ❤️♀️@ Meghna Jaipur Call Girls Number CRTHNR Call G...
❤️♀️@ Jaipur Call Girls ❤️♀️@ Meghna Jaipur Call Girls Number CRTHNR   Call G...❤️♀️@ Jaipur Call Girls ❤️♀️@ Meghna Jaipur Call Girls Number CRTHNR   Call G...
❤️♀️@ Jaipur Call Girls ❤️♀️@ Meghna Jaipur Call Girls Number CRTHNR Call G...
 
Call Girls Hyderabad Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Hyderabad Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Hyderabad Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Hyderabad Just Call 9907093804 Top Class Call Girl Service Available
 
Ozhukarai Call Girls 👙 6297143586 👙 Genuine WhatsApp Number for Real Meet
Ozhukarai Call Girls 👙 6297143586 👙 Genuine WhatsApp Number for Real MeetOzhukarai Call Girls 👙 6297143586 👙 Genuine WhatsApp Number for Real Meet
Ozhukarai Call Girls 👙 6297143586 👙 Genuine WhatsApp Number for Real Meet
 
Call Girl Amritsar ❤️♀️@ 8725944379 Amritsar Call Girls Near Me ❤️♀️@ Sexy Ca...
Call Girl Amritsar ❤️♀️@ 8725944379 Amritsar Call Girls Near Me ❤️♀️@ Sexy Ca...Call Girl Amritsar ❤️♀️@ 8725944379 Amritsar Call Girls Near Me ❤️♀️@ Sexy Ca...
Call Girl Amritsar ❤️♀️@ 8725944379 Amritsar Call Girls Near Me ❤️♀️@ Sexy Ca...
 
Krishnagiri call girls Tamil aunty 7877702510
Krishnagiri call girls Tamil aunty 7877702510Krishnagiri call girls Tamil aunty 7877702510
Krishnagiri call girls Tamil aunty 7877702510
 
VIP Call Girls Noida Jhanvi 9711199171 Best VIP Call Girls Near Me
VIP Call Girls Noida Jhanvi 9711199171 Best VIP Call Girls Near MeVIP Call Girls Noida Jhanvi 9711199171 Best VIP Call Girls Near Me
VIP Call Girls Noida Jhanvi 9711199171 Best VIP Call Girls Near Me
 
Call Girls Service Anantapur 📲 6297143586 Book Now VIP Call Girls in Anantapur
Call Girls Service Anantapur 📲 6297143586 Book Now VIP Call Girls in AnantapurCall Girls Service Anantapur 📲 6297143586 Book Now VIP Call Girls in Anantapur
Call Girls Service Anantapur 📲 6297143586 Book Now VIP Call Girls in Anantapur
 
Russian Call Girls Kota * 8250192130 Service starts from just ₹9999 ✅
Russian Call Girls Kota * 8250192130 Service starts from just ₹9999 ✅Russian Call Girls Kota * 8250192130 Service starts from just ₹9999 ✅
Russian Call Girls Kota * 8250192130 Service starts from just ₹9999 ✅
 
Ernakulam Call Girls 👙 6297143586 👙 Genuine WhatsApp Number for Real Meet
Ernakulam Call Girls 👙 6297143586 👙 Genuine WhatsApp Number for Real MeetErnakulam Call Girls 👙 6297143586 👙 Genuine WhatsApp Number for Real Meet
Ernakulam Call Girls 👙 6297143586 👙 Genuine WhatsApp Number for Real Meet
 
Chandigarh Escorts, 😋9988299661 😋50% off at Escort Service in Chandigarh
Chandigarh Escorts, 😋9988299661 😋50% off at Escort Service in ChandigarhChandigarh Escorts, 😋9988299661 😋50% off at Escort Service in Chandigarh
Chandigarh Escorts, 😋9988299661 😋50% off at Escort Service in Chandigarh
 
raisen Call Girls 👙 6297143586 👙 Genuine WhatsApp Number for Real Meet
raisen Call Girls 👙 6297143586 👙 Genuine WhatsApp Number for Real Meetraisen Call Girls 👙 6297143586 👙 Genuine WhatsApp Number for Real Meet
raisen Call Girls 👙 6297143586 👙 Genuine WhatsApp Number for Real Meet
 
(Sonam Bajaj) Call Girl in Jaipur- 09257276172 Escorts Service 50% Off with C...
(Sonam Bajaj) Call Girl in Jaipur- 09257276172 Escorts Service 50% Off with C...(Sonam Bajaj) Call Girl in Jaipur- 09257276172 Escorts Service 50% Off with C...
(Sonam Bajaj) Call Girl in Jaipur- 09257276172 Escorts Service 50% Off with C...
 
❤️Call girls in Jalandhar ☎️9876848877☎️ Call Girl service in Jalandhar☎️ Jal...
❤️Call girls in Jalandhar ☎️9876848877☎️ Call Girl service in Jalandhar☎️ Jal...❤️Call girls in Jalandhar ☎️9876848877☎️ Call Girl service in Jalandhar☎️ Jal...
❤️Call girls in Jalandhar ☎️9876848877☎️ Call Girl service in Jalandhar☎️ Jal...
 
Call Girls Service In Goa 💋 9316020077💋 Goa Call Girls By Russian Call Girl...
Call Girls Service In Goa  💋 9316020077💋 Goa Call Girls  By Russian Call Girl...Call Girls Service In Goa  💋 9316020077💋 Goa Call Girls  By Russian Call Girl...
Call Girls Service In Goa 💋 9316020077💋 Goa Call Girls By Russian Call Girl...
 
Punjab❤️Call girls in Mohali ☎️7435815124☎️ Call Girl service in Mohali☎️ Moh...
Punjab❤️Call girls in Mohali ☎️7435815124☎️ Call Girl service in Mohali☎️ Moh...Punjab❤️Call girls in Mohali ☎️7435815124☎️ Call Girl service in Mohali☎️ Moh...
Punjab❤️Call girls in Mohali ☎️7435815124☎️ Call Girl service in Mohali☎️ Moh...
 

Genomic Medicine in the NICU

  • 1. © The Children's Mercy Hospital, 2014. 11/14 Center for Genomic MedicineCenter for Genomic Medicine Joshua E. Petrikin, MDJoshua E. Petrikin, MD Director of Neonatal GenomicsDirector of Neonatal Genomics Genomic Medicine in the NICUGenomic Medicine in the NICU
  • 2. © The Children's Mercy Hospital, 2014. 03/14 2 © The Children's Mercy Hospital, 2014. 11/14 DisclosuresDisclosures • I have no conflicts of interest to disclose • I will not be discussing off label medication uses
  • 3. © The Children's Mercy Hospital, 2014. 03/14 3 © The Children's Mercy Hospital, 2014. 11/14 OverviewOverview • Discuss past and current genetic testing • Define Genomic Medicine • Speculate on future directions for genomics • Elucidate some ethical considerations in Neonatal genomic testing
  • 4. © The Children's Mercy Hospital, 2014. 03/14 4 © The Children's Mercy Hospital, 2014. 11/14 Genetic TestingGenetic Testing • The analysis of human DNA, RNA, chromosomes, proteins, and certain metabolites in order to detect heritable disease-related genotypes, mutations, phenotypes or karyotypes for clinical purposes. • Prenatal, newborn, and carrier screening included.
  • 5. © The Children's Mercy Hospital, 2014. 03/14 5 © The Children's Mercy Hospital, 2014. 11/14 http://www.indiana.edu/~oso/lessons/Genetics/MyFamily2.html
  • 6. © The Children's Mercy Hospital, 2014. 03/14 6 © The Children's Mercy Hospital, 2014. 11/14 Genetic Testing:Genetic Testing: Chromosome KaryotypeChromosome Karyotype
  • 7. © The Children's Mercy Hospital, 2014. 03/14 7 © The Children's Mercy Hospital, 2014. 11/14 ExampleExample Patient #1 is a 10 year old girl with short stature and a broad neckPatient #1 is a 10 year old girl with short stature and a broad neck
  • 8. © The Children's Mercy Hospital, 2014. 03/14 8 © The Children's Mercy Hospital, 2014. 11/14 Microarrays aka “CHIPS” • Short oligos are attached to a solid support (microarray). • Hybridize with fluorescently labeled PCR products containing SNP of interest. • Can analyze many mutations at once • Currently > 740k SNP per chip
  • 9. © The Children's Mercy Hospital, 2014. 03/14 9 © The Children's Mercy Hospital, 2014. 11/14 Array-CGH (comparative genomic hybridization)
  • 10. © The Children's Mercy Hospital, 2014. 03/14 10 © The Children's Mercy Hospital, 2014. 11/14 Deletion on array Muscular Dystrophy • Since 65-85% of cases are due to deletions, start with deletion testing. • The lab we use for dystrophin deletion testing uses an “exon array” with high density probes spanning entire dystrophin gene. • Case 4 patient has a deletion including exons 44-48 (not shown here). • If no deletion detectable, sequence entire DMD gene (79 exons!).
  • 11. © The Children's Mercy Hospital, 2014. 03/14 11 © The Children's Mercy Hospital, 2014. 11/14 Genomic MedicineGenomic Medicine • A structured approach to disease diagnosis & management that prominently features genome sequence information. • Decoding Genomes to diagnose diseases better and help choose the best treatments
  • 12. © The Children's Mercy Hospital, 2014. 03/14 12 © The Children's Mercy Hospital, 2014. 11/14 Monogenic DiseasesMonogenic Diseases J Clin Invest. 2008;118:1590-1605. doi:10.1172/JCI34772.
  • 13. © The Children's Mercy Hospital, 2014. 03/14 13 © The Children's Mercy Hospital, 2014. 11/14 7,700 monogenic diseases7,700 monogenic diseases • 4,174 causal genes known • Affect 4% of children • Cause 20% of infant deaths • Cause 17% of pediatric hospitalizations • Genome Variants determine phenotype • Genome variants = individual changes in the DNA sequence from “normal” • Proving ground for genomic medicine • 20 year experience with sequence-based diagnosis • 1-gene-at-a-time • Slow (months – years) • Expensive ($2500 - $10,000) • Requires right gene to be nominated
  • 14. © The Children's Mercy Hospital, 2014. 03/14 14 © The Children's Mercy Hospital, 2014. 11/14 Neonatal Intensive CareNeonatal Intensive Care • 4.1 million babies born in US / year • 1 in 20 admitted to NICU • 220,000 (5.4%) NICU admissions/year • 30% due to congenital abnormalities • 19,000 neonatal deaths/year • 6.8/1000 • 22% due to congenital abnormalities • $3,000 - $8,000 per day
  • 15. © The Children's Mercy Hospital, 2014. 03/14 15 © The Children's Mercy Hospital, 2014. 11/14 Neonatal Diseases are UniqueNeonatal Diseases are Unique • Emergencies • Rapid results can guide management • Largely stereotyped presentation • Broad differential diagnosis workups • Considerable genetic heterogeneity • Molecular diagnoses almost never made
  • 16. © The Children's Mercy Hospital, 2014. 03/14 16 © The Children's Mercy Hospital, 2014. 11/14 Neonatal Genomic Medicine NICU $3,000 - $8,000 per day Rapid Genome Sequence • Test for things too rare and/or heterogeneous to be considered • Identification of genotype before phenotype fully manifests • Diagnose or rule out known mutations • Reduce unnecessary tests & empiric therapies • Improve prognostic assessment, genetic counseling • Unique opportunity to intervene before irreversible disease processes manifests with irreversible symptoms
  • 17. © The Children's Mercy Hospital, 2014. 03/14 17 © The Children's Mercy Hospital, 2014. 11/14 Genomic Sequencing – Sanger
  • 18. © The Children's Mercy Hospital, 2014. 03/14 18 © The Children's Mercy Hospital, 2014. 11/14 Human GenomeHuman Genome 3.2 billion base pairs, 6.4 billion nt Equal to typing 60 words/min x 8hrs/day x 50 years 20,000 genes (just 2% of genome) which encode 100,000 proteins 7700 Monogenic diseases
  • 19. © The Children's Mercy Hospital, 2014. 03/14 19 © The Children's Mercy Hospital, 2014. 11/14
  • 20. © The Children's Mercy Hospital, 2014. 03/14 20 © The Children's Mercy Hospital, 2014. 11/14 Primary Analysis – Base CallingPrimary Analysis – Base Calling • In Illumina sequencing, each sequencing cycle produces 4 images, one for each base, where clusters that show that base are lit up • Base calling done by • detecting the coordinates of each cluster • measuring the intensity of the signal at each cluster for each base • determining which base has the strongest signal • strength of call results in a quality score for each base Whiteford N et al. Bioinformatics 2009;25: 2194-2199 http://www. clinchem.or g/content/5 5/4/641/F4.l arge.jpg
  • 21. © The Children's Mercy Hospital, 2014. 03/14 21 © The Children's Mercy Hospital, 2014. 11/14 Shotgun SequencingShotgun Sequencing • Shotgun sequencing techniques rely on breaking long strands of DNA into fragments and then sequencing them individually • NextGen Sequencing is massively parallel, ultra high throughput • HiSeq 2500 run produces 1 trillion base pairs in 8 billion 125 bp reads • Interpreting an individual’s DNA sequence means taking all the pieces and putting them together into some meaningful context
  • 22. © The Children's Mercy Hospital, 2014. 03/14 22 © The Children's Mercy Hospital, 2014. 11/14 Sequence Alignment – Read MappingSequence Alignment – Read Mapping AGCTATTTATGACCATGATTTTTCTTTTTTTATTTTTTCCATATAAGATAAGATGGAGACGGTCTTTTCTTGTGAGTCTGTTTTTCTGTATTCA AGCTATTTATGACCATGATTTTTCTTTTTTTATTTTTTCCATATAAGATA TTTATGACCATGATTTTTCTTTTTTTATTTTTTCCATATAAGATAAGATG GACCATGATTTTTCTTTTTTTATTTTTTCCATNTAAGATAAGATGGAGAC TGATTTTTCTTTTTTTATTTTTTCCATATAAGATAAGATNGAGACGGTCT TTTCTTTTTTTATTTTTTCCATATAAGATCAGATGAAGACGGTCTTTTCTTG CCATATAAGATAAGATGGAGACGGTCTTTTCTTGTGAGTCTGTTTTTCTG TATAAGATAAGATGGAGACGGTCTTTTCTTGTGAGTCTGTTTTTCTGTAT TAAGATAAGATGGAGACGGTCTTTTCTTGTGAGTCTGTTTTTCTGTATTC • Most human sequence analysis is done by mapping reads to the human reference genome • Alignment results are stored in a compact standard file format called Sequence Alignment Map (SAM) or its binary version BAM • Each alignment records: • read position in reference (e.g. chr10:1000-1125) • mismatch between read and reference • strand read aligned to • mapping quality score
  • 23. © The Children's Mercy Hospital, 2014. 03/14 23 © The Children's Mercy Hospital, 2014. 11/14 Alignment Visualization in theAlignment Visualization in the Integrative Genomics Viewer (IGV)Integrative Genomics Viewer (IGV) • Red reads pointing right aligned to the forward strand • Blue reads pointing left aligned to the complement strand
  • 24. © The Children's Mercy Hospital, 2014. 03/14 24 © The Children's Mercy Hospital, 2014. 11/14 SubstitutionsSubstitutions
  • 25. © The Children's Mercy Hospital, 2014. 03/14 25 © The Children's Mercy Hospital, 2014. 11/14 DeletionsDeletions
  • 26. © The Children's Mercy Hospital, 2014. 03/14 26 © The Children's Mercy Hospital, 2014. 11/14 Infant CMH487 Diagnosis! Bioinformatic Filter 5
  • 27. © The Children's Mercy Hospital, 2014. 03/14 27 © The Children's Mercy Hospital, 2014. 11/14 Newborn TestingNewborn Testing • ““If medical or psychosocial benefits of genetic test will not accrue until adulthood, as in case of carrier status or adult-onset diseases, genetic testing should be deferred…” • Guides gene analysis/interpretation • Do not analyze newborns for carrier status or adult conditions or off-target diseases
  • 28. © The Children's Mercy Hospital, 2014. 03/14 28 © The Children's Mercy Hospital, 2014. 11/14 SecondarySecondary Findings • Also called incidental or unanticipated findings • Highly likely, if not inevitable, whenever WGS/WES is performed • Examples include: • finding of a previously unsuspected high risk of future disease • discovery of a disorder in an asymptomatic individual • detection of carrier status
  • 29. © The Children's Mercy Hospital, 2014. 03/14 29 © The Children's Mercy Hospital, 2014. 11/14 Incidental Findings inIncidental Findings in Neonates?Neonates? • Mandate to avoid violating a child’s right to an open future? • Considerations • Parents of critically-ill children “just tell me where to sign” • Feasibility of reporting secondary findings - accuracy, expectations, defining the scope • Impacts: • Test design (SSAGA) • Consent • Communication of results
  • 30. © The Children's Mercy Hospital, 2014. 03/14 30 © The Children's Mercy Hospital, 2014. 11/14 Francis Collins, Director of the NIH,Francis Collins, Director of the NIH, Wall Street Journal, July 8, 2014  "Over the course of the next few decades, the availability of cheap, efficient DNA sequencing technology will lead to a medical landscape in which each baby's genome is sequenced, and that information is used to shape a lifetime of personalized strategies for disease prevention, detection and treatment."
  • 31. © The Children's Mercy Hospital, 2014. 03/14 31 © The Children's Mercy Hospital, 2014. 11/14 Not quite inexpensive enough for generalized newborn screening— but right up there for diagnosis of ill infants in the NICU
  • 32. © The Children's Mercy Hospital, 2014. 03/14 32 © The Children's Mercy Hospital, 2014. 11/14 Adapted from Sir George Poste, circa1999
  • 33. © The Children's Mercy Hospital, 2014. 03/14 33 © The Children's Mercy Hospital, 2014. 11/14 Take Home PointsTake Home Points • Genomic Medicine hold promise, but is not the final answer • Proteinomics, metabolomics, epigenetics • WGS compares most of a patient’s genome against a reference genome • Deletions, insertions, triplet repeats centrimeric anomalies undetected • The focus on care will shift from disease centered to patientcentered
  • 34. © The Children's Mercy Hospital, 2014. 03/14 34 © The Children's Mercy Hospital, 2014. 11/14 Take Home PointsTake Home Points • Whole genome sequencing is not ready for prime time use for newborn screening • Don’t invest in WGS equipment and bioinformatics tools yet • Ethical questions arise as to the use of WGS for NBS • Adult onset disorders • Variants of unknown significance • Paternity
  • 35. © The Children's Mercy Hospital, 2014. 03/14 35 © The Children's Mercy Hospital, 2014. 11/14 Children’s Mercy Hospital Center for Pediatric Genomic Medicine Supported By Clements Foundation Marion Merrell Dow Foundation National Institutes of Health WT Kemper Foundation Patton Trust Director Dr. Stephen Kingsmore

Editor's Notes

  1. Medicine today. Make a Dx, select an Rx, physician-centric Medicine twenty seventeen. Personal genome database – stored probably on your watch or your ring. Symptoms e.g. breathlessness prompt specific, multiplexed finger stick tests e.g. BNP, troponin Multiscale modeling of dx, prognosis, personalized interventions