1. 2015
The Pathophysiology of
Pain with Obesity in
Relation to VEGF
Dr. Sharron Dolan
Stephanie Gorman
Sgorma200@caledonian.ac.uk
S1021623
MHC920369-10-AB
2. 1
Abbreviation
VEGF – Vascularendothelial growthfactor
RT – Reverse transcription
Q - Quantitative
WAT – White adipose tissue
PNS– Peripheral nervoussystem
CNS– Central nervoussystem
DRG – Dorsal rootganglion
VPF– Vascularpermeabilityfactor
NP-1– Neuropilin-1
STZ - Streptozotocin
Bps- Base pairs
3. 2
Abstract
The purpose of this experiment was to use tissue from male wistar and male zeuker rats in
order to determine whether expression of the vascular endothelial growth factor (VEGF)
gene is altered in obese tissue compared to lean tissue and between diabetic tissue and
control tissue. This was done in order to determine whether VEGF had a role in the up
regulated pain sensitivity associated with obesity and to determine if it also has a role in
diabetes. So far the experiments done on VEGF’s role in both obesity and diabetes have
had conflicting results as to the level of expression and so VEGF’s roles as to whether it
protects against or exacerbates these conditions is not fully understood. This experiment
was done by gene isolation and extraction, reverse transcription (RT) PCT, PCR, gel
electrophoresis and quantitative (q) PCR to visualise the expression of VEGF in each of the
tissues and the differences between each tissue. The results were analysed using prism to
perform unpaired t tests and were unfortunately found to be insignificant and further work is
needed to establish VEGFs role in pain associated with obesity
4. 3
Introduction
Obesity and pain
It is becoming apparent that, in both humans and animals, obesity is now associated with
increased pain sensitivity (Stolzman et al 2013). The reason for this is not fully understood
but the cause is thought to be due to an increase in white adipose tissue (WAT) which
releases pro-inflammatory cytokines, which acts in both disease and normal body functions,
leading to the innate immune system being chronically activated (Bastard et al, 2006).
There are many pain conditions associated with obesity such as lower back pain, peripheral
vascular disease, an array of muscoskeletal disorders and osteoarthritis (Janke at al, 2007).
It is not clear whether obesity is a direct factor in lower back pain or if it mediated by other
factors i.e. lifestyle, but it is known that obesity is a direct risk factor for osteoarthritis as
being even marginally overweight can increase the chance of developing it (Janke at al,
2007), although this does not mean that a larger weight gain results in an even greater
increase in pain perception (Motaghedi et al, 2014).
The increased weight will put increased pressure on the bones/joints and will contribute both
to the development and persistence of the disease in both the hip and the knees and
possibly the hand and neck (Iannitti et al, 2012). Increased weight has also known to
increase pain severity in some conditions such as headache and migraine (Iannitti et al,
2012). The exact way in which obesity can contribute to pain is not exactly known but it is
thought that it due to mechanical, structural, metabolic and behavioural changes but it’s most
likely due to a combination of them all. It is also thought that these factors contributions to
pain may differ depending on the disease (Iannitti et al, 2012).
Cytokines are small regulatory proteins secreted from cells which can have a particular
effect on the communication and interaction between cells and which take part in host
5. 4
responses to situations like infections, immune responses, inflammation and trauma.
Cytokine is a general term, other names include; lymphokine, monokine, chemokine and
interleukin (CAD 2015). Cytokines work as an autocrine, paracrine or endocrine and can be
pro- or anti-inflammatory meaning they can either worsen the inflammation or promote
wound healing by reducing inflammation (CAD 2015). Often cytokines are produced by
cascade meaning that the release of one cytokine will most likely result in the further release
of many cytokines. Pro-inflammatory cytokines are produced mainly by activated
macrophages and usually result in the up-regulation of inflammatory responses. (Zhang and
An, 2007)
Evidence has shown that certain cytokines such as TNF-α and interleukins (IL-1β, IL-2, IL-6,
IL-8) (Bastard et al, 2006) are involved in the beginning and the persistence of pathological
pain by acting on nociceptive sensory neurons directly (Zhang and An, 2007). Some
inflammatory cytokines are also known to be take part in nerve injury; inflammation induced
central sensitization and is associated with the development of contralateral allodynia and
hyperalgesia. (Zhang and An, 2007).
Inflammatory responses in both the Peripheral Nervous System (PNS) and Central Nervous
System (CNS) play key roles in the development and continuation of pathological pain, some
cytokines in the skin, spinal cord, injured nerve and dorsal root ganglion (DRG) are
associated with both pain behaviours and the generation of abnormal spontaneous activity
originating from injured nerve fibres or from compressed or inflamed DRG neurons (Zhang
and An, 2007). An example of this would be the cytokine IL-1β which is released in cases
such as injury and inflammation by macrophages, monocytes, endothelial cells and
nociceptive DRG neurons. After nerve injury or distress to the CNS IL-1β expression is up-
regulated leading to hyperalgesia (Zhang and An, 2007).
In this study we will be focusing on the expression of VEGF as there are many conflicting
studies concerning its role in obesity and very little regarding its role in pain.
6. 5
VEGF and its role in obesity
Vascular endothelial growth factor (VEGF), also sometimes known as Vascular Permeability
Factor (VPF) is a potent angiogenic factor. It is a member of a subgroup of the platelet-
derived growth factor family (Wu et al, 2014) which has four members VEGF-A –D (Wu et al,
2014).
VEGF’s main role in the body is in the vascular system; angiogenesis where new blood
vessels are made from pre-existing vessels and vasculogenesis where new vessels are
made were there were no pre-existing vessels, but VEGF also takes part in normal
physiological functions such as haematopoiesis, bone formation, wound healing and
development (Duffy et al, 2000).
VEGF and its receptor are expressed not only on endothelial cells but also on many non-
epithelial cells. VEGF is known to be expressed in the central nervous system where
neuropilin-1 (NP-1) can act as a receptor for the VEGF isoform VEGF165 (Duffy et al, 2000).
VEGF has been found to have a neuroprotective role in the CNS (Marti, 2000) such as
increasing the survival rate of schwann cells and providing protection for hippocampal
neurons from ischemic damage (Duffy et al, 2000). VEGF is also needed for growth of
nervous tissue in embryos; this was shown by the loss of VEGF expression in the CNS
leading to neuronal apoptosis in mice (Rosenstein et al, 2010). VEGF165 has been shown to
be expressed in the spinal cord and to be reduced in response to spinal cord injury (Herrera,
Nesic and Narayana, 2009).
The role of VEGF in obesity has been looked into and they are being considered as in
important target in the treatment of obesity (Wu et al, 2014) but unfortunately conflicting
results (Yilmaz and Hotamisligil, 2013) have emerged on whether VEGF expression is
reduced or enhanced in obesity. In some experiments it was found that in obese patient’s
serum levels of VEGF are increased (Halberg et al., 2009) and that serum VEGF is directly
connected to BMI (Loebig et al., 2010) and (Silha et al., 2005). VEGF knockout mice showed
7. 6
suppression of obesity but also stimulated “browning” of WAT (Lu et al., 2012). However
other studies have found that an overexpression promotes a brown adipose tissue (BAT) like
phenotype in WAT tissue protecting against insulin resistance and diet-induced obesity
(Elias et al, 2013) and mice models of obesity show a reduction in VEGF (Pasarica et al.,
2008). Adipose-specific VEGF transgenic /knockout mice also showed increased VEGF
expression to be advantageous (Sung et al., 2013) this has been further established by Elias
et al. using transgenic mice models. In these models overexpression always lead to
increased energy expenditure (Elias et al, 2013). It has also been discovered recently that
VEGF is a chemo attractor for the anti-inflammatory macrophage M2, since obesity is
associated with low grade chronic inflammation, VEGF attracting M2 macrophages to WAT
where they could release anti-inflammatory cytokines (Elias et al, 2013) this would decrease
inflammation and suggest VEGF is in fact protective against obesity.
VEGF and Diabetes
Obesity resulting from WAT continuously stimulating the innate immune system is known to
lead to insulin resistance and diabetes (Bastard et al, 2006). Unfortunately the exact
mechanism of how this happens is not clear and the role of VEGF in diabetes, like in obesity,
is not clear due to conflicting studies (Wu et al, 2014), some showing VEGF as having a
protective role against diabetes as it has been found to be reduced in level in patients with
T2D (Thangarajah et al., 2012;Chou et al., 2002) and that overexpression shows an
improvement in both insulin sensitivity and glucose intolerance (Sun et al., 2012). Other
studies have shown VEGF to be a contributor to obesity, for example Wu et al showed that
VEGF-B knockout mice have improved insulin sensitivity while Tinahones et al showed that
obese patients with lower insulin resistance have higher VEGF levels compared to those
with high insulin resistance.
8. 7
VEGF and pain
As stated above Elias et al found VEGF to be a chemo attractor specifically for the anti-
inflammatory macrophage M2 and once M2 reaches the adipose tissue it releases more
anti-inflammatory cytokines. This would suggest that VEGF would protect against obesity
associated pain.
Animal model
Using male Zucker (fa/fa) rats it’s possible to compare the expression of genes in different
types of tissue to determine whether they contribute to certain diseases. Male rats are used
to eliminate the interference of hormones such as oestrogen, zucker rats are used as they
make the ideal model of early-onset human hyperplastic-hypertrophic obesity (Kava,
Greenwood and Johnson, 1990). These rats are an ideal model as they become obese at 3-
5 weeks old (Kava, Greenwood and Johnson, 1990) and their body composition is over 40
percent lipid by week 14 (Kava, Greenwood and Johnson, 1990) and the have been used for
years to study the development, treatments and mechanisms of genetic obesity (Kava,
Greenwood and Johnson, 1990). Wistar rats were used to determine expression of VEGF
compared to cyclophilin in diabetic tissue as they are non-obese and from the age of 48-120
days it is possible to detect glycosuria and eventually hyperketonemia, hyperglycemia and
hypoinsulinemia (Nakhooda et al., 1977).
Aim
The aim of this study is to determine whether VEGF levels are increased or decreased in
obese spinal cord and WAT and so determine if VEGF contributes to increased pain in
obesity. It will also look at whether VEGF levels are increased or decreased in diabetic rats,
a disease commonly associated with increased pain, when compared to lean rats.
9. 8
Method
Animal model
The study was approved by the Institute’s Ethics and Welfare committee and all procedures
were performed according to the UK Animal Scientific Procedures Act (1986). Animals were
treated in accordance with the Ethical Guidelines for Investigations of Experimental Pain in
Conscious Animals as issued by the International Association for the study of Pain. Tissues
were collected from obese Zucker male rats (fa/fa) and lean male littermates (fa/-) aged
between 12-14 weeks were used. Tissues were also collected from adult male Wistar rats
rats fed a high fat diet (HFD) for 12 week and injected intraperitoneally (i.p) with low dose of
streptozotocin (STZ; 30 mg/kg) or citrate buffer vehicle. Control rats were fed a normal diet
and received either STZX or vehicle (i.p). A total of 6 animals in each group were used. All
animals were killed immediately after the experiment by intraperitoneal administration of
pentobarbital (5 mg/100 g; Pharmasol (Andover), JM Loveridge PLC, Southampton, UK).
(Sharron Dolan and Andrea Mary Nolan, (2007)
RNA extraction
To begin 350µl of RA1 lysis buffer and 15µl of DTT (0.1M) is added to a bead tube
containing a small square of defrosted rat tissue. This is then disrupted and homogenised by
placing it in in a bead basher for 20 seconds. The lysate is the placed in a nucleospin filter
with a 2ml collection tube, centrifuged at maximum speed for 1 minute, the filter then
discarded 300µl of 70% ethanol was added to the lysate and mixed by pipetting up and
down 5 times.
The lysate was then transferred to a new filter and collection tube, centrifuged at maximum
speed for 30 seconds and the flow through then discarded. The filter was placed back in the
collection tube and 350µl of membrane desalting buffer was added to the filter. The column
is then centrifuged for 1 minute at max speed and the flow through discarded.
10. 9
A DNase reaction mixture was made adding 10µl of reconstituted rDNase to 90µl reaction
buffer for rDNase; this was mixed by flicking the tube. 95µl of this mixture was added directly
to the filter membrane and left at room temperature for 15 minutes. After, 200µl of RA2
buffer was added to the filter and centrifuges for 30 seconds the flow through was then
discarded. Then 250µl of RA3 buffer was added to the column and centrifuged for 2 minutes,
the filter was then placed in a new collection tube and 60µl of RNase free H2O was added
and the column centrifuged foe 1 minute; transferring the RNA to the collection tube.
RNA quantification
RNA was quantified using a nanodrop spectrometer. Using ND-100 program on computer,
with apparatus cleaned with alcohol beforehand, 1µl of elation buffer was placed on dots on
apparatus and read by computer, if the program showed dots to be green they could be
used to read RNA, red dots were non –viable. Then 1µl of RNA was placed on viable dots
and the RNA was measured with A260/A280 noted. Using the lowest sample quantity, a
dilution factor was found for each sample for use in RT-PCR, and the amount needed for
RT-PCR was then calculated for a volume of 8µl.
RT-PCR
Using the dilution factors from the RNA quantification a 0.2ml PCR tube was filled with RNA,
1µl random hexamers (2.5ng/ml), 1µl dNTPs (10Mm mix) and DEPC-treated water (PCR
grade) to make 8 µl. All reagents were provided by QIAGEN®. The tubes were then
incubated for 5 minutes at 65°C then placed back on ice for 1 minute. During this a cDNA
synthesis mix was made with 2µl 10x RT buffer, 4µl 25mM MgCl2, 2µl 0.1M DTT, 1µl
RNaseOUT (40U/µl) and 1µl SuperScript III RT (200 U/µl) (also provided by QIAGEN®),
these volumes were multiplied to accommodate the number of samples, 10µl of this mix was
added to each tube, mixed gently and briefly centrifuged. They were then placed in the PCR
machine for 10 minutes at 25°C then for 50 minutes at 50°C and then for 5 minutes at 85°C,
the tubes were then chilled on ice. The tubes were briefly centrifuged again and 1µl of
11. 10
RNase H added to each tube, they were then incubated at 37°C for 20 minutes. Samples
were either chilled if used then or frozen at -20°C until needed.
PCR/ gel electrophoresis
A mixture was made by 12.5µl ready mix (Thermo Fisher Scientific, UK), 0.3µl forward
primer 0.3µl reverse primer and 12.5µl H2O. Forward and reverse primers used were specific
for the gene amplifies i.e. actin forward and reverse primers were used to amplify the
housekeeping gene. This mixture was altered depending on the amount of samples being
used, 2µl of cDNA is then added and the mixture briefly centrifuged and placed in the PCR
machine. PCR ran at 94°C for 2 minutes, then did 34 cycles consisting of ; 94°C for 30
seconds, 55°C for 60 seconds and 72°C for 60seconds. It ran at 72°C for 10minutes.
A 1.0% agarose gel was made by mixing 1.3g of agarose with 130ml 0.5X TBE buffer and
heating it in a microwave until the agarose dissolved. Once cooled a little 5µl of miduri green
was added to the mix and the solution was poured into a casting tray with combs and left to
set. Once set the gel tray was placed in an electrophoresis tank and covered with 0.5X TBE
buffer and the combs removed, 5µl of DNA hyper ladder and 20µl of samples are loaded into
the wells and the gel ran at 120V for 45 minutes to 1 hour.
Actins PCR product should be 450 base pairs (bps) while VEGFs should be358bps.
Primer Sequence
Rat β-actin Forward Primer GACCCAGATCATGTTTGAGA
Rat β-actin Reverse Primer CACAGGATTCCATACCCAGG
qPCR
A master mix was made up of 10µl mix, 0.75µl forward primer, 0.75µl reverse primer, 1µl
probe and 6.5µl H2O (all reagents provided by peqlab®). These volumes were altered
depending on the number of samples; 19µl of this master mix was added to a space in the
qPCR template and 1µl of sample, gene of interest VEGF and housekeeping gene
12. 11
cyclophilin, added to each well. The template was then placed in the qPCR machine for 2
hours. Samples were measured in duplicate and VEGF gene results compared to
housekeeping gene (Cyclophilin).
Primer Sequence
VEGF Forward Primer CCAAGATCCGCAGACGTGTA
VEGF Reverse Primer GCTGCCTCGCCTTGCA
VEGF Probe ATGTTCCTGCAAAAACACAGACTCGCG
Cyclophilin Forward Primer AGGGTTCCTCCTTTCACAGAATTAT
Cyclophilin Reverse Primer GCCACCAGTGCCATTATGG
Cyclophilin Probe CCACCCTGGCACATGAATCCTGG
Results from qPCR were analysed using Prism to determine significance.
13. 12
Results
Expression of VEGF in WAT and spinal cord tissue
Using real time PCR and RT-PCR and gel electrophoresis the expression of the gene VEGF
was seen in both WAT and spinal cord tissue (Figure 1A). Actin was used as the positive
control as it is a housekeeping gene and will always be present in both WAT and in the
spinal cord. Water was used as a negative control to show that no contamination is present
and that any expression shown is from the genes alone. VEGF samples appear to have
around the same level of expression for both spinal cord and WAT going by the intensity of
the PCR products. Figure 1A shows that VEGF is expressed in both WAT and spinal cord
tissue and so it is possible to go on to compare the level of expression of VEGF in lean and
obese spinal cord and WAT.
14. 13
Figure 1A
Hyper; hyperladder, WAT; white adipose tissue, SC; spinal cord H2O; water (negative)
control. Positive control (actin) shows that the RNA is of good quality while negative control
shows no contamination is present. Arrow shows directional flow of electricity.As stated
before actins PCR product should be 450 base pairs (bps) while VEGFs should be358bps,
actins bands seem to be below the 6th
band on the hyperladder putting it just under 500bp’s
while VEGF’s bands are under the 7th
putting it under 400bp’s making them the correct band
sizes.
15. 14
Expression of VEGF in control and diabetic tissue
Diabetic and control rat tissue was disrupted and homogenised in order to extract the RNA
through a series of filters. The RNA was then quantified using a nanodrop spectrometer.
Once the calculations were made the RNA was put through reverse transcription (RT) PCR
in order to convert the RNA to cDNA and the calculation used to ensure that all samples
would contain the same amount of cDNA at the end. Samples were amplified using PCR and
visualised by agarose gel electrophoresis in order to view the expression of actin and VEGF
genes in both the control and diabetic samples. Both the actin and VEGF samples appear to
have the same level of expression as each other with exception of VEGF sample C1 which
has a less intense level of expression compared to the rest. Figure 1B shows the
expression of both genes in spinal cord tissue. Actin was detected in all samples suggesting
the cDNA was of good quality.
16. 15
Gel picture 1B
Hyp; hyperladder, C1; control sample 1, C2; control sample 2, D1; diabetic sample 1, D2;
diabetic sample 2, H2O; water (negative) controls have no expression so no contamination
is present. All VEGF samples show expression although sample C1 expression is not as
intense as the others.. Positive control (actin) shows that tissue used is viable while negative
control shows no contamination is present. Arrow shows directional flow of electricity.
17. 16
Relative expression of VEGF in WAT and spinal cord of lean /obese tissue and
control/diabetic tissue
Quantitative (q) PCR was run on samples from the lean, obese, control and diabetic RNA
samples. Samples were placed in a qPCR plate with a mix containing a probe, a forward and
a reverse primer relating to the gene of interest, VEGF or the positive control cyclophilin, and
placed in a qPCR machine. A negative water control was also used in the template to screen
for any contaminations. Figure 2A shows the expression of WAT VEGF in lean and obese
samples, graph 2B shows the expression of spinal cord VEGF in lean and obese samples,
graph3A shows the expression of WAT VEGF in control and diabetic samples and graph 3B
shows the expression of spinal cord VEGF in control and diabetic. In both lean and obese
graphs the expression of VEGF appears to have decreased in the obese samples an in the
control and diabetic graphs the VEGF expression also appears to have been reduced in the
diabetic samples.
Unpaired t tests were used to determine whether the results from the graphs were
significant by finding the p value; graph 2A p value = 0.6719, graph 2B p value = 0.6112,
graph 3A p value = 0.7636 and graph 3B p value = 0.7057. None of these p values are
under 0.05 therefore the differences in expression are not significant.
18. 17
All graphs show the expression of VEGF in lean and obese samples with obese being
compared against the lean or with control and diabetic samples with the diabetic samples
being compared against the control. Graphs show mean and standard error bars taken from
tables 1A, 1B, 2A and 2B
19. 18
Raw data for lean/obese and control/diabetic spinal cord and WAT qPCR
These tables show the raw data obtained from the qPCR for all samples. Table 1A shows
the results for the lean and obese WAT, table 1B shows the results for lean and obese spinal
cord tissue, table 2A shows the results for control and diabetic WAT and table 2B shows the
results for control and diabetic spinal cord tissue. From these tables figures 2A, 2B,3A and
3B were made using the RQ values for expression and the rqmax value for the error bars.
22. 21
Discussion
The PCR results shows VEGF mRNA is expressed in WAT and spinal cord tissue. That
VEGF is expressed in the spinal cord would agree with Herrera et al (2009) who found
expression of VEGF in lesions in the spinal cord after damage. The fact that VEGF is
expressed is also expected as the theory for the increased pain sensitivity is that WAT
releases pro-inflammatory cytokines (Bastard et al, 2006).
The qPCR analytical results showed there was no difference in expression between the lean
and obese samples or the control and diabetic samples. This does not correspond with any
other experiments which looked into VEGF’s expression in either obesity or diabetes as
those experiments either found there was a reduction or an increase in expression. For
example, Lu et al 2012 showed VEGF knockout mice had a suppression of obesity with the
appearance of brown like adipocytes in WAT, while Pasarica et al 2008 found mice models
of obesity to have lower expression of VEGF in WAT mRNA and Sung et al 2013 showed
VEGF deletion decreased mice body weight and significantly decreased body mass in obese
mice and that VEGF overexpression in WAT using doxycycline inducible overexpression
mice to be an advantage against obesity which was confirmed by Elias et al 2013. Elias et al
also showed that overexpression of VEGF in transgenic mice not only protects against
obesity but it also protects against insulin resistance. Sun et al 2012 also showed that an
inducible overexpression of VEGF improved both glucose intolerance and insulin sensitivity
while others showed VEGF to contribute to diabetes i.e. Wu et al 2014 showed VEGF
knockout mice, obtained using a VEGF neutralising antibody B20-4.1 and control antibody
IgG, had improved insulin sensitivity and Tinahones et al 2012showed that increased VEGF
in both subcutaneous and omentim adipose tissue lead to decreased insulin sensitivity.
23. 22
These results may be due to the model types used in the experiments, for example Sung et
al 2012 used adipose-specific transgenic and knockout mice while Wu et al 2014used
VEGF-B specific knockout mice which in the case of knockout mice may lead to different
compensatory pathways being activated to make up for the loss of the gene . It could also be
due to these experiments using larger sample numbers as this one used only three samples
each to determine the differences in expression.
Further study
As only three tissue samples were used to calculate the expression of VEGF in all our
tissues further studies should use much larger sample sizes in order to establish if there is
actually any significant difference in expression in VEGF in obese/diabetic tissue when
compared with lean/control tissue.
Knockout mice studies can also be used to see the effect on mice when faced with the loss
of VEGF. These could be compared with the results of Lue et al and Sun et al to see
whether it promotes or suppresses the development of obesity.
Conclusion
Although this study showed that VEGF is in fact expressed in WAT and spinal cord tissue as
well as control, diabetic, lean and obese tissue we could not determine any difference in
gene expression and so consequently we cannot say for certain what VEGFs role is in
obesity.
Acknowledgements
Dr Sharon Dolan
Integrated DNA technologies for providing VEGF probes and primers.
24. 23
References
1. Bastard, J., Maachi, M., Lagathu, C., Kim, M., Caron, M., Vidal, H., Capeau, J. and Feve,
B. (2006). Recent advances in the relationship between obesity, inflammation, .?. -
PubMed - NCBI. [online] Ncbi.nlm.nih.gov. Available at:
http://www.jle.com/fr/revues/ecn/e-
docs/recent_advances_in_the_relationship_between_obesity_inflammation_and_insulin
_resistance_268297/article.phtml?tab=texte [Accessed 13 Feb. 2015].
2. CA, D. (2015). Proinflammatory cytokines. - PubMed - NCBI. [online] Ncbi.nlm.nih.gov.
Available at: http://www.ncbi.nlm.nih.gov/pubmed/10936147 [Accessed 5 Feb. 2015].
3. Chou, E., Suzuma, I., Way, K., Opland, D., Clermont, A., Naruse, K., Suzuma, K.,
Bowling, N., Vlahos, C., Aiello, L. and King, G. (2002). Decreased Cardiac Expression of
Vascular Endothelial Growth Factor and Its Receptors in Insulin-Resistant and Diabetic
States: A Possible Explanation for Impaired Collateral Formation in Cardiac Tissue.
Circulation, [online] 105(3), pp.373-379. Available at:
http://circ.ahajournals.org/content/105/3/373.long [Accessed 17 Mar. 2015].
4. Duffy, A., Bouchier-Hayes, D. and Harmey, J. (2000). Vascular Endothelial Growth
Factor (VEGF) and Its Role in Non-Endothelial Cells: Autocrine Signalling by VEGF.
Landes Bioscience. [online] Available at: http://www.ncbi.nlm.nih.gov/books/NBK6482/
[Accessed 5 Feb. 2015].
5. Elias, I., Franckhauser, S. and Bosch, F. (2013). New insights into adipose tissue VEGF-
A actions in the control of obesity and insulin resistance. Adipocyte, [online] 2(2), pp.109-
112. Available at: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3661112/ [Accessed 13
Feb. 2015].
6. Halberg, N., Khan, T., Trujillo, M., Wernstedt-Asterholm, I., Attie, A., Sherwani, S., Wang,
Z., Landskroner-Eiger, S., Dineen, S., Magalang, U., Brekken, R. and Scherer, P. (2009).
Hypoxia-Inducible Factor 1 Induces Fibrosis and Insulin Resistance in White Adipose
Tissue. Molecular and Cellular Biology, [online] 29(16), pp.4467-4483. Available at:
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2725728/ [Accessed 17 Mar. 2015].
7. Herrera, J., Nesic, O. and Narayana, P. (2009). Reduced Vascular Endothelial Growth
Factor Expression in Contusive Spinal Cord Injury. Journal of Neurotrauma, [online]
26(7), pp.995-1003. Available at: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2848947/
[Accessed 31 Mar. 2015].
8. Iannitti, T., Graham, A. and Dolan, S. (2012). Increased central and peripheral
inflammation and inflammatory hyperalgesia in Zucker rat model of leptin receptor
deficiency and genetic obesity. Experimental Physiology, 97(11), pp.1236-1245.
9. Janke, E., Collins, A. and Kozak, A. (2007). Overview of the relationship between pain
and obesity: What do we know? Where do we go next?. The Journal of Rehabilitation
Research and Development, 44(2), p.245. [online] Available at:
http://www.rehab.research.va.gov/jour/07/44/2/Janke.html [Accessed 5 Feb. 2015].
10. Kava, R., Greenwood, M. and Johnson, P. (1990). Zucker (fa/fa) Rat. ILAR Journal,
32(3), pp.4-8.
11. Loebig, M., Klement, J., Schmoller, A., Betz, S., Heuck, N., Schweiger, U., Peters, A.,
Schultes, B. and Oltmanns, K. (2010). Evidence for a Relationship between VEGF and
BMI Independent of Insulin Sensitivity by Glucose Clamp Procedure in a Homogenous
25. 24
Group Healthy Young Men. PLoS ONE, [online] 5(9), p.e12610. Available at:
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2935379/ [Accessed 17 Mar. 2015].
12. Lu, X., Ji, Y., Zhang, L., Zhang, Y., Zhang, S., An, Y., Liu, P. and Zheng, Y. (2012).
Resistance to Obesity by Repression of VEGF Gene Expression through Induction of
Brown-Like Adipocyte Differentiation. Endocrinology, [online] 153(7), pp.3123-3132.
Available at: http://press.endocrine.org/doi/abs/10.1210/en.2012-1151 [Accessed 17
Mar. 2015].
13. Marti, H. (2000). Vascular Endothelial Growth Factor. Landes Bioscience. [online]
Available at: http://www.ncbi.nlm.nih.gov/books/NBK6149/ [Accessed 13 Feb. 2015].
14. Motaghedi, R., Bae, J., Memtsoudis, S., Kim, D., Beathe, J., Paroli, L., YaDeau, J.,
Gordon, M., Maalouf, D., Lin, Y., Ma, Y., Cunningham-Rundles, S. and Liu, S. (2014).
Association of obesity with inflammation and pain after total hip a... - PubMed - NCBI.
[online] Ncbi.nlm.nih.gov. Available at: http://www.ncbi.nlm.nih.gov/pubmed/24096457
[Accessed 13 Feb. 2015].
15. Nakhooda, A., Like, A., Chappel, C., Murray, F. and Marliss, E. (1977). The
Spontaneously Diabetic Wistar Rat: Metabolic and Morphologic Studies. Diabetes,
[online] 26(2), pp.100-112. Available at:
http://diabetes.diabetesjournals.org/content/26/2/100.abstract [Accessed 14 Mar. 2015].
16. Pasarica, M., Sereda, O., Redman, L., Albarado, D., Hymel, D., Roan, L., Rood, J., Burk,
D. and Smith, S. (2008). Reduced Adipose Tissue Oxygenation in Human Obesity:
Evidence for Rarefaction, Macrophage Chemotaxis, and Inflammation Without an
Angiogenic Response. Diabetes, [online] 58(3), pp.718-725. Available at:
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2646071/ [Accessed 17 Mar. 2015].
17. Rehman, J., Considine, R., Bovenkerk, J., Li, J., Slavens, C., Jones, R. and March, K.
(2003). Obesity is associated with increased levels of circulating hepatocyte growth
factor. Journal of the American College of Cardiology, [online] 41(8), pp.1408-1413.
Available at: http://www.sciencedirect.com/science/article/pii/S0735109703002316
[Accessed 17 Mar. 2015].
18. Rosenstein, J., Krum, J. and Ruhrberg, C. (2010). VEGF in the nervous system.
Organogenesis, [online] 6(2), p.107. Available at:
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2901814/ [Accessed 13 Feb. 2015].
19. Sharron Dolan and Andrea Mary Nolan, (2007). Blockade of metabotropic glutamate
receptor 5 activation inhibits mechanical hypersensitivity following abdominal surgery.
European Journal of Pain Volume 11, Issue 6, pages 644–651.
20. Silha, J., Krsek, M., Sucharda, P. and Murphy, L. (2005). Angiogenic factors are elevated
in overweight and obese individuals. Int J Obes Relat Metab Disord, [online] 29(11),
pp.1308-1314. Available at: http://www.nature.com/ijo/journal/v29/n11/full/0802987a.html
[Accessed 17 Mar. 2015].
21. Stolzman, S. (2013). The Influence of Cytokines on Obesity-Associated Pain. [online]
Epublications.marquette.edu. Available at:
http://epublications.marquette.edu/cgi/viewcontent.cgi?article=1010&context=dittman
[Accessed 13 Feb. 2015].
22. Sun, K., Asterholm, I., Kusminski, C., Bueno, A., Wang, Z., Pollard, J., Brekken, R. and
Scherer, P. (2012). Dichotomous effects of VEGF-A on adipose tissue dysfunction.
Proceedings of the National Academy of Sciences, [online] 109(15), pp.5874-5879.
Available at: http://www.pnas.org/content/109/15/5874.full [Accessed 17 Mar. 2015].
23. Sung, H., Doh, K., Son, J., Park, J., Bae, Y., Choi, S., Nelson, S., Cowling, R., Nagy, K.,
Michael, I., Koh, G., Adamson, S., Pawson, T. and Nagy, A. (2013). Adipose Vascular
26. 25
Endothelial Growth Factor Regulates Metabolic Homeostasis through Angiogenesis. Cell
Metabolism, [online] 17(1), pp.61-72. Available at:
http://www.sciencedirect.com/science/article/pii/S1550413112005013 [Accessed 17 Mar.
2015].
24. Thangarajah, H., Yao, D., Chang, E., Shi, Y., Jazayeri, L., Vial, I., Galiano, R., Du, X.,
Grogan, R., Galvez, M., Januszyk, M., Brownlee, M. and Gurtner, G. (2009). The
molecular basis for impaired hypoxia-induced VEGF expression in diabetic tissues.
Proceedings of the National Academy of Sciences, [online] 106(32), pp.13505-13510.
Available at: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2726398/ [Accessed 17 Mar.
2015].
25. Tinahones, F., Coín-Aragüez, L., Mayas, M., Garcia-Fuentes, E., Hurtado-del-Pozo, C.,
Vendrell, J., Cardona, F., Calvo, R., Obregon, M. and El Bekay, R. (2012). Obesity-
associated insulin resistance is correlated to adipose tissue vascular endothelial growth
factors and metalloproteinase levels. BMC Physiol, [online] 12(1), p.4. Available at:
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3382430/ [Accessed 17 Mar. 2015].
26. Wu, L., Meoli, C., Mangiafico, S., Fazakerley, D., Cogger, V., Mohamad, M., Pant, H.,
Kang, M., Powter, E., Burchfield, J., Xirouchaki, C., Mikolaizak, A., Stockli, J., Kolumam,
G., van Bruggen, N., Gamble, J., Le Couteur, D., Cooney, G., Andrikopoulos, S. and
James, D. (2014). Systemic VEGF-A Neutralization Ameliorates Diet-Induced Metabolic
Dysfunction. Diabetes, [online] 63(8), pp.2656-2667. Available at:
http://diabetes.diabetesjournals.org/content/63/8/2656.short [Accessed 13 Feb. 2015].
27. Yilmaz, M. and Hotamisligil, G. (2013). Damned If You Do, Damned If You Don’t: The
Conundrum of Adipose Tissue Vascularization. Cell Metabolism, [online] 17(1), pp.7-9.
Available at: http://www.sciencedirect.com/science/article/pii/S1550413112005050
[Accessed 17 Mar. 2015].
28. Zhang, J. and An, J. (2007). Cytokines, Inflammation, and Pain. International
Anesthesiology Clinics, 45(2), pp.27-37. [online] Available at:
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2785020/html [Accessed 5 Feb. 2015].
