Master Version (1)

Phenomic Evaluation and Molecular
Breeding of Field-Grown Transgenic
Perennial Ryegrass (Lolium perenne)
with Altered Fructan Biosynthesis
Submitted by
Pieter E. Badenhorst
Bachelor of Science (Hons)
Master of Science
A thesis submitted in total fulfilment
of the requirements for the degree of
Doctor of Philosophy
School of Life Sciences
Faculty of Science, Technology and Engineering
La Trobe University
Bundoora, Victoria 3086
October 2014

i | P a g e
Table of contents
Table of contents ...................................................................................................i
List of abbreviations............................................................................................ vii
Abstract ................................................................................................................x
Statement of authorship....................................................................................... xi
Acknowledgements ............................................................................................ xii
Chapter 1..............................................................................................................1
1.1 Perennial ryegrass (Lolium perenne L.) growth and development.............1
1.2 Endophyte – Lolium symbiota....................................................................4
1.3 Current breeding methods for improvement of Lolium grasses .................6
1.3.1 Conventional breeding strategies .......................................................6
Recurrent restricted phenotypic selection ....................................................11
Half-sib progeny test ....................................................................................13
Between and within family selection.............................................................15
Recurrent multi-step family selection ...........................................................17
1.3.2 Marker-assisted breeding .................................................................19
1.3.3 Genomic selection ............................................................................21
Factors affecting the accuracy of genomic selection in Lolium grasses.......22
1.3.4 Genetic transformation of Lolium grasses ........................................28
1.4 Alteration of fructan biosynthesis through genetic transformation............30
1.4.1 Fructan structure and biosynthesis.........................................................31
1.4.2 Fructan biosynthesis in Lolium grasses..................................................33
1.5 A novel molecular breeding strategy for transgenic Lolium grasses ........35

ii | P a g e
1.6 Objectives ................................................................................................36
Chapter 2 Material and Methods ........................................................................37
2.1 Plant material ............................................................................................37
2.2 Genetic transformation ..............................................................................37
2.2.1 Construction of expression vectors .....................................................37
2.2.2 Genetic transformation of perennial ryegrass .....................................39
2.3 Molecular analysis.....................................................................................41
2.3.1 Transgene detection ...........................................................................41
Real-time PCR .............................................................................................41
Southern hybridisation .................................................................................41
2.3.2 Transgene expression.........................................................................43
2.3.3 Endophyte detection ...........................................................................44
2.4 Regulatory compliance..............................................................................46
2.5 Field trial designs ......................................................................................50
2.5.1 Field trial design for primary T0 transgenic perennial ryegrass events 50
2.5.2 Field trial design for perennial ryegrass breeding nurseries................53
2.5.3 Field trial design for transgenic T1 perennial ryegrass progeny...........54
2.6 Phenotypic measurements........................................................................56
2.6.1 Plant vigour .........................................................................................57
2.6.2 Biomass yield......................................................................................57
2.6.3 Estimated biomass yield .....................................................................58
2.6.4 Regrowth.............................................................................................58
2.6.5 Crown rust infection ............................................................................58
2.7 Biochemical analysis .................................................................................58

iii | P a g e
2.7.1 Near-infrared spectroscopy.................................................................58
2.7.2 High-performance liquid chromatography ...........................................59
2.8 Total fructan yield......................................................................................61
2.9 Data analysis.............................................................................................61
2.10 Crossing methods for perennial ryegrass................................................61
2.10.1 Floral induction..................................................................................61
2.10.2 Crossing............................................................................................63
2.10.3 Seed harvest and germination ..........................................................65
Chapter 3 Designer forages: From single cell to the field ...................................68
3.1 Introduction...................................................................................................68
3.2 Results..........................................................................................................69
3.2.1 Tissue culture responsiveness ...............................................................69
3.2.2 Biolistic transformation of genotype FLp418-20 .....................................70
3.2.3 Field evaluation of primary T0 transgenic perennial ryegrass plants with
altered fructan biosynthesis.............................................................................71
Agronomic performance of primary T0 transgenic perennial ryegrass plants
.....................................................................................................................71
Fructan concentration of leaf blades and pseudostems in primary T0
transgenic perennial ryegrass plants............................................................72
Nutritional composition in primary T0 perennial ryegrass events..................73
3.2.4 Field evaluation of recipient perennial ryegrass genotypes for agronomic
performance ....................................................................................................74
3.2.5 Generation of transgenic T1 populations ................................................74
3.3 Discussion ....................................................................................................84

iv | P a g e
3.3.1 Generation of primary T0 perennial ryegrass events with altered fructan
biosynthesis.....................................................................................................84
3.3.2 Assessment of primary T0 perennial ryegrass events.............................86
3.4.3 Selection of superior perennial ryegrass genotypes...............................87
3.4.4 Generation of transgenic T1/F1 progeny .................................................88
Chapter 4 Field evaluation of T1 transgenic perennial ryegrass for enhanced
fructan biosynthesis............................................................................................90
4.1 Introduction...................................................................................................90
4.2 Results..........................................................................................................91
4.2.1 Crown rust infection................................................................................91
Crown rust infection in primary T0 events.....................................................91
Crown rust infection in T1 progeny ...............................................................92
Crown rust infection in selected T1 progeny.................................................92
4.2.2 Biomass yield .........................................................................................92
Biomass yield in primary T0 events ..............................................................92
Biomass yield in T1 progeny.........................................................................93
Variation in biomass yield of T1 progenies and their full-sib F1 null controls 95
Biomass yield of selected T1 progeny ..........................................................97
4.2.3 Fructan concentration.............................................................................97
Fructan concentration in primary T0 events..................................................97
Fructan concentration in T1 progeny ............................................................98
Fructan concentration in selected T1 progeny..............................................99
4.2.4 Fructan yield.........................................................................................101
Fructan yield of primary T0 transgenic events ............................................101

v | P a g e
Fructan yield of transgenic T1 progeny.......................................................101
Fructan yield of selected transgenic T1 progeny ........................................101
4.2.5 SNP genotyping analysis of primary T0 transgenic events and their
progeny .........................................................................................................102
4.2.6 Poly-crosses of selected T1 progeny ....................................................108
4.3 Discussion ..................................................................................................110
Chapter 5 Nutritive composition of transgenic perennial ryegrass with altered
fructan biosynthesis..........................................................................................114
5.1 Introduction.................................................................................................114
5.2 Results........................................................................................................116
5.2.1 Metabolisable energy estimation in primary T0 events and their progeny
......................................................................................................................116
5.2.2 Water-soluble carbohydrate concentration in primary T0 events and their
progeny .........................................................................................................117
5.2.3 Crude protein concentration in primary T0 events and their progeny....118
5.2.4 Neutral detergent fibre concentration in primary T0 events and their
progeny .........................................................................................................119
5.2.5 Acid detergent fibre concentration in primary T0 events and their progeny
......................................................................................................................119
5.2.6 In vivo dry matter digestibility in primary T0 events and their progeny..120
5.3 Discussion ..................................................................................................125
Chapter 6 Breeding strategies for enhanced transgenic germplasm development
in Lolium grasses..............................................................................................129
6.1 Introduction.................................................................................................129
6.2 Selection methods for tissue culture responsive genotypes .......................131

vi | P a g e
6.3 Development, evaluation and selection of primary T0 transgenic events in
Lolium grasses .................................................................................................133
6.4 Introgression of the transgene into the wider breeding population .............135
6.5 Evaluation of progeny for trait stability and agronomic performance ..........137
6.6 An optimum transgenic breeding strategy in Lolium grasses......................139
6.7 Conclusion..................................................................................................142
References .......................................................................................................145

vii | P a g e
List of abbreviations
1-FFT Fructan:fructan 1-fructosyltransferase
6G-FFT Fructan:fructan 6G-fructosyltransferase
6-SFT Sucrose:fructan 6-fructosyltransferase
1-SST Sucrose:sucrose 1-fructosyltransferase
ADF Acid detergent fibre
AFIA Australian Fodder Industry Association
AFLP Amplified fragment length polymorphism
B&WFS Between and within family selection
Ca(ClO)2 Calcium hypochlorite
CP Crude protein
DArT Diversity array technology
DMD Dry matter digestibility
DNA Deoxyribonucleic acid
E Elongation
EC Embryogenic callus
FFT Fructan-fructan-fructosyltransferase
GEBV Genomic estimated breeding value
GOI Gene-of-interest
GS Genomic selection
h2
Heritability
ha Hectares
hph Hygromycin phosphotransferase

viii | P a g e
HPLC High pressure liquid chromatography
HSPT Half-sib progeny test
ISTA International Seed Testing Association
IVVDMD In vivo dry matter digestibility
IVVOMD In vivo organic matter digestibility
KNO3 Potassium nitrate
LD Linkage disequilibrium
MAS Marker-assisted selection
ME Metabolisable energy
Me Effective number of independent chromosome segments
N Nitrogen
NDF Neutral detergent fibre
Ne Effective population size
NIRS Near-infrared spectroscopy
OGTR The Office of the Gene Technology Regulator
PC2 Physical containment level 2
PCR Polymerase chain reaction
PI Primary Induction
QTL Quantitative trait loci
R Reproductive
RAPD Randomly amplified polymorphic DNA
REML Residual maximum likelihood
RFLP Restriction fragment length polymorphism
RMFS Recurrent multistep family selection

ix | P a g e
RRPS Recurrent restricted phenotypic selection
RuBisCo Ribulose-1,5-bisphosphate carboxylase/oxygenase
SI Secondary induction
SNP Single nucleotide polymorphism
SSR Simple sequence repeat
SST Sucrose-sucrose-fructosyltransferase
TCR Tissue culture responsive
UK United Kingdom
V Vegetative
VA Additive variance
VDEPI Victorian Department of Environment and Primary Industries
VE Environmental variance
WSC Water-soluble carbohydrates

x | P a g e
Abstract
Grasses of the genus Lolium are key pasture species in temperate agriculture
and provide the grazing feed-base for the dairy, beef and sheep meat production
industries. South-east Australia contains more than 6 million hectares (ha) of
pasture with perennial ryegrass (Lolium perenne L.) as the major sown grass
species, which dominates dairy production systems in Victoria.
Improving pasture grass digestibility is a key objective for pasture grass
development, due to its potential to increase animal production through
increased intake and energy yield. In Australia, increased dry matter digestibility
(DMD) and increased water-soluble carbohydrate (WSC) were ranked as the
most important traits for genetic improvement of nutritional value in grasses.
Genetic improvement in dry matter digestibility is slow when using conventional
breeding methods such as phenotypic selection, due to low heritability and the
large number of genes that control the trait(Barnes, 1990). Fructans, a class of
WSC, are major contributors to the digestibility of pasture grasses. Therefore,
alteration of fructan concentration in pasture grasses would alter their
digestibility(Buxton and Russell, 1988; Miller et al., 2001c).
In this study, a transgenic approach has been investigated to increase energy
yield of perennial ryegrass through targeted expression of fructan biosynthesis in
the leaf blades and pseudostems. Fixing a transgenic trait in a homozygous
state, in cross-pollinated species is more complex than in self-pollinated species,
and it can also lead to inbreeding depression. The objectives of this thesis are to
evaluate transgenic perennial ryegrass events with enhanced fructan
biosynthesis in field conditions and to develop and discuss an optimal breeding
strategy for transgenic Lolium grasses.

xi | P a g e
Statement of authorship
Except where reference is made in the text of the thesis, this thesis contains no
material published elsewhere or extracted in whole or in part from a thesis
submitted for the award of any other degree or diploma.
No other person’s work has been used without due acknowledgement in the
main text of the thesis.
The thesis has not been submitted for the award of any other degree or diploma
in any other tertiary institution.
Pieter E. Badenhorst
October 2014

xii | P a g e
Acknowledgements
I am sincerely grateful for the Victorian Department of Environment and Primary
Industries (VDEPI), the School of Life Science, La Trobe University and the Dairy
Futures Cooperative Research Centre for the opportunity to undertake these
studies. In particular I want to thank Prof. German Spangenberg and Prof. John
Mason for their supervision and encouragement during the project and Dr. Tony
Slater for all his input.
I would like to thank the Molecular Plant Breeding group of VDEPI at Hamilton
for all the technical support. In particular I would like to thank Carly Elliott and
Darren Pickett for their continued assistance and support.
I would like to thank the Plant Functional Genomics group of VDEPI at AgriBio,
who undertook the molecular biological assays that were used in these studies.
In particular the work undertaken by Susan Georges, Zhiqian Liu and Stephen
Panter.
I would like to thank Prof. Kevin Smith for his mentorship and support and advise
towards my scientific research and career.
I would like to thank God for the wisdom and perseverance that he has bestowed
upon me during this research project and throughout my life.
I would like to thank my family and friends for all their support.
Last but not least, I owe my deepest gratitude to my amazing wife Michelle for
her unending tolerance, patience and support.

1 | P a g e
Chapter 1
1.1 Perennial ryegrass (Lolium perenne L.) growth and
development
The Lolium genus is classified within the family Poaceae, syn. Gramineae
(Mallett and Orchard, 2002; Wheeler et al., 2002). This genus belongs to the
tribe Poeae and falls within the sub-family of Pooideae (Wheeler et al., 2002).
Lolium species are indigenous to Europe, North Africa and temperate Asia, with
the main centre of origin of Poaceae being Western Europe (Meyer, 2003; Polok,
2007; Wipff, 2002). Plant morphology among grass species is relatively similar
with only small variations between species. Variation between species is seen in
the spatial tillering arrangement, plant height and leaf length, vegetative leaf
texture and the inflorescence morphology (Lamp et al., 2001; Polok, 2007). The
morphology of perennial ryegrass is illustrated in Figure 1.1.
Perennial ryegrass is adapted to temperate regions with 550 – 800 mm annual
rainfall and is defined as a temperate or cool season grass due to its preferential
adaptation to moist and cool environments (Romani et al., 2002). It is the most
significant pasture grass in temperate Australia and other temperate regions
around the globe (Cunliffe, 2004; Cunningham et al., 1994) and provides a
critical role in providing high quality fodder to all livestock industries in these
regions. It is easy to establish and will provide dense swards of highly
productive, palatable and digestible grass (Delagarde et al., 2000; Yamada et al.,
2005). Perennial ryegrass has a number of important characteristics that account
for its extensive use and popularity as forage. These characteristics include high
herbage yield, palatability, a long growing season, high digestibility, excellent
persistence under grazing and its tolerance to a wide range of environmental
factors (Delagarde et al., 2000; Yamada et al., 2005).
Perennial ryegrass is a self-incompatible, outcrossing species (Copeland and
Hardin, 1970; Cornish et al., 1979). The self-incompatible nature of perennial
ryegrass is due to a gametophytic two-locus system (S and Z) that prevents self-
fertilisation and inbreeding depression (Cornish et al., 1979; Fearon et al., 1984;

2 | P a g e
Thorogood and Hayward, 1991; Thorogood et al., 2002). S and Z allelic diversity
can be reduced in smaller populations, resulting in self-incompatibility or
inbreeding depression.
Figure 1.1. Morphology of Lolium perenne (source: Polok 2007)

3 | P a g e
Floral induction marks the transition from a vegetative state to a reproductive
state and requires a dual induction in most temperate perennial grasses (Heide,
1994; Langer, 1972; Sharman, 1945). Floral induction occurs in response to a
photoperiodic stimulus. The primary induction (PI) is brought on by short days
and/or low temperatures (vernalisation) followed with a secondary induction (SI)
in response to a transition to longer days and moderately high temperatures
(Aamlid et al., 2001; Heide, 1994; Meyer, 2003). The PI enables initiation of
inflorescence primordia and the SI enables culm elongation, inflorescence
development and anthesis (Aamlid et al., 2001; Heide, 1994). In perennial
ryegrass, floral initiation only begins after secondary induction (Andersen et al.,
2006). Perennial ryegrass has an obligate PI requirement of at least two weeks
of short days and/or low temperatures before floral initiation will begin (Aamlid et
al., 2001; Cooper, 1960; OGTR, 2008). The requirements for both primary and
secondary induction vary greatly between individual plants, with the requirement
generally increasing with an increase in the latitude of germplasm origin (Aamlid
et al., 2001; Cooper, 1960).
Anthesis in perennial ryegrass starts at the central spikelets and proceeds
towards the base and apex at the same time. Within each spikelet, anthesis
begins at the lowest florets and moves towards the tip (Warringa, 1997). At
anthesis, each flower releases two anthers on long, thin filaments that will move
and release pollen with a slight breeze, and a large feathery stigma to capture
wind-borne pollen (Figure 1.2). The growth rate of perennial ryegrass pollen
tubes are affected by temperatures in the range of 14°C to 26°C, where higher
temperature leads to increased pollination rates (Elgersma et al., 1989).
Pollination in wind pollinated grasses is influenced by a number of factors,
including reproductive aspects (floral fertility, timing of flowering of pollen donors
and receivers, level of pollen production, pollen viability, inflorescence height and
size, number of panicles and pollen weight), climatic conditions (wind speed,
wind direction and humidity), ecological factors (distance between donor and
receiver, density of donor and receiver plants and geographical barriers) and
genetic factors (ploidy and genetic compatibility) of both the pollen donor and
pollen recipient (Rognli et al., 2000; Smart et al., 1979).

4 | P a g e
Studies have shown that the most effective pollination in perennial ryegrass
occurs within 6 m of the pollen source. In the prevailing wind direction, some
pollination occurs up to 150 m away, with no outcrossing detected at 200 m
(Copeland and Hardin, 1970; Giddings et al., 1997a, b; Wang et al., 2004).
Figure 1.2. Flowering spikelet from Lolium perenne (Callow, 2009).
1.2 Endophyte – Lolium symbiota
An endophyte (Greek: endo = within + phyte = plant) is defined as an organism
that lives its entire life cycle within a host plant without causing disease (Wilson,
1995). Endophytic fungi are naturally occurring organisms that grow within the
intercellular spaces of the basal meristems, leaf sheaths, flowering stems and
seeds of many forage grasses in the Poaceae family (Philipson and Christey,
1986; Siegel et al., 1987). Neotyphodium lolii exists in symbiosis with perennial
ryegrass, relying on the host for nutrients, protection and dissemination (Latch et
al., 1984; van Zijl de Jong et al., 2008). The endophyte in return provides the
host grass with enhanced fitness (Bush et al., 1997) and protects the host grass
from biotic and abiotic environmental stresses (Breen, 1994; Clements and

5 | P a g e
Lewis, 1988; Hesse et al., 2004; Hesse et al., 2003; Reed et al., 2000; van Zijl de
Jong et al., 2008). These benefits are partially due to the production of
biologically active alkaloids by the endophytes.
Endophytes can produce several classes of alkaloid metabolites (Bush et al.,
1997; Keogh et al., 1996). The alkaloid profiles vary among different endophyte
species and can be selected based on the range of alkaloids that they produce
(Bush et al., 1997). The four major classes of endophyte alkaloids produced by
Neotyphodium are the indole-diterpenoid, pyrrolopyrazine, aminopyrrolizidine
and ergot alkaloids (Figure 1.3) (Clay and Schardl, 2002). The main benefit of
ergot alkaloids for grasses is the bio-protective activity against insects (Bush et
al., 1997). Ergot alkaloids and indole-diterpenes (lolitrems) are detrimental to
livestock producers as they cause neurotoxic effects on grazing vertebrates that
have consumed endophyte-infected grasses (Bush et al., 1997; Porter, 1995;
Strickland et al., 1996). Symptoms include lowered serum prolactin levels,
elevated body temperature, lowered reproduction, lowered milk production and
exacerbation of the tremorgenic condition known as ryegrass staggers (Bush et
al., 1997; Strickland et al., 1996). Peramine (pyrrolopyrazine) has insect
deterrent properties, while lolines (aminopyrrolizidines) have insecticidal
properties (Bush et al., 1997; Porter, 1995). Despite the toxicity of ergovaline and
lolitrem B on grazing vertebrates, endophyte infection is considered to have a net
benefit in many agricultural systems. Grasses harbouring an endophyte have a
competitive advantage in most grassland communities and will eventually
dominate a plant community (van Zijll de Jong et al., 2003).
Endophytes thus confer agronomic advantages to the host plant but can also be
detrimental to the health of grazing animals. Selection of a specific endophyte
that only produces a range of alkaloids that are non-toxic to the animal can
overcome these detrimental health effects (Fletcher et al., 1991). A number of
commercial perennial ryegrass cultivars contain such novel endophytes (Bluett et
al., 2005a; Bluett et al., 2005b; Bluett et al., 2004).

6 | P a g e
Figure 1.3. The four major classes of endophyte alkaloids in Neotyphodium spp.
(Clay and Schardl, 2002).
1.3 Current breeding methods for improvement of
Lolium grasses
1.3.1 Conventional breeding strategies
A concerted effort in the breeding of forage grasses for improved agronomic
performance only began at the beginning of the 20th
century, much later than
most other major agricultural crops. In the 1980’s, in Germany, it was still
possible to find a natural population of perennial ryegrass that was as good as
the best commercial variety (Spatz et al., 1987; Wilkins and Humphreys, 2003a).
Since the 1950’s, most of the genetic gain for dry matter yield and dry matter
digestibility was achieved through sexual recombination and directional selection
(Wilkins and Humphreys, 2003a). Early bred forage cultivars were classified
according to maturity and use, where tall plants were classed as hay-types and
plants with lower growth patterns were classified as pasture-types (Casler et al.,
1996).
Since then, breeding selection criteria of temperate forage grasses have
focussed on the development of cultivars that produce more feed and improve
animal performance on farm (Casler et al., 1996; Humphreys, 1997; Stewart and

7 | P a g e
Hayes, 2011). These selection criteria took into account that perennial cultivars
need to be able to persist under local climatic conditions, persist under regular
defoliation through livestock grazing and cope with pest and disease pressures
(Casler et al., 1996; Stewart and Hayes, 2011). Furthermore, having adequate
seed yield is crucial for the delivery of the cultivar to market (Stewart and Hayes,
2011).
The desirable traits selected in perennial ryegrass breeding programs are thus
improved dry matter production (total yield and seasonal yield), digestibility,
persistence, tolerance to biotic and abiotic stresses, flowering behaviour and
seed production (Casler et al., 1996; Conaghan and Casler, 2011; Stewart and
Hayes, 2011). The desirable traits in perennial ryegrass can be broadly divided
into three categories that influence production: forage yield, forage quality and
persistence (Stewart and Hayes, 2011). It is necessary to select for a range of
these traits, with the emphasis placed on each trait based on the economic value
of that trait within the targeted farming system where the cultivar will be used
(Stewart and Hayes, 2011).
Perennial ryegrass, like the majority of important forage grasses, is a self-
incompatible, outcrossing species and this largely determines the selection
strategy used in breeding. Outcrossing species have characteristic population
structures, with self-incompatibility making the plants dependent upon foreign
pollen for seed set. Each plant receives pollen from a large number of individuals
in the population, each having different genotypes (Warringa, 1997; Wit, 1952).
These populations are generally genetically diverse, with a high proportion of
heterozygosity at each locus, maintained by unrestricted gene flow among
individuals within the population (Levin and Kerster, 1974). A reduction of this
genetic diversity can lead to inbreeding depression, often observed as a
reduction of yield and/or seed set; usually due to the expression of linked
recessive deleterious alleles (Fejer, 1958; Thorogood and Hayward, 1991). It is
thus important to ensure that the response to selection is not restricted by a lack
of genetic variation. To create a base population for breeding, germplasm can be
selected from new and old cultivars, wild accessions, related species or a
combination of these (Stewart and Hayes, 2011; Vogel and Pedersen, 1993).

8 | P a g e
Breeding strategies for perennial ryegrass have also been influenced by the fact
that it is grown as dense swards. However, the evaluation and selection of
individual plants under these conditions is not feasible (Vogel and Pedersen,
1993). Therefore, the selected germplasm is most commonly collected as seed,
germinated in the glasshouse and transplanted into space-planted plots in
evaluation nurseries (Levy, 1932; Vogel and Pedersen, 1993; Watson, 2000).
Space-planted nurseries provide the breeder with the opportunity to observe
phenotypic variation within and between populations grown under uniform
conditions. This gives the breeder the ability to select phenotypically superior
plants from the best populations/accessions (Vogel and Pedersen, 1993;
Watson, 2000). Selection of individual plants is based on the phenotypic
variation in traits such as growth habit, flowering date, vigour, disease resistance
and persistence (Humphreys, 1995; Stewart and Hayes, 2011; Wilkins, 1991).
However, the performance of space-planted individuals does not accurately
predict characteristics such as yield and persistency under competitive sward
conditions (Stewart and Hayes, 2011). Such characteristics can however be
evaluated in progeny testing under sward conditions. Superior plants selected
from within the breeding populations are moved to an isolated nursery and poly-
crossed to produce a new population with fixed genetic gains from the previous
cycle of selection (Vogel and Pedersen, 1993). A poly-cross nursery allows for
the random intermating of selected genotypes in isolation from any other
compatible genotypes (Vogel and Pedersen, 1993). This conserves sufficient
genetic variation within the progeny, while increasing the frequency of alleles
with favourable phenotypic expression (Lee, 1995). The genotypes selected for
poly-crossing was based on improved agronomic traits, which are mostly
quantitatively inherited (Vogel and Petersen, 1993).
When it comes to the logistics of a commercial forage breeding program, the
program is designed to start a new breeding cycle each year, allowing for a
potential variety release each year (Figure 1.4). Many different breeding
schemes have been implemented commercially for forage grasses. A generic
breeding scheme is described below, to depict most of the relevant features of a
commercial breeding program (Figure 1.4). Most of the commercial breeding
programs are based on the establishment of a base population that contains
around 10,000 plants. These plants are used for seed multiplication within

9 | P a g e
families, to produce up to a 100,000 plants for mass selection. A space-planted
nursery of the 100,000 plants is then used to visually asses the performance of
individual plants, where a 1% sub-selection is chosen based on agronomic
performance traits such as biomass yield, forage quality, disease resistance and
persistence. The surviving group of up to a 1,000 potential parental genotypes
undergo further evaluation of key agronomic characteristics such as biomass
yield and persistence. The various evaluation and selection methods for these
potential parental genotypes are described below. The best parental genotypes,
with similar heading dates, are selected as the foundation (Syn0) individuals and
are later poly-crossed to produce the first synthetic (Syn1) population. The Syn2
populations are generated through Syn1 multiplication and then assessed as
swards in multiple environments, allowing for the selection of a single population
for commercial release as a variety (Hayes et al., 2013).
Figure 1.4. Generic scheme for a current commercial ryegrass breeding program
(Hayes et al., 2013).
Specific recurrent selection breeding strategies for the improvement of perennial
cross-pollinating forage grasses have been reviewed extensively (Conaghan and
Casler, 2011; Vogel and Pedersen, 1993; Wilkins and Thorogood, 1992). The
objective of the recurrent selection breeding strategies is to change the

10 | P a g e
population mean by utilizing additive genetic variation in each selection cycle
(Figure 1.5) (Vogel and Pedersen, 1993). This allows for the identification and
selection of superior genotypes followed by the interbreeding of these superior
genotypes to produce new combinations of genotypes with an improved mean
performance relative to the original population. This cycle can continue until the
improved mean performance is sufficiently different to the original population,
where the improved populations can be released as a synthetic variety (Vogel
and Pedersen, 1993). Some of the most successful breeding strategies used for
cross-pollinating forage grasses are recurrent restricted phenotypic selection
(RRPS), half-sib progeny test (HSPT), between and within family selection
(B&WFS) and recurrent multi-step family selection (RMFS) (Vogel and Pedersen,
1993). A summary of these breeding strategies is described below.
Figure 1.5. Representation of the theoretical effect of three cycles of restricted,
recurrent phenotypic selection on yield. The area under the curve represents all
plants in the population. The shaded area represents the selected plants. In this
example, 5% of the highest-yielding plants are selected from each cycle,
heritability is 40%, and the phenotypic standard deviation is 10. The population
mean ( X ) of the base population is 100 in cycle 1 (Vogel and Pedersen, 1993).

11 | P a g e
Recurrent restricted phenotypic selection
RRPS is an efficient breeding strategy for mass selection in perennial forage
grasses. The RRPS strategy aims to reduce the influence of environmental
variation on selection decisions, by subdividing the selection nursery into smaller
selection units (Vogel and Pedersen, 1993, 2010). The RRPS is summarized as
follows (Figure 1.6):
Year 1: Establish space-planted evaluation nursery. Phenotypic data can be
collected in this establishment year, depending on the trait of
interest.
Year 2: Sub-divide the space-planted evaluation nurseries into selection
units. This is done to reduce the impact of environmental variation on
the breeders selection decisions. The size of the selection units can
vary depending on the base population size and the selection
intensity selected. Plants in each selection unit are measured and
evaluated for the desired trait or combination of traits.
Year 3: A fixed number of plants from each selection unit are selected,
based on the selection intensity. Generally a selection intensity of
10% is used. Selected plants from each selection unit are
transplanted to an isolated nursery for poly-crossing. Equal amounts
of seed from each plant in the poly-cross are bulked and used for the
next cycle of selection.
Year 4: Sward trials are established for further evaluation after each cycle of
selection. The next cycle of selection (year 1 of cycle 2) is started
using the bulked seed from the previous cycle of selection. The
process repeats until sufficient genetic gain has been achieved.
RRPS is an easy breeding system to use with minimum time intervals per cycle
of selection. It utilizes within and between family genetic variation, and
inbreeding depression is minimized due to the large number of plants that are
intermated.

12 | P a g e
Figure 1.6. Recurrent restricted phenotypic selection adapted from Vogel and
Pedersen (1993).

13 | P a g e
Half-sib progeny test
The HSPT breeding strategy has been extensively used in the production of
perennial ryegrass cultivars and allows for better results than RRPS for traits with
low heritability (Burton, 2010). The HSPT breeding system identifies superior
seed parents based on the performance of their half-sib progeny (Fehr, 1987), in
replicated field trials to minimize large environmental variances (Nguyen and
Sleper, 1983). The HSPT breeding strategy has been extensively used for the
development of initial cultivars. It has, however, not been useful for subsequent
improvement trials (Vogel and Pedersen, 1993). The HSPT strategy is
summarized as follows (Figure 1.7):
Year 1-2: Same as in RRPS
Year 3: Selected plants from each selection unit are transplanted to an
isolated nursery for poly-crossing. Seed from each plant in the poly-
cross is harvested and bulked by genotype.
Year 4: Replicated half-sib progeny evaluation nurseries are established
using the progeny of each genotype from the poly-cross nursery.
Year 5-6: Evaluation of half-sib families is completed. Using the mean family
values from the half-sib progeny, a subset of superior genotypes are
selected from the original poly-cross nursery.
Year 6-7: The selected genotypes from the original poly-cross nursery are
poly-crossed. Equal amounts of seed from each plant in the poly-
cross are bulked to form the new population.
HSPT is usually stopped after a single cycle as it can only utilize the between
family genetic variation, which is only part of the total variation that can be
utilized by breeders using this breeding system (Connolly, 2001; Vogel and
Pedersen, 1993).

14 | P a g e
Figure 1.7. Half-sib progeny test adapted from Vogel and Pedersen (1993).

15 | P a g e
Between and within family selection
Within-family selection is based on the deviation of an individual from the family
mean to which it belongs. Individuals that exceed their family mean are selected
(Figure 1.5) (Falconer, 1996). B&WFS utilizes both between- and within-family
genetic variance (Vogel and Pedersen, 1993). The B&WFS is summarized as
follows (Figure 1.8):
Year 1-2: Same as in RRPS.
Year 3: Selected plants from each selection unit are transplanted to an
isolated nursery for poly-crossing. An equal amount of seed from
each plant in the poly-cross is harvested and bulked alongside
female genotypes.
Year 4: Replicated half-sib progeny evaluation nurseries are established
using the progeny of each genotype from the poly-cross nursery.
Year 5-6: Evaluation and selection of half-sib families, as well as plants within
half-sib families are made. Superior genotypes within selected half-
sib families can be selected and transplanted to an isolated poly-
cross nursery in year 6. Equal amounts of seed from each plant in
the poly-cross are bulked to form a new population.
The B&WFS strategy is superior to HSPT as it utilizes the within and between
family variation, which is the total variance that can be utilized.

16 | P a g e
Figure 1.8. Between and within family selection adapted from Vogel and
Pedersen (1993)

17 | P a g e
Recurrent multi-step family selection
RMFS is an adaptation of the B&WFS and HSPT breeding strategies. RMFS
breeding is similar to the B&WFS and only differs in that it maintains the poly-
cross nursery that was used to produce the half-sib progeny seed until the
evaluation of the half-sib progeny has been completed. This information allows
for the selection of the best individuals from the best families. The selected
subset of superior parents can then be used in a new poly-cross nursery. Using
RMFS, the breeder can monitor the additive genetic variation within a population
and can calculate the rate of inbreeding through the use of estimates for genetic
variance (Vogel and Pedersen, 1993). The RMFS is summarized as follows
(Figure 1.9):
Year 1-3: Same as in B&WFS.
Year 4-6: Maintain poly-cross nursery from year 3. Replicated half-sib progeny
evaluation nurseries are established in year 4 using the progeny of
each genotype from the poly-cross nursery. Evaluation and selection
of half-sib families, as well as plants within half-sib families are made
in year 5 and 6.
Year 6: Superior genotypes within selected half-sib families can be selected
and transplanted to an isolated poly-cross nursery. Equal amounts of
seed from each plant in the poly-cross are bulked to form a new
population. A subset of superior genotypes is selected from the
original poly-cross nursery and transferred. The selected genotypes
from the original poly-cross nursery are poly-crossed. Equal amounts
of seed from each plant in the poly-cross are bulked to form a new
population.
Each cycle of selection will produce an elite population based on progeny-tested
genotypes as well as a broader-based population that captured the genetic gains
of the previous cycle of selection and to continue in a new cycle of recurrent
selection. RMFS has the same advantages as A&WFS with the added benefit of
the identification of elite genotypes that may be used in synthetic cultivar
development.

18 | P a g e
Figure 1.9. Recurrent multi-step family selection adapted from Vogel and
Pedersen (1993)

19 | P a g e
There are a number of alterations to the breeding strategies described above,
that can be used to lift the expected genetic gain per cycle (Casler and Brummer,
2008; Conaghan and Casler, 2011). Although a lot of research has been done to
design optimum breeding strategies that can overcome family progeny testing,
they have not been widely adopted. The reluctance of forage breeders to
implement new breeding strategies can be due to the risk of inbreeding, an
increase in the cost or space requirements, or disruption to their current breeding
programs.
Conventional forage breeding strategies have been mainly based on phenotypic
selection followed by sexual recombination to utilize additive genetic variation
found within and between ecotypes (Spangenberg, 2001; Vogel and Pedersen,
1993). These breeding strategies do not, however, maximise the potential rate of
genetic gain as they can only utilize a proportion of the additive genetic variance,
and thus not use all the additive genetic variation present in the population. Once
phenotypic data can be correlated with molecular data, the molecular data may
enable an increased combination of genetic factors for improved genetic gain in
the targeted phenotype.
1.3.2 Marker-assisted breeding
The discovery of restriction endonucleases (Meselson and Yuan, 1968) allowed
for the first visualisation of the composition of organisms at the DNA level. This
allowed for the detection of DNA polymorphisms. These DNA polymorphisms
can be classified according to how DNA sequence varies between different
alleles. The different DNA polymorphisms include single nucleotide
polymorphisms, insertion-deletion polymorphisms and copy-number
polymorphisms. These polymorphisms are abundant throughout the genome and
allow for the discrimination between these individuals and populations (Batley et
al., 2003; Savelkoul et al., 1999). DNA markers target specific nucleotide
polymorphisms that may exist between individuals of a population or different
populations. The first molecular marker developed, was restriction fragment
length polymorphisms (RFLP) (Botstein et al., 1980). Since then, advances in
molecular genetics have led to the development of several new types of
molecular markers. One key break-through in molecular genetics was the

20 | P a g e
development of the polymerase chain reaction (PCR) (Mullis et al., 1986), which
allowed for the development of a number of other molecular markers. These
include random amplification of polymorphic DNA (RAPD) (Williams et al., 1990),
amplified fragment length polymorphism (AFLP) (Vos et al., 1995), simple
sequence repeats (SSR) (Weber and May, 1989), single nucleotide
polymorphism (SNP) (Kwok and Chen, 2003) and Diversity Arrays Technology
(DArT) (Kilian et al., 2003).
The development of DNA markers has enabled the creation of genomic linkage
maps (Faville et al., 2004; Gill et al., 2006b; King et al., 2013), the ability to
perform pedigree analysis (Gill et al., 2006b; Sim et al., 2007; Wang et al., 2014),
cultivar identification (Wang et al., 2014) and marker assisted selection (MAS) in
perennial ryegrass (Shinozuka et al., 2012; Sim et al., 2007). These various
markers have enhanced our understanding of the genetics of traits as well as the
relative genomic location of markers associated with genes for traits (King et al.,
2013; Ye and Smith, 2008). Genetic linkage maps (Gill et al., 2006a; Jones et al.,
2002a; Jones et al., 2002b) have enabled the use of molecular markers to
assess population diversity, understand and capture heterosis, identify
quantitative trait loci (QTL), conduct marker-assisted selection, introgress unique
genetic variation, and study the genotype by environment interactions (Woodfield
and Brummer, 2000). Molecular markers can be a very useful tool for plant
breeders when they are closely linked to genes of interest (e.g. genes for key
agronomic traits), as they can then be used to indirectly select for traits
(Humphreys and Hides, 1999; Woodfield and Brummer, 2000). The utilization of
MAS offers the ability to move from the estimation of genotypic effects by
measuring the phenotype, to accurately measuring the genotype. This could
happen much earlier than conventional phenotyping methods, as selection using
MAS can occur at, or soon after, germination of seedlings. Both qualitative and
quantitative traits can be identified using MAS, but the effectiveness for
qualitative traits will be greater, as only a single gene needs to be identified.
MAS is currently being practised in a variety of crops and animals and has
shown to greatly accelerate the breeding process (Cho et al., 1994; Hayes and
Goddard, 2003; Hospital et al., 1997; Mohan et al., 1997; Zhang et al., 2003).

21 | P a g e
In perennial ryegrass, a number of studies have aimed to identify favourable QTL
alleles of significant effect (Cogan et al., 2005; Shinozuka et al., 2012).
Technological advances have made it increasingly faster and cheaper to develop
and use molecular markers, and while many markers linked to QTL’s have been
identified and reported in the literature (Pembleton et al., 2013; Shinozuka et al.,
2012; Sim et al., 2007), they have not been adequately exploited in breeding
programs (Bernardo, 2008), and where they have been exploited, the worth of
these QTL’s have been shown to be over inflated (Shinozuka et al., 2012). A
new form of marker-assisted selection, genomic selection, may overcome some
of the limitations of MAS.
1.3.3 Genomic selection
Genomic selection (GS) is a form of marker-assisted selection, where the
prediction of breeding values is based on high-density genetic markers that
cover the whole genome, with the assumption that the number of markers are
sufficiently dense that all QTLs are expected to be in linkage disequilibrium (LD)
with at least one marker (Crossa et al., 2014; Goddard and Hayes, 2007; Hayes
et al., 2013). This approach has become possible due to the large number of
SNP discovered by whole genome scale sequencing and new methods to
efficiently genotype and analyse large numbers of SNPs (Forster et al., 2008;
Goddard and Hayes, 2007; Hayes et al., 2013). Due to the assumption that all
QTLs are in LD with at least one genetic marker, there is no need to identify
genetic markers in LD with QTLs or to validate those markers, as genomic
breeding values (GEBVs) can be predicted as the sum of all marker effects by
the regression of all phenotypic values on all available markers (Meuwissen et
al., 2001). As all marker effects are accounted for in genomic selection, it
overcomes the overestimated marker effects that are present in MAS, which only
uses markers with significant effects (Heffner et al., 2010; Meuwissen et al.,
2001; Shinozuka et al., 2012).
In animals, the first use of GS was on dairy cattle (Goddard and Hayes, 2007;
Hayes et al., 2009a; VanRaden et al., 2009), followed in a number of other
animal species (Daetwyler et al., 2010a; Duchemin et al., 2012; Tosser-Klopp et
al., 2014). Genomic selection in plants have been the subject of many studies
(Bernardo and Yu, 2007; Crossa et al., 2014; Jannink, 2010; Kumar et al., 2012;

22 | P a g e
Poland et al., 2012; Simeão Resende et al., 2014). The potential of genomic
selection in forages have also been explored in three recent studies (Hayes et
al., 2013; Lin et al., 2014; Simeão Resende et al., 2014).
Factors affecting the accuracy of genomic selection in Lolium
grasses
The accuracy of GEBVs is the correlation between the GEBV with the true
breeding values (observed phenotype) and can be influenced by a number of
factors including trait heritability, marker density, training population size,
relationship between training population and testing sets, and the genotype by
environment (G x E) interaction (Crossa et al., 2011; Hayes et al., 2013). It is
important to increase the accuracy of GEBVs due to their linear relationship with
the rate of genetic gain (Lin et al., 2014). This accuracy can be increased by
higher trait heritability, larger reference populations and higher marker density
(Hayes et al., 2013). The outbreeding nature of forage grasses leads to a high
effective population size (Ne) and the effective number of independent
chromosome segments (Me) (Daetwyler et al., 2010b; Falconer, 1996; Goddard,
2009). This larger number of Me leads to more recombination of chromosome
segments and decreases the LD compared to self-pollinated crop species
(Hayes et al., 2013). The predicted accuracy of genomic selection in species with
a large Ne is dramatically reduced, with a predicted accuracy of less than 0.1 if
heritability (h2
) =0.5 and Ne =1000 (Lin et al., 2014).
Studies have shown that Ne has been reduced in animals through
domestication, breed divergence and intensive selection (Kijas et al., 2012; Villa-
Angulo et al., 2009). Additional studies have shown that genomic selection can
be exploited in outcrossing species by artificially minimizing Ne, by either using
half-sibs or within family designs (Hayes et al., 2013; Simeão Resende et al.,
2014). Using within family designs also reduces the need for high density
markers in genomic selection as markers only have to track large chromosome
segments that is shared by family members (Hayes et al., 2009b). This has been
shown in Kumar et al. (2012) where only 2,500 markers provided good accuracy
(>0.7) for apples in a bi-parental design.

23 | P a g e
Another important aspect that can affect the accuracy of genomic selection is
trait heritability. If only additive genetic effects were considered, heritability can
be calculated as h2
= VA/(VA+VE), where VA is additive variance and VE is
environmental variance (Falconer, 1996). Heritability of a phenotype can thus be
calculated more accurately when VE is low, as the additive genetic effect
explains a larger proportion of the phenotype. The VE of a phenotype can be
reduced by averaging the phenotypic performance of a plant/variety across
replicated plots, leading to an increase in h2
(Lin et al., 2014). This increase in h2
will lead to a more accurate estimation of the marker effect in genomic selection.
The heritability of traits can vary considerably between traits and between plants
species for the same trait (Conaghan and Casler, 2011). Heritabilities of forage
quality traits in perennial ryegrass are sufficient (Table 1.1) (Pembleton et al.,
2013) to ensure accurate genomic selection predictions, provided that there is a
sufficient reference population size and genetic marker number (Lin et al., 2014;
Simeão Resende et al., 2014).
Table 1.1. Heritability of forage quality traits in perennial ryegrass (Pembleton et
al., 2013) including acid detergent fibre (ADF), crude protein (CP), in vivo dry
matter digestibility (IVVDMD), neutral detergent fibre (NDF) and water-soluble
carbohydrate (WSC) concentration.
Trait Harvest Mean ± s.d. Range
Genotype
variance
Residual
variance
Heritability
ADF Vegatative 164.1 ± 23.3 97.86 - 263 3.1 2.3 0.57
Reproductive 231.0 ± 41.2 27.04 - 373.3 8.8 8.6 0.51
CP Vegatative 242.6 ± 24.4 160.7 - 327.4 2.7 3.6 0.43
Reproductive 148.5 ± 31.1 60.44 - 254.4 3.6 6.1 0.37
IVVDMD Vegatative 0.80 ± 0.03 0.70 - 0.88 2.2 4.3 0.34
Reproductive 0.73 ± 0.05 0.45 - 0.86 14.9 13.6 0.52
NDF Vegatative 404.6 ± 29.5 306.1 - 505.1 5.4 3.8 0.59
Reproductive 456.1 ± 41.9 311.2 - 607 8.6 9.8 0.47
WSC Vegatative 177.6 ± 30.6 97.31 - 339.3 5.3 4.4 0.39
Reproductive 228.0 ± 50.4 98.03 - 416.1 10.4 16.0 0.55
The implementation of genomic selection requires a reference population of
individuals that have both phenotypes and genotypes to estimate the marker
effects that allows for the development of a genomic selection prediction
equation. This prediction equation can then be used to estimate GEBVs for
selection candidates that have genotypes, but possibly no phenotypes (Figure

24 | P a g e
1.10). Increasing the size of the reference population can lead to a more
accurate estimation of marker effects, which in turn improves the accuracy of the
GEBVs. The prohibitive cost of phenotyping can become a limiting factor to
increasing the reference population size, as phenotyping is normally conducted
in replicated field trials across years and environments (Jannink, 2010). This cost
can be addressed by using technologies such as near-infrared spectroscopy to
predict nutritive value on a cheaper and faster method than conventional wet-
chemistry approaches (Section 5.1). Another, more efficient method to increase
the accurate estimation of marker effects in perennial ryegrass, without altering
the reference population size, is to increase the relationship between selection
candidates and the reference population to effectively reduce Ne and Me
(Daetwyler et al., 2010b; Habier et al., 2007). To enable genomic selection in
perennial ryegrass, a within family design is needed (Hayes et al., 2013). This
will allow for accurate prediction of selection candidates that is related to the
reference population, but will not allow for accurate prediction of selection
candidates that are not related to the reference population (Albrecht et al., 2011;
Simeão Resende et al., 2014).

25 | P a g e
Figure 1.10. Basic principles of genomic selection.
A genomic selection strategy for perennial ryegrass has been proposed by
Hayes et al. (2013) (Figure 1.11) and reviewed by Simeão Resende et al. (2014).
The genomic selection breeding strategy described below is adapted from Hayes
et al. (2013) and assumes that the genomic selection program is well established
and that accurate GEBV’s can be predicted on selection candidates for important
traits such as biomass yield, nutritive quality and persistence in a sward (Hayes
et al., 2013; Simeão Resende et al., 2014). With these assumptions, the
genomic selection breeding strategy will include the following steps (Figure
1.11):

26 | P a g e
A) Clonal Plant Nursery
Phase 1: Phenotypic evaluation is done on a space-planted nursery for
traits such as increased nutritional quality, heading dates and/or mineral
content. Individual plants are not selected based on yield data, as there is
low correlation between space-planted trials and sward trials. The yield
will be assessed in C.
Phase 2: Individual plants are selected for crossing based on both
phenotype and genotype for traits such as increased nutritional quality,
heading dates and/or mineral content as well as GEBVs for a range of
traits/all traits, including yield.
B) Crossing
Phase 1: Perform a number of poly-crosses as with 4 parent synthetics,
but harvest seed from each parent as a half sib family. Retain seed for
regeneration of clonal nursery in A from better crosses identified in C.
C) Mini Sward Trial
Phase 1: Mini swards are sown as half-sib populations with a defined low
number of off-spring. Each of the potential 4 parent synthetic populations,
(i.e. the 4 mini-swards) will need to be observed together for assessment
of flowering time uniformity. Phenotypic evaluation of yield and evaluation
of selected traits (WSC/flowering time/mineral content) are performed on a
population basis.
Phase 2: Phenotypic data of selected plants and their progeny can be
used to validate and update the genomic prediction equation.
D) Re-Establish Clonal Nursery
All Phases: Mini swards identify better parents that are then used to re-
establish the clonal nursery. This does not have to be from all plants used
in the 4 parent synthetics but from the individual mothers, as mini-swards
were sown as half sib families from each individual mother. Seed from the
plants in the mini sward or a specific bulk up can be taken for multisite
evaluation and commercial release. All crosses can lead to commercial
product and release.

27 | P a g e
Figure 1.11. A genomic selection strategy in perennial ryegrass, adapted from
Hayes et al. (2013).
The use of genomic selection in perennial ryegrass breeding has the capacity to
reduce the generation intervals through accurate prediction of trait performance
at an early stage of plant development. Compared to non-genomic breeding
methods, it can deliver more genetic gain over time, minimizing the need to
phenotype selection candidates (Hayes et al., 2013). In practice, selection will
likely be without phenotypes, but a proportion of selection candidates will be
added to the reference population.

28 | P a g e
1.3.4 Genetic transformation of Lolium grasses
Molecular plant breeding strategies have now entered the biotechnology era and
utilize genomic and transgenic biotechnology in conjunction with conventional
breeding for cultivar development (Bouton, 2009). Biotechnological approaches
have the potential to complement or accelerate conventional breeding by
extending the range of sources from which genetic information may be obtained,
thus offering new opportunities for molecular breeding (Spangenberg et al. 1998;
Wang et al. 2001a). In the past two decades, enabling methodologies for the
application of genetic transformation have been developed or improved for many
important forage, turf and bioenergy crops (Spangenberg et al., 1998; Wang and
Brummer, 2012; Wang and Ge, 2006; Wang et al., 2003). The technology allows
for the introduction of novel genetic variation through the down-regulation or up-
regulation of endogenous genes, or through the introduction of foreign genes
from unrelated species (Wang and Brummer, 2012). Considering the genetic
complexity of forage grasses and the difficulties associated with conventional
plant breeding, genetic transformation may offer more effective strategies to
forage grass improvement (Spangenberg et al., 1998; Wang and Ge, 2006). It is
expected that transgenic approaches will accelerate conventional breeding
strategies in forage grasses (Spangenberg et al., 2001; Wang and Brummer,
2012; Wang and Ge, 2006).
Primary targeted traits for forage improvement have been identified for the
application of transgenesis. These traits include forage quality, tolerance to biotic
and abiotic stress and the manipulation of growth and development
(Spangenberg et al., 2001; Wang and Brummer, 2012). Significant advances
have been made in genetic transformation of grass and legume species (Table
1.2) (OGTR, 2008; Wang and Brummer, 2012; Wang and Ge, 2006). Although
the methodologies are in place to generate new transgenic events within forage
crops, they have not been assembled or optimized for integration into a breeding
program. Combining forage breeding strategies with these molecular tools will
progress the efforts in cultivar development and will advance our understanding
of the genetic control of the phenotype (Bouton, 2009). Transgenic breeding is
thus required to create a commercially viable transgenic cultivar.

29 | P a g e
Table 1.2. Recent advances in genetic transformation of forages and turf
adapted from (OGTR, 2008; Wang and Brummer, 2012).
Trait Plant Species
Altered nutrition
Alfalfa (Guo et al., 2001; Reddy et al., 2005),
tall fescue (Chen et al., 2004c; Tu et al., 2010;
Wang et al., 2001b)
Enhanced fructan biosynthesis Perennial ryegrass (Hisano et al., 2008)
Enhanced drought tolerance
Alfalfa (Jiang et al., 2009; Zhang et al., 2005;
Zhang et al., 2007b), white clover (Jiang et al.,
2010), creeping bentgrass (Fu et al., 2007),
bahiagrass (Xiong et al., 2010)
Increased phosphorus acquisition
Alfalfa (Ma et al., 2012), white clover (Ma et
al., 2009)
Enhanced salt tolerance, cold
tolerance or freezing tolerance
Perennial ryegrass (Wu et al., 2005), tall
fescue (Hu et al., 2005), creeping bentgrass
(Li et al., 2010)
Delay or inhibition of floral
development
Red fescue (Jensen et al., 2004)
Reduced pollen allergens
Perennial ryegrass (Bhalla et al., 2001;
Petrovska et al., 2005), italian ryegrass
(Bhalla et al., 2001; Petrovska et al., 2005)
Enhanced aluminium tolerance
Alfalfa (Barone et al., 2008; Tesfaye et al.,
2001), white clover (personal communication)
Altered senescence
Alfalfa (Calderini et al., 2007), white clover,
perennial ryegrass (Li et al., 2004)
Disease/virus resistance
Perennial ryegrass (Xu, 2001), white clover
(Ludlow et al., 2009; Panter et al., 2012),
creeping bentgrass (Fu et al., 2005; Zhou et
al., 2011), tall fescue (Dong et al., 2008; Dong
et al., 2007)
Improved turf quality
Bahiagrass (Agharkar et al., 2007; Zhang et
al., 2007a)
Accumulation of sulphur-rich Subterranean clover (Khan et al., 1996), tall

30 | P a g e
protein fescue (Wang et al., 2001a)
Production of polyhydroxybutyrate Switchgrass (Somleva et al., 2008)
Increased sugar release
Alfalfa (Jackson et al., 2008), switchgrass
(Chen and Dixon, 2007; Fu et al., 2011)
Increased biomass yield Switchgrass (Fu et al., 2012)
Herbicide tolerance Roundup Ready Alfalfa
Hygromycin tolerance
Tall fescue (Wang and Ge, 2005; Wang et al.,
2003), perennial ryegrass (Van der Maas et
al., 1994), Italian ryegrass (Takahashi et al.,
2005; Takahashi et al., 2006)
Phosphinothricin tolerance Tall fescue (Bettany et al., 2003)
Decreased lignin concentration
Tall fescue (Chen et al., 2003; Chen et al.,
2004a), switchgrass (Chen and Dixon, 2007;
Fu et al., 2011)
1.4 Alteration of fructan biosynthesis through genetic
transformation
Alteration of the fructan concentrations in pasture grasses have shown to alter
the digestibility of pasture grasses (Buxton and Russell, 1988; Miller et al.,
2001c). Fructans are carbohydrates consisting of polymers of fructose molecules
with a common glucose residue (Banguela, 2006; Pavis et al., 2001a; Pollock,
1986), which are naturally produced in a wide range of bacteria, fungi and
around 15% of flowering plant species (both monocots and dicots) (Banguela,
2006; Hendry and Wallace, 1993; Ritsema and Smeekens, 2003). These
carbohydrates represent short- and long-term WSC reserves and are the main
storage carbohydrate in temperate forage grasses (Pollock and Cairns, 1991;
Ritsema and Smeekens, 2003).
In contrast to starch, which is stored in plastids, fructans are stored in vacuoles
(Darwen and John, 1989). The biosynthesis of fructans lowers the sucrose
concentration in the cell and prevent sugar-induced feedback inhibition of
photosynthesis (Pollock, 1986). Fructans are actively synthesized during cell
elongation (Pavis et al., 2001a), and accumulate in vacuoles if the carbohydrate
production exceeds demand for growth and development (Banguela, 2006;

31 | P a g e
Thomas et al., 1999). Fructans are stored in cells of mature leaf sheaths and
pseudostems but may also accumulate in cells of leaf blades if the storage
capacity of leaf sheaths and pseudostems has been decreased (Guerrand et al.,
1996). Depending on the developmental stage of the plant, fructans can account
for around 30% of the dry weight of the plant (Pollock and Jones, 1979).
1.4.1 Fructan structure and biosynthesis
Multiple sub-units of fructans are synthesized through the attachment of fructose
units to the precursor sucrose molecule. The addition of a fructosyl residue to
one of the three primary alcohol groups of sucrose produces the following
trisaccharides: 1-kestose, 6-kestose, or neokestose (Figure 1.12) (Banguela,
2006; French, 1989). Linear or branched polyfructans are formed through one or
more fructosyl-fructose linkages. Fructans are classified through the predominant
linkage type and chain size. Inulin-type fructans contain mostly β(2-1) fructosyl-
fructose linkages and levan-type fructans contain β(2-6) fructosyl-fructose
linkages (Banguela, 2006; Chalmers et al., 2005b; Pontis, 1985).
Figure 1.12. Molecular structures of the three trisaccharide precursors to plant
fructans. Structural representation of the three trisaccharides containing all the
disaccharide linkages found in natural polyfructans. A) 1-Kestose, B) 6-Kestose,
and C) Neokestose (Banguela, 2006).

32 | P a g e
There are several classes of fructans, each distinguished by the type of linkage
between adjacent fructose units, branching and sugar residue position
(Chalmers et al., 2005b). Of these, there are five distinct classes of fructans that
have been identified in plants: inulin series, levan series, mixed levan
(graminan), inulin neoseries, and levan neoseries (Table 1.3).
Table 1.3. Summary of the five classes of fructans identified in plants (adapted
from Chalmers et al. 2005). Glucose and Fructose
Fructan type
Predominant
linkages
present
Example
Trisaccharide
precursor
General
occurrence
in plants
Inulin Linear β(2-1) 1-kestose Asteraceae
Levan Linear β(2-6) 6-kestose
Graminacea
e
Mixed Levan
Branched β(2-1)
and β(2-6)
1-kestose and 6-
kestose
Poaceae
Inulin
Neoseries
Linear β(2-1) 6G-kestose Liliaceae
Levan
Neoseries
Linear β(2-6) 6G-kestose Poaceae
n
n
n
n
n
nn

33 | P a g e
Dicotyledonous species mostly produce the inulin fructan series (Van Laere and
Van Den Ende, 2002), whereas monocotyledonous species can produce and
store a mixture of different fructan types (Chalmers et al., 2005b; Pavis et al.,
2001b). Fructans from Lolium belong to the inulin series, the inulin neoseries and
the levan neoseries (Pavis et al., 2001b).
In plants, fructan is synthesised by the action of two or more different
fructosyltransferases, exhibiting distinct specificity towards the fructosyl-donor
and fructosyl-acceptor substrates (Banguela, 2006). The classic enzymatic
model for the synthesis of the simplest form of fructan, inulin, (Vijn and
Smeekens, 1999) is the SST/FFT model (Edelman, 1968). In this model, there
are two key enzymes, sucrose-sucrose-fructosyltransferase (SST) and fructan-
fructan-fructosyltransferase (FFT). The enzyme sucrose:sucrose 1-
fructosyltransferase (1-SST) catalyse the fructan synthesis reaction by producing
the intermediary trisaccharide, 1-kestose, from two sucrose molecules, with the
consequent release of glucose. The second enzyme fructan:fructan 1-
fructosyltransferase (1-FFT) further elongates the fructan polymer by using the
trisaccharide that is formed by 1-SST.
More FTT enzymes have been identified, including fructan:fructan 1-
fructosyltransferase (1-FFT), fructan:fructan 6G-fructosyltransferase (6G-FFT)
and sucrose:fructan 6-fructosyltransferase (6-SFT) (Banguela, 2006). Fructans
can be synthesized by one or more of these fructosyltransferase (FTT) enzymes,
dependent on the plant species (Banguela, 2006).
1.4.2 Fructan biosynthesis in Lolium grasses
Lolium grasses can produce a complex of fructan structures that fall within the
inulin series, the inulin neoseries and the levan neoseries (Chalmers et al.,
2005a; Chalmers et al., 2005c; Pavis et al., 2001c). A set of at least four
enzymes would be necessary to produce these: 1-SST, 1-FFT, 6G-FFT, and
either 6-FFT or 6-SFT (Pavis et al., 2001c). Of these fructans, Lolium grasses
mainly produce and accumulate high molecular mass fructans with β(2-6)
linkages (Pavis et al., 2001c).

34 | P a g e
The following metabolism pathway for fructan biosynthesis in perennial ryegrass
was proposed by Chalmers et al. (2005). Sucrose is the substrate of fructan
biosynthesis, and is utilised by 1-SST to produce 1-kestose. This is then either
elongated by 1-FFT to produce inulin series fructans, or used by 6G-FFT to
produced 6G-kestose, the precursor to the neoseries fructans. 6G-kestose is
then either elongated by 6-FFT or 6-SFT to produce levan neoseries fructans, or
by 1-FFT to produce the inulin neoseries fructans (Figure 1.13).
Figure 1.13. Proposed metabolism pathway for fructan in perennial ryegrass
(Chalmers et al., 2005c).
In this study, a transgenic approach to alter fructan biosynthesis in perennial
ryegrass, through the overexpression of fructosyltransferases will be discussed
and assessed.

35 | P a g e
1.5 A novel molecular breeding strategy for transgenic
Lolium grasses
Transgenic breeding is an extension of conventional plant breeding technologies,
and although it shares the same basic principles and guidelines with
conventional plant breeding, it has its own challenges and breeding objectives
(Zhong, 2001). The first aim of transgenic breeding is to improve existing
germplasm without negatively affecting their agronomic qualities. The second
aim is to develop a transgenic product that has stable predicted inheritance of
the trait and consistent expression of the trait, with no significant negative impact
on the expression of endogenous genes or agronomic traits (Visarada et al.,
2009; Zhong, 2001).
The self-incompatible, outcrossing nature of certain species adds more
complexity to transgenic breeding. Introgression of a transgene within the
outcrossing population can lead to a founder effect (Ladizinsky, 1985), as
repeated back-crossing to a single parent is required. This new population will
only have a small fraction of the parental population’s genetic variation, which
could lead to inbreeding depression (Ladizinsky, 1985). Avoiding excessive
inbreeding is vital as inbreeding can lead to reduced growth rate, yield and seed
set (Wilkins and Humphreys, 2003b). For this reason, the introgression of
individual genes have played a limited role in the development of new forage
grass cultivars (Wilkins and Humphreys, 2003b). To fix the transgene within the
population, an introgression step must be employed in the breeding system. A
variation of the backcross system used in self-compatible species will have to be
employed. This thesis aims to discuss an optimal breeding program, employing
conventional breeding and molecular genetics, to integrate a transgene within a
breeding population.

36 | P a g e
1.6 Objectives
The work described in this thesis aimed to apply current advances in genomic
selection, molecular genetics, transgenesis and breeding to a perennial ryegrass
breeding program, focussed on improvement of nutritive value characteristics,
through transgenesis. The particular focus of these activities was:
• Design and evaluate a multi-year, multi-generational (T0 and T1
generation) field trial of transgenic perennial ryegrass events with
enhanced fructan biosynthesis;
• Selection of transgenic events with stable introgression of the transgene;
that express the transgene within Australian field conditions and are
agronomically sound;
• Assessment of the nutritive value changes in transgenic perennial
ryegrass plants with enhanced fructan biosynthesis;
• Development of an optimal breeding program to introgress and fix the
transgene in a homozygous state within an agronomically fit and genetic
diverse population while minimizing the consequences of the “founder
effect”.

37 | P a g e
Chapter 2
Material and Methods
2.1 Plant material
The genotype, FLp418-20, from an advanced breeding population, FLp418, was
used for genetic transformation. The material was provided by PGG Wrightson
Seeds.
2.2 Genetic transformation
The generation of transgenic perennial ryegrass events pre-date work described
in this thesis. The methods in this section were used to create the transgenic
perennial ryegrass events that were evaluated in this study.
2.2.1 Construction of expression vectors
All PCR products used for construct-making were generated using the proof-
reading enzyme Pfx (Invitrogen, Carlsbad, CA). Oligonucleotide primers used for
PCR are shown in Table 2.1. Constructs were verified by PCR-amplification,
restriction endonuclease analysis and Sanger sequencing.
A 693 bp LpFT4 terminator fragment was PCR-amplified from a perennial
ryegrass genomic DNA library using primers containing an EcoRI recognition site
incorporated in the primer and EcoRV and XmaI recognition sites incorporated in
the reverse primer. The PCR product was cloned into the EcoRI and XmaI
recognition sites of the pBlueScript SK(-) vector (Short et al., 1988) to create
pBS-LpFT4. A 630 bp LpRbcS promoter fragment was PCR-amplified from a
perennial ryegrass genomic DNA library using primers containing XhoI and
EcoRV recognition sites in the forward primer and an EcoRI recognition site in
the reverse primer. The 610 bp PCR product was cloned into pBS-LpFT4, which
had been digested with EcoRI and XhoI, creating pBS-LpRbcS::LpFT4. The Lp1-
SST coding region was PCR-amplified from a cDNA template (Chalmers et al.,
2003) with EcoRI recognition sites flanking both forward and reverse PCR

38 | P a g e
primers, and was cloned into the EcoRI recognition site of pBS-LpRbcS::LpFT4,
generating pBS-LpRbcS::Lp1-SST::LpFT4.
The Lp1-SST coding region was PCR-amplified from a cDNA template (Chalmers
et al., 2003) with an attB recombination site incorporated in the forward primer. A
sequence encoding three glycine residues followed by a HindIII recognition site
was incorporated into the reverse primer, with the stop codon removed. The
Lp6G-FFT coding region (Chalmers et al., 2005c) was PCR-amplified with a
HindIII recognition site followed by sequence encoding three glycine residues and
the gene specific sequence. The reverse primer for the Lp6G-FFT gene was
flanked by the attB recombination site. The purified fragments were digested with
Hind III and the ligated product was cloned into pDONR®
221 (Invitrogen). The
3920 bp Lp1-SST-Lp6G-FFT coding region fusion was PCR-amplified from this
construct with flanking primers containing EcoRI recognition sites, cloned into the
pCR®
-Blunt (Invitrogen), excised using EcoRI, and cloned into an EcoRI
recognition site between the promoter and terminator sequences of pBS-
LpRbcS::LpFT4, generating pBS-LpRbcS::Lp1-SST-Lp6G-FFT::LpFT4.
The pAcH1 vector, containing a cassette with a rice actin1 gene promoter
sequence, the coding sequence of the hygromycin phosphotransferase gene and
the cauliflower mosaic virus 35S gene terminator has been previously described
(Bilang et al., 1991).
The expression cassette, cGRA000022, for biolistic delivery was excised from
LpRbcS::Lp1-SST-Lp6G-FFT::LpFT4 by digestion with EcoRV. The expression
cassette, cGRA000025, for biolistic delivery was excised from pBS-
LpRbcS::Lp1-SST::LpFT4 by digestion with EcoRV. The cassette was excised
from pAcH1 using BglII. Cassettes were separated from vector DNA by agarose
gel electrophoresis and purified using an EluTrap system (GE Healthcare, Little
Chalfont, UK), according to the manufacturer’s instructions.

39 | P a g e
Table 2.1. Sequences of oligonucleotide primers used to amplify gene fragments
for vector construction. Restriction endonuclease recognition sites are
underlined, attB recombination sites are shown in italics and bases encoding six
glycine residues added between the Lp1-SST and Lp6G-FFT coding regions in
the fusion construct are shown in bold type.
Target Type Reverse Primer 5`-3`
LpFT4 terminator (EcoR I) fwd CGCGGAATTCAACAATAATTTTCTGAGCCTAGTATCC
LpFT4 terminator (EcoR V,
Xma I)
rev GGCGCCCGGGTTTGATATCACATTGAGTACATGAGCAGGG
Lp1-SST coding region
(EcoR I)
fwd TTGGAATTCGCCGACGATCGATGGAGTCCCCAAGCGCCG
(EcoR I)
rev CCCCGAATTCTCGAGCTACAAGTCGTCGTTCGTG
LpRbcS promoter (Xho I,
EcoR V)
fwd GCTCTCGAGGATATCTGTTCATCTACCTTACTAGTCTG
LpRbcS promoter (EcoR I) rev GCTGAATTCACCGCGGGGGCCATGGTG
(attB1)
fwd GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGAGTCCCCAAGCGCCGTCG
Lp1-SST-Lp6G-FFT coding
region junction (Hind III,
3xGly)
rev TCTAAGCTTTCCTCCTCCCAAGTCGTCGTTCGTG
Lp1-SST-Lp6G-FFT coding
region junction (Hind III,
3xGly)
fwd ACTAAGCTTGGAGGAGGAGAGTCCAGCGCCG
Lp6G-FFT coding region
(attB2)
rev GGGGACCACTTTGTACAAGAAAGCTGGGTCCTACATGTCGTCAGCCAAGAAGGCC
Lp6G-FFT coding region
(EcoR I)
rev CCCCGAATTCCTACATGTCGTCAGCCAAGAAGGCC
2.2.2 Genetic transformation of perennial ryegrass
The genotype, FLp418-20, was selected for use as donor material on the basis
of observed shoot regeneration from embryogenic callus (EC) derived from
mature seeds of the perennial ryegrass breeding population, FLp418 (PGG
Wrightson Seeds, Christchurch, New Zealand). Clonal replicates of perennial
ryegrass genotype FLp418-20 were subjected to transformation with vector
backbone-free expression cassettes cGRA000022, GRA000025 and cAcH1
were delivered using biolistic-mediated DNA delivery to EC of FLp418-20, to
generate putative primary T0 transgenic perennial ryegrass events. The
transgenic perennial ryegrass events containing the plasmid pAcH1 and either
cGRA000022 or cGRA000025 were generated according to the method of
Spangenberg et al. (1995) (Figure 2.1).

40 | P a g e
Figure 2.1. Production of transgenic perennial ryegrass plants from
microprojectile bombardment of shoot meristem-derived calli of the genotype,
FLp418-20. A) Donor material for shoot meristems; high vegetative mass, nil-to-
low root development; B) Distribution of basal meristematic material on callus
initiation medium; C) Proliferation of callus from basal meristematic regions; D-E)
Proliferation of embryogenic callus derived from basal meristems; F) Distribution
of calli on high osmotic medium prior to biolistic transformation; G) Biolistic
transformation device, PDS-1000/He; H-I) Growth and development of
hygromycin-resistant shoots, 30 – 75 days after bombardment; J) Growth and
development of hygromycin-resistant shoots in vitro; K) Hygromycin-resistant
plants established in soil and grown under glasshouse containment conditions.
E
I J
F G H
K

41 | P a g e
2.3 Molecular analysis
The methods described in this section was performed by research staff at the
AgriBio, the Centre for AgriBioscience. The interpretation of the results obtained
from these methods fall within the scope of this study.
2.3.1 Transgene detection
Real-time PCR
DNA was extracted from freeze-dried, immature perennial ryegrass leaf tissue
using the DNeasy 96TM
Plant kit (QIAGEN, Hilden, Germany) according to the
manufacturer’s instructions. The presence of the endogenous histone H3 gene
(LpHisH3) and the cAcH1, cGRA000022 and cGRA000025 transgene cassettes
was detected by real-time PCR using specific oligonucleotide primer pairs and
SYBR Green chemistry (Roche Diagnostics, Basel, Switzerland). Oligonucleotide
primer sequences are shown in Table 2.2. Cycling conditions for detection of
cGRA000022 and cGRA000025 were as follows: 95o
C for 10 min, 40 cycles of
95o
C for 30 sec and either 63.7o
C for 1 min or 63.2o
C for detection of
cGRA000022 and cGRA000025, respectively. Real-time PCR results were
scored in comparison to positive (plasmid DNA) and negative (non-transgenic
plant DNA, no-template) control templates.
Table 2.2. Oligonucleotide primer sequences to determine transgene presence
in perennial ryegrass.
Target Assay Forward Primer (5`-3`) Reverse Primer (5`-3`)
LpHisH3 qPCR TGCTTGCCCTTCAGGAGGCT CTGAATGTCCTTGGGCATGAT
cGRA000022 qPCR CCCGCGGTGAATTCATGGAG CGACGACCACCGACAACGC
cGRA000025 qPCR CGCGGTGAATTCGACATGGAG CGACGACCACCGACAACGC
cAcH1 qPCR ATTTCGGCTCCAACAATGTC AGATGTTGGCGACCTCGTAT
Southern hybridisation
Genomic DNA was isolated from leaf tissue that had been flash-frozen and
manually ground using a mortar and pestle under liquid nitrogen using either a
standard cetyltrimethylammonium bromide protocol (Doyle and Doyle, 1987) or a
nuclear lysis method. For the latter method, 2 cm3
of frozen tissue was combined
in a 15 mL centrifuge tube (Becton-Dickinson, Franklin Lakes, NJ) with 3 mL of
nuclear lysis buffer that had been preheated to 65o
C, 600 µL of 5% w/v N-

42 | P a g e
laurylsarcosine and 20 µL of 100 mg/mL RNAse A. Nuclear lysis buffer consisted
of 200mM Tris-HCl pH 8.0, 2M NaCl, 50mM EDTA, and 2% w/v
cetyltrimethylammonium bromide. Samples were mixed by inversion and
incubated at 65o
C for 1 h, with periodic inversion, cooled to ambient temperature
and combined with 5 mL of phenol:chloroform:isoamyl alcohol (25:24:1). After
thorough mixing by inversion, samples were subjected to centrifugation at 5525 g
for 20 min at 4o
C. The aqueous phase was removed and combined with 1
volume of isopropanol, mixed by inversion and incubated for 1 h at ambient
temperature. DNA was looped out into a 1.5 mL microtube containing 1 mL of
70% v/v ethanol and incubated for 14 h at 4o
C. Samples were subjected to
centrifugation at 16000 g for 15 min before the DNA pellet was washed with 500
µL of 70% ethanol and air dried. The pellet was resuspended in 400 mL of 10mM
Tris-HCl pH 8.0, 1mM EDTA and 1.5M NaCl, incubated for 30 min on ice and
then for 15 min at 55o
C. The sample was mixed by inversion with 1 mL of ethanol
and incubated for 14 h at 4o
C. After samples were subjected to centrifugation at
16000 g for 15 min, pellets were washed twice with 70% v/v ethanol,
resuspended in 100 µL of 1mM Tris-HCl pH 8.0 and 0.1mM EDTA and incubated
on ice for 30 min, at 55o
C for 15 min and at 4o
C for 14 h. A 10 µg aliquot of DNA
from each line was digested with HindIII for detection of hph, the LpRbcS gene
promoter and the LpFT4 gene terminator or with EcoRI for detection of the
LpFT1 promoter. Digested DNA was separated on 0.8% (w/v) agarose gels.
Following electrophoresis, DNA was transferred to Hybond N membrane (GE
Healthcare, Little Chalfont, UK) using established protocols (Sambrook et al.,
1989). Sequence-specific probes targeting the LpRbcS or LpFT1 promoter and
the LpFT4 terminator as well as the hph selection cassette were generated
using the PCR-based digoxigenin (DIG) Probe Synthesis Kit (Roche) according
to the manufacturer’s instructions. Sequences of all primers are provided in
Table 2.3. Hybridisation with the LpFT1 promoter-specific probe was performed
for 14 h at 43°C. Hybridisation with the three other probes was performed for 14
h at 42 °C. A chemiluminescent detection protocol was used as per the
manufacturer’s instructions (Roche).

43 | P a g e
Table 2.3. Oligonucleotide primer sequences used for Southern Hybridisation
analysis.
LpFT1 promoter Southern hybridization analysis probe AAGGTGTTTGAGTTTCTGG CGATCACGCTTCTATTGG
LpRbcS promoter Southern hybridization analysis probe CTAGTCTGCATGATTAGTTTATTCGT CCTCCATGTCCGAGTCGCC
LpFT4 terminator Southern hybridization analysis probe CAATAATTTTCTGAGCCTAGTATCC CACATTGAGTACATGAGCAGGGAAC
hph Southern hybridization analysis probe CGCATAACAGCGGTCATTGACTGGAGC GCTGGGGCGTCGGTTTCCACTATCGG
2.3.2 Transgene expression
Leaf tissue samples were ground manually under liquid nitrogen using a mortar
and pestle. Total RNA was extracted from 50-100 mg of frozen, ground tissue
using the QIAGEN RNeasy Plant Mini Kit (QIAGEN, Hilden, Germany) according
to the manufacturer’s instructions. The RNA was quantified using a Nanodrop
spectrophotometer (Thermo Fisher Scientific, Waltham, USA) and RNA integrity
was tested by agarose gel electrophoresis.
First-strand cDNA was synthesised from 400 ng aliquots of total RNA using the
Quantitect Reverse Transcription Kit (QIAGEN) according to the manufacturer’s
instructions, including control reactions without reverse transcriptase
corresponding to each cDNA sample. The cDNA samples and no-RT controls
were analysed in duplicate by PCR, alongside a standard curve of plasmid DNA
templates (no-template control, 10-12
- 10-18
mol) performed in triplicate. Each
PCR reaction contained HF reaction bufferTM
(Thermo Fisher Scientific), 1 µL of
a 1:10,000 dilution of SYBR Green I (Life Technologies, Carlsbad, USA), 500nM
each of forward and reverse oligonucleotide primers, 200nM dNTPs (Bioline,
London, UK), 0.5 units of Phusion Hotstart II DNA polymerase (Thermo Fisher
Scientific), 1 µL of cDNA, no-RT control reaction, and sterile distilled water to a
total volume of 25 µL. The oligonucleotide primers specific to LpHisH3,
cGRA000025 and cGRA000022 transgene sequences are listed in Table 2.4.
PCR was performed using a CFX96 Real-Time System with a C100 Touch
thermal cycler (Bio-Rad, Hercules, USA), with an initial denaturation temperature
of 98°C for 30 s, followed by 40 cycles of 98°C for 30 s, the appropriate
annealing temperature (Table 2.4) for 20 s, and 72°C for 10 s with detection of
SYBR Green fluorescence, followed by a dissociation curve (65°C to 95°C).
Real-time PCR data was visualised using the proprietary CFX ManagerTM
software (Bio-Rad) and results were scored on the basis of quantification cycle

44 | P a g e
(Cq) and correlation of the dissociation curve peak from a cDNA sample to the
peak corresponding to a plasmid positive control. In addition to collection of real-
time RT-PCR data, representative PCR products from experiments were
visualised after agarose gel electrophoresis. Representative PCR products
amplified from plant cDNA were also purified using Ampure XP system
(Beckman-Coulter Inc, Brea, USA), cloned using the Zero BluntTM
Cloning Kit
(Life Technologies) and sequenced to verify their identity.
Table 2.4. Oligonucleotide primer sequences and annealing temperatures to
determine gene expression levels in perennial ryegrass.
Expected
Size
Annealing
temperature
LpHisH3 RT-PCR CAGAGGCTTGTTAGGGAGATTG AGGTGGATGCTTTGACAGAC 384 bp 60°C
cGRA000022 RT-PCR CAGCCTCCTGACGCACTAC TGATCATGGATACTAGGCTCAGAA 368 bp 64.2°C
cGRA000025 RT-PCR ACTCCATCGTGCAGAGCTTC TGATCATGGATACTAGGCTCAGAA 237 bp 66.8°C
2.3.3 Endophyte detection
Basal 1 cm portions were sampled from three randomly selected vegetative
pseudostems of each plant and pooled together (Figure 2.2). DNA was extracted
from freeze-dried pseudostem tissue using a DNeasy 96TM
Plant kit or
MagatractTM
96 Plant Core Kit (QIAGEN) according to the manufacturer’s
instructions. Multiplex PCR reactions were set up with 0.2mM dNTPs, 250nM of
each of the six oligonucleotides used for endophyte detection, 0.5 units of
Immolase DNA polymerase (Bioline, London, UK) and 1 x Immolase buffer
(Bioline) and 25 ng of plant DNA, 10 ng of positive control endophyte DNA or
water as the template in a 20 µL reaction volume. Cycling conditions were: 95o
C
for 10 min, 10 cycles of 94o
C for 30 sec, 65o
C - 1o
C per cycle and 72o
C for 1 min,
20 cycles of 94o
C for 30 sec, 55o
C for 30 sec and 72o
C for 1 min followed by a
4o
C hold. Reactions containing plant DNA and endophyte DNA were diluted 1:10
and 1:100 respectively with nuclease-free water. Aliquots of diluted PCR
reactions (2 µL) were combined with 7.95 µL of Hi DiTM
Formamide (Life
Technologies, Carlsbad, CA) and 0.05 µL of the GenescanTM
500LIZTM
molecular weight standard (Life Technologies). PCR products were analysed
using an Applied Biosystems 3730 DNA AnalyzerTM
(Life Technologies), and raw
results were scored against predicted product sizes to identify endophytes with
GeneMapperTM
v 3.7 software (Table 2.5, Table 2.6).

45 | P a g e
Table 2.5. Oligonucleotide primer sequences to determine to differentiate
between different genotypes of endophyte within perennial ryegrass plants.
NLESTA1QA09
Endophyte
genotyping
FAM-TGGATATTTTGAAGAAGTTCCAGG CTAACGATGTATGCGTTTGTTTGG
NLESTA1NGO3
Endophyte
genotyping
HEX-CGGGCGCACTTGCTTCTCGG GCCCCGCAGCCTTGTCGTTG
NLESTA1CC05
Endophyte
genotyping
NED-CGCATACACGTTATGAAGCAGAGG TTGGGACTTTCCAGAGTTGAGCAG
Figure 2.2. Sampling area for genotyping of endophytes in perennial ryegrass.
Table 2.6. Table of SSR marker details and expected product sizes amplified
from different genotypes of endophyte within perennial ryegrass plants. ST:
standard toxic.
SSR Locus Sensitivity Repeat Motif
Expected
Size AR1
Expected
Size AR37
Expected
Size ST
NLESTA1QA09 low (GA)20(G)1(GA)3 189 187 149
NLESTA1NGO3 high (GTC)6 226 217 226
NLESTA1CC05 intermediate (TGT)17 217 138 164
Sampling
area

46 | P a g e
2.4 Regulatory compliance
The Office of Gene Technology Regulator (OGTR) granted licence DIR082/2007
to the Department of Environment and Primary Industries (DEPI, Victoria) for the
intentional release of genetically modified (GM) perennial ryegrass and tall
fescue into the environment on a limited scale (OGTR, 2007a). The DIR licence
allowed for field evaluation of perennial ryegrass to be conducted on a single
field trial site, under controlled conditions, in the shire of Southern Grampians,
Victoria (S 37°49’, E 142°04’) between June 2008 and July 2013 (Figure 2.3,
Figure 2.4).
A number of control measures to restrict the dissemination or persistence of the
GM plants and their introduced genetic material were included as licence
conditions in the DIR082/2007 OGTR licence (OGTR, 2007a). All licence
conditions were strictly adhered to during the entire experimental period, with
weekly inspections to ensure all licence conditions were met. All equipment used
for harvests were cleaned on site. Equipment taken off site was inspected and
sprayed with 80% v/v ethanol/water before leaving the site. Any plant material
removed from the trial site was placed in double containment for transportation
and was accompanied by transportation documents describing the nature and
amount of material as per OGTR transportation guidelines (OGTR, 2007b).

47 | P a g e
DPI, Hamilton
DIR082
DPI, Hamilton
DIR082
Figure 2.3. Location of the DIR082 field trial of transgenic perennial ryegrass
with altered fructan biosynthesis at the Department of Environment and Primary
Industries, Hamilton, Victoria (S 37°49’, E 142°04’).
Figure 2.4. The DIR082 licence allowed for the limited and controlled release of
up to 2000 plants. This field trial site was surrounded by a 250 m isolation zone
of Triticale.

48 | P a g e
Plants were inspected for signs of floral development on alternate days between
October and January each year. Reproductive tillers in reproductive stages E3 to
R2 (Figure 2.5) were removed at ground level to ensure that no pollination could
occur. After the conclusion of each field trial, the plants were destroyed through
the application of glyphosate [Roundup PowerMAXTM
(Monsanto)] containing a
coloured dye (red spray marker dye (Dy-mark)) for visual confirmation of the
application of herbicide to each plant. Post-trial monitoring continued on a
monthly basis to identify and remove any volunteer plants present on the DIR082
field trial site.

49 | P a g e
Figure 2.5. Developmental stages of Lolium perenne. Three sub-stages within
each of the vegetative (V), elongation (E), and reproductive (R) growth stages
are shown: V1, first leaf collared; V2, leaf collared; V3, third leaf collared; E1, first
node visible; E2, two nodes visible; E3, three nodes visible; R1, inflorescence
emerging; R2, spikelets fully emerged; R3, full anthesis. Positions of nodes are
shown by arrowheads. Internodes are shown for stages E1-E3. Bars = 2 cm
(vegetative), 3 cm (elongation), and 2 cm (reproduction) (Tu et al., 2010).

50 | P a g e
2.5 Field trial designs
The 2008/2009 and 2009/2010 field trials (Section 2.5.1 and 2.5.2) described in
this section pre-date the activities reported in this thesis. However, this
background is critical to the interpretation of the results described in this thesis
and has not been previously published.
2.5.1 Field trial design for primary T0 transgenic perennial ryegrass
events
The 2008/2009 experimental design was a space-planted nursery with a
randomised complete block design. Design parameters were 182 genotypes,
containing 7 rows and 26 columns per clonal replicate, with four clonal replicates.
To allow for clonal replicates, plants were replicated through vegetative
propagation, by separating three tillers per clone, in the PC2 glasshouse two
weeks prior to planting. Plants were transported to the DIR082 field trial site on
the 25th
September 2008 complying with OGTR transportation guidelines
(OGTR, 2007b). Plants were spaced 0.5 m apart, with 0.5 m spacing between
rows and replicates. The investigated plants were not surrounded by any border
plants. The field trial was planted on the 26th
September 2008 (Figure 2.5, 2.6).
The investigated plants included 100 primary T0 transgenic events carrying the
target sequence from the cGRA000022 cassette and 50 primary T0 transgenic
events carrying the target sequence from the cGRA000025 cassette. Control
plants included non-transformed maternal genotype (FLp418-20) and two PGG
Wrightsons breeding populations (FLp711, FLp752). Agronomic traits were
measured between September 2009 and February 2010. Agronomic traits were
measured between October 2008 and February 2009 in the 2008/2009 field trial.
Plants were visually scored for crown rust infection and plant vigour on the 27th
October 2008, 23rd
November 2008, 29th
December 2008 and 5th
January 2009.
All plants were sampled for fructan concentration in leaf blades on the 23rd
November 2008, with a sub-set of plants sampled for fructan concentration of
leaf blades and pseudostems on the 5th
January 2009.

51 | P a g e
Figure 2.5. Planting of the 2008/2009 field trial of primary T0 transgenic
perennial ryegrass with altered fructan biosynthesis.
Figure 2.6. The 2008/2009 field trial of primary T0 transgenic perennial ryegrass
events with altered fructan biosynthesis.
The 2009/2010 experimental design was a space-planted nursery using a
randomised complete block design. Design parameters were 108 genotypes,
containing 9 rows and 12 columns per clonal replicate, with two clonal replicates.
To allow for clonal replicates, plants were replicated through vegetative
propagation, by separating three tillers per clone, in the PC2 glasshouse two
weeks prior to planting. All genotypes were divided into four replicates, two
replicates being used for field evaluation and individual replicates being

52 | P a g e
maintained under containment glasshouse conditions. Plants were transported to
the DIR082 field trial site on the 24th
June 2009 complying with OGTR
transportation guidelines (OGTR, 2007b). Plants were spaced 0.5 m apart, with
0.5 m spacing between rows and replicates. The investigated plants were not
surrounded by any border plants. The field trial was planted on the 24th
June
2009. Control plants included non-transformed maternal genotype (FLp418-20),
three PGG Wrightson Seeds breeding populations (FLp853, PG1243 and
PG1266) and a commercial control cultivar, Abermagic.
A total of 75 primary T0 transgenic events, not previously screened under field
conditions, were selected for the 2009/2010 field trial based on consistently high
fructan content and low transgene copy number. The investigated plants
included 25 primary T0 transgenic events carrying the target sequence from the
cGRA000022 cassette and 50 primary T0 transgenic events carrying the target
sequence from the cGRA000025 cassette. Five T0 events (Table 3.6) from the
2008/2009 field trial, selected on the basis of consistently enhanced fructan
concentration in leaf blades and pseudostems, relative to their non-transgenic
isogenic control genotype (FLp418-20) were also planted included in the
2009/2010 field trial. Additional control plants included three high-fructan and
three low-fructan transgenic perennial ryegrass plants from the initial proof-of-
concept experiments, and a number of non-transgenic seed-derived perennial
ryegrass plants from different genotypes. Transgenic perennial ryegrass plants
with altered fructan biosynthesis, as well as corresponding control (transgenic
and wild type) plants were transplanted into the designated field site at Hamilton,
Victoria on 24th
June 2009 (Figure 2.7). Agronomic traits were measured
between September 2009 and February 2010 in the 2009/2010 field trial. Plants
were visually scored for crown rust infection on the 20th
January 2010 and plant
vigour on the 8th
September 2009, 22nd
October 2009, 3rd
November 2000 and
20th
January 2010. All plants were sampled for fructan concentration of
pseudostems on the 8th
September 2009, with a sub-set of plants sampled for
fructan concentration of leaf blades and pseudostems on the 22nd
October 2009,
3rd
November 2009 and 20th
January 2010.

Master Version (1)

Recommended

Recommended

More Related Content

Similar to Master Version (1)

Similar to Master Version (1) (20)

Master Version (1)