The document describes the identification, cloning, sequencing, and characterization of the a-L-arabinofuranosidase B (abfB) gene from the phytopathogenic fungus Fusarium oxysporum f. sp. dianthi (Fod). The gene was identified using random amplified polymorphic DNA and encodes a protein of 499 amino acids. The recombinant protein expressed in E. coli had arabinofuranosidase activity and optimal activity at pH 4.0 and 50°C. Reverse transcription PCR showed that the abfB gene is actively transcribed in carnation plants infected with Fod, suggesting it plays a role in the fungus's pathogenicity.

1. Physiological and Molecular Plant Pathology 64 (2004) 201–208
www.elsevier.com/locate/pmpp
Identification and characterization of the a-L-arabinofuranosidase B
of Fusarium oxysporum f. sp. dianthi
Carlos A. Chacon-Martıneza, Juan M. Anzolaa, Andres Rojasa, Freddy Hernandeza,
´ ´ ´ ´
a,b a a,*
Howard Junca , Walter Ocampo , Patricia Del Portillo
a
´ ´
Corporacion CorpoGen, Department of Molecular Biotechnology, Carrera 5, No. 66A-34, Bogota D.C., Colombia
b
Department of Environmental Microbiology, GBF-German Research Centre for Biotechnology, Mascheroder Weg 1, D-38124 Braunschweig, Germany
Accepted 26 August 2004
Abstract
The gene encoding a-L-Arabinofuranosidase B (abfB) from the phytopathogenic fungus Fusarium oxysporum f. sp. dianthi (Fod) was
identified, cloned, sequenced and heterologously expressed. AbfB consists in an intronless open reading frame of 1500-bp coding for a
protein of 499 aminoacid residues. The partially purified fusion protein has an apparent molecular mass of approximately 58 kDa and exhibits
a-L-arabinofuranosidase activity. The specific activity of the recombinant enzyme was 1.07 units mgK1 protein. Optimal activity is attained
at pH 4.0 and 50 8C. Interestingly, the abfB gene is actively transcribed in carnation plants infected with Fod. Its upregulation during the
infection process suggests a possible role of this gene as virulence factor in the phytopathogenicity of this fungus.
q 2004 Elsevier Ltd. All rights reserved.
Keywords: Carnation; Fusarium wilt; Phytopathogenic fungus; Hemicellulase; Arabinase; a-L-arabinofuranosidase
1. Introduction requires the cooperative action of several microbial
enzymes, particularly endo-b-xylanases and arabinosi-
The main structural components of plant cell walls are dases [11]. Arabinosidases comprise the a-L-arabinofura-
cellulose, hemicellulose, lignin and pectin, compounds also nosidases (a-L-arabinofuranoside arabinofuranohydrolase,
acting as protective barriers against phytopathogenic EC 3.2.1.55, ABF), enzymes able to hydrolyse terminal
organisms [12]. Fungal plant pathogens are able to produce non-reducing a-L-1,2-, a-L-1,3- and a-L-1,5-a-L-arabinofur-
a variety of enzymes hydrolysing these compounds, anosyl linkages from a-L-arabinofuranosides, arabinans,
facilitating the penetration and colonization of their hosts arabinoxylans and arabinogalactans [25]. The ABFs have
[34]. Xylan is a predominant hemicellulose polysaccharide been classified into four families of glycanases (glycosyl
composed of a backbone of b-1,4-xylopyranosyl residues, hydrolase families 43, 51, 54, and 62) on the basis of
some of which are substituted with arabinosyl, acetyl and aminoacid (aa) sequence similarities [18]. Glycosyl
glucuronosyl residues [29,30,35]. L-Arabinosyl residues are hydrolase families 51 and 54 comprise those glycanases
widely distributed in some hemicelluloses, such as showing a preferential activity against arabinose-containing
arabinan, arabinoxylan, arabic gum, and arabinogalactan polysaccharides.
[30]. The complete breakdown of these compounds Enzymes degrading hemicellulose polysaccharides use
to be present in plant pathogens, e.g. xylanases have been
isolated from a wide variety of fungal plant pathogens [34].
Abbreviations: AP-PCR, arbitrary priming-polymerase chain reaction; For this reason, attempts to interpret their functions as
ABF, a-L-arabinofuranosidase; abfB, a-L-arabinofuranosidase B gene; Fod, virulence factors have been a common trend in phytopathol-
Fusarium oxysporum f. sp. dianthi; Fox, Fusarium oxysporum; PNP-A,
para-nitrophenyl-a-L-arabinofuranoside; PNP, p-nitrophenol.
ogy, despite that the specific roles of these enzymes in
* Corresponding author. Tel.: C57 1 3484606/8; fax: C57 1 3484607. pathogenicity have not been clearly established yet. As an
E-mail address: corpogen@etb.net.co (P. Del Portillo). example, disruptions of two xylanase genes in Cochliobolus
0885-5765/$ - see front matter q 2004 Elsevier Ltd. All rights reserved.
doi:10.1016/j.pmpp.2004.08.005

2. 202 ´ ´
C.A. Chacon-Martınez et al. / Physiological and Molecular Plant Pathology 64 (2004) 201–208
carbonum or Magnaporthe grisea showed that they are not 2.2. DNA isolation and analysis
essential for pathogenicity [3,36], however, these enzymes
use to be present in multiple copies. A number of studies The mycelium was mechanically disrupted in a Mini
continue considering these enzymes as an important factor Bead Beater (Biospec Products Bartlesville, OK, USA)
in plant–pathogen interactions [34]. using 0.1 mm diameter glass beads (Biospec Products)
Fusarium oxysporum f. sp. dianthi (Fod) is the etiological moistened in TE (10 mM Tris–HCL, 1 mM EDTA pH 8.0)
agent of the vascular wilting disease of carnations, a disease containing 1% (w/v) SDS. The DNA was purified using
which causes important economic losses to commercial cetyltrimethyl ammonium bromide (CTAB; Sigma) and
carnation growers in Latin American and European extracted with one volume of chloroform:isoamyl alcohol
countries. The presence of xylanases in F. oxysporum (24:1). Southern blot analysis was carried out following
(Fox) has been reported [1,21,28]. Ruiz-Roldan and co- standard procedures [31].
workers [29] identified the xyl2 and xyl3 genes in F.
oxysporum f. sp. lycopersici and provided evidence for the 2.3. Sequence of the a-L-arabinofuranosidase gene
presence of these genes in other formae speciales of Fox.
Christakopoulos and co-workers [10] isolated and charac- The 2600-bp fragment identified by RAPD [19] was
terized an a-L-arabinofuranosidase from culture filtrates of isolated from 1% (w/v) agarose gels, purified using the
Fox. In a previous work using Fod race 2, a race of worldwide QIAquick Spin PCR purification kit (Qiagen, WI, USA) and
distribution [5] and the most aggressive and prevalent form cloned into the pGEM-T Easy Vector System (Promega).
of Fod in Colombia [4], we reported the identification by The DNA was sequenced using the BigDye terminator kit in
random amplified polymorphic DNA (RAPD), of a 2600 an ABI 377 XL automatic DNA sequencer (Perkin–Elmer
base pair (bp) molecular marker [19]. The sequence of this Applied Biosystems, USA).
2600-bp fragment shared high similarity with the DNA The complete nucleotide sequence of the gene was
sequences coding for the a- L -arabinofuranosidases obtained by a modification of the arbitrary-priming poly-
reported in the GenBank/EMBL/DDBJ databases. Here we merase chain reaction (AP-PCR) [8] as previously reported
report the cloning, the complete nucleotide sequence, the [27]. Briefly, the method consists in two amplification steps;
heterologous expression of the encoded protein, the in the first step, two arbitrary primers were mixed with a
detection of the arabinofuranosidase activity, and evidence specific primer derived from the nucleotide sequence of the
of in situ active transcription during plant infection of this 2600-bp fragment. In the second step, one aliquot of the first
a-L-arabinofuranosidase B gene of Fod race 2. round of amplification was used as a template, in which
specific primers were used to generate an enriched sequence
containing the remaining part of the gene. The PCR was
carried out in a final volume of 100 ml containing 1 ng of
2. Materials and methods Fod DNA, 5 U of Taq DNA polymerase (CorpoGen, COL),
2 mM MgCl2; PCR buffer pH 8.5 (20 mM Tris–HCl, 50 mM
KCl); 0.6 mM of each ARB1, ARB6 and Fod Dir (Table 1),
2.1. Strains, plasmids and culture conditions
0.2 mM of dNTPs and 50 ml of mineral oil. The first round
conditions were: (i) 5 min at 95 8C; (ii) 5!(30 s at 95 8C,
Fod race 2 strain 11–88, originally isolated in Israel [24], 30 s at 30 8C, 1.5 min at 72 8C); (iii) 30!(30 s at 95 8C, 30 s
was kindly provided by Dr G. Arbelaez from Universidad at 48 8C, 1 min 72 8C) and a final elongation of 5 min at
Nacional de Colombia. Escherichia coli BL21GoldDE3 72 8C in a thermal cycler PTC-100e MJ Research. The
(Stratagene, La Jolla, CA, USA) was used as host. Plasmids reaction for the second round of PCR was performed as
pGEM-T easy (Promega, Madison, WI, USA) and
pET-23c(C) (Novagen, Madison, WI, USA) were used as Table 1
cloning and expression vectors. For DNA extraction, Fod Primers used in this study
was grown during four days on potato dextrose agar Primer Sequence 5 0 -3 0 Reference
(PDA, Difco-BRL Laboratories. Detroit, MI, USA) at ARB1 GGCCACGCGTCGACTAGTAC [27]
28 8C. Induction of a-L-arabinofuranosidase expression for NNNNNNNNNNGATAT
enzymatic analysis was done by growing the fungus in ARB2 GGCCACGCGTCGACTAGTAC [27]
potato dextrose broth (PDB, Difco-BRL) supplemented ARB6 GGCCACGCGTCGACTAG [27]
TACNNNNNNNNNNACGCC
with 1% L-arabitol (Sigma Co., St Louis, MO, USA) during
FUS7 CGGGATCCGGACTGAATAACACAA This study
four days at 28 8C. For RNA extraction, the fungus was ARJM 1.2 TGGGGTTGTATCCGCCGTCAG This study
grown four days at 28 8C on solid medium, pH 5.0, FOD Dir GCCATTTAGTTCGGTGACAGCAC This study
containing 8 g lK1 of KH2PO4, 10 g lK1 of Na2NO3, ARA1 ATAACAGCAATGGAGCTC This study
1.67 g lK1 of yeast extract and 15 g lK1 of bacto agar, AAF direct CGGCGAATTCCTGCAGGACCATGa This study
AAR reverse CCGGCTCGAGGCAAAACCATTGGC1a This study
supplemented with 0.3% oat spelt xylan (Sigma) as
a
carbon source [13]. Restriction enzymes sites are in italic.

3. ´ ´
C.A. Chacon-Martınez et al. / Physiological and Molecular Plant Pathology 64 (2004) 201–208 203
described for the first round, but using as DNA template 5 ml used to transform E. coli BL21GoldDE3 competent cells
of the first-round PCR product and the primers were ARA1 using standard protocols [31]. Transformed cells bearing the
and ARB2 (Table 1). The PCR products were purified and recombinant plasmid (pET-AF) were grown in 50 ml of
sequenced as described above. The sequence was compared Luria Bertani broth (LB) containing 50 mg mlK1 of
with the GenBank sequence database using the BLASTX ampicillin at 37 8C with agitation, to reach an optical
program [2]. Open reading frame prediction was performed density (A600) of 0.5–0.7. Isopropyl b-D-thiogalactopyrano-
using ORF Finder (http://www.ncbi.nlm.nih.gov/gorf/gorf. side (IPTG) was added to give a final concentration of
html). Sequence assembly was done with the CAP3 0.4 mM, and the culture was further incubated with
Sequence Assembly Program [20]. Signal peptide and agitation for 3 h at 37 8C. The recombinant protein was
splicing sites predictions were carried out using the SignalP isolated essentially as previously reported [32] and isolated
WWW Server [26] and the SplicePredictor program [7], fractions were analyzed by sodium dodecyl sulphate/
respectively. polyacrylamide gel electrophoresis (SDS-PAGE) using
8% (w/v) polyacrylamide gels containing 0.1% (w/v) SDS
2.4. Reverse transcription-PCR [23]. Gels were stained with Coomassie brilliant blue R 250.
Recombinant fusion protein was refolded by dialysis against
Carnation plants infected by Fod and showing the
50 volumes of phosphate–buffered saline (PBS) pH 7.2 for
characteristic symptoms of the disease, were collected
50 h with four buffer changes every 12 h. To determine the
´
from a commercial farm (Sabana de Bogota, Colombia).
total protein concentration the Bradford method (BioRad)
Stem fragments of 10 cm length were rinsed with deionized
was used with Immunoglobulin G (IgG) as standard.
water and 70% (v/v) ethanol. Transversal cuts in the stem
were performed and segments of the affected tissues were
placed in RNA later (Qiagen) until RNA extraction. Total 2.6. Enzymatic assay
RNA from infected carnation plants or from induced
cultures of Fod race 2 was isolated with TRIZOLw reagent The a-L-arabinofuranosidase enzymatic activity was
(Gibco-BRL), using 0.1 g of 0.1 mm diameter glass beads to measured using para-nitrophenyl-a-L-arabinofuranoside
mechanically disrupt the mycelium and vegetal tissue in a (PNP-A, Sigma N3641) as substrate. Each assay mixture
Mini Bead Beater. The Reverse Transcription-PCR (RT- contained 180 ml of a 1 mM PNP-A solution in 50 mM
PCR) was performed with the Access RT-PCR kit citrate buffer (pH 4.0) and 20 ml of the samples. The reaction
(Promega). The reaction was carried out in a final volume was carried out at 50 8C for 30 min, stopped by adding
of 50 ml containing: 50 ng of total RNA (treated with Dnase 100 ml of a 1 M Na2CO3 solution, and the amount of p-
free Rnase, Promega), AMV/Tfl reaction buffer, 0.2 mM nitrophenol (PNP) released was determined at 415 nm. The
dNTPs, 1 mM MgSO4, 0.1 U AMV reverse transcriptase, activity was expressed as international units in which one
0.1 U Tfl DNA polymerase and 0.6 mM of the specific unit was defined as the amount of the enzyme required to
primers AAF-AAR (Table 1). The cDNA was obtained by release 1 mmol of PNP from PNP-A per min under these
incubation at 42 8C for 45 min, followed by 40 cycles of experimental conditions [10,16,22].
30 s at 95 8C, 1 min at 70 8C, and 2 min at 72 8C. Total RNA
from infected carnation plant was used as template in RT-
PCR under the same conditions but using primers ARJM 1.2 2.7. Optimal temperature and pH
and FUS7.
The optimal temperature for the enzymatic activity was
2.5. Cloning and expression of the abf gene in E. coli determined by carrying out the standard assay at various
temperatures between 40 and 92 8C in 50 mM of citrate
The abf gene was amplified by PCR from 50 ng of buffer (pH 4.0), as described above. The optimum pH value
genomic DNA of Fod race 2, using 1 U of high fidelity DNA was determined by monitoring activity at 50 8C at various
polymerase with proofreading activity (Platinumw Pfx DNA pH values between 2.5 and 8.0. The buffers used were:
polymerase, Gibco-BRL), PCR buffer (20 mM Tris–HCl 50 mM glycine–HCl (pH 2.5), 50 mM citrate (pH 4.0),
50 mM KCl, pH 8.5), 1.5 mM MgCl2, 0.2 mM dNTPs and 50 mM citrate–phosphate (pH 6.0) and 50 mM Tris–HCl
0.4 mM of each primer (AAF and AAR). The reaction (pH 8.0).
conditions were: (i) 5 min at 95 8C; (ii) 5!(30 s at 95 8C,
45 s at 55 8C, 1 min at 72 8C); (iii) 30!(30 s at 95 8C, 1 min
45 s at 72 8C); (iv) 5 min at 72 8C. The amplified product 2.8. Nucleotide sequence accession number
was purified using the QIAquick gel extraction kit, digested
with EcoR I and Xho I enzymes and cloned in pET-23c(C) The complete nucleotide sequence of the Fod a-L-
vector. Recombinant plasmids were sequenced as described arabinofuranosidase B gene (abfB) was deposited in
above (Section 2.2) using primers T7 [31] and walking GenBank/EMBL/DDBJ databases under the accession
primers, and a plasmid with the confirmed sequence was number AJ310126.

4. 204 ´ ´
C.A. Chacon-Martınez et al. / Physiological and Molecular Plant Pathology 64 (2004) 201–208
3. Results HL15 (79%) (GenBank accession number AB073860), the
ABF1 of P. purpurogenum (78%) [9], and the ABF of
3.1. Sequence analysis and characterization of the abf gene Cochliobolus carbonum (77%) (GenBank accession number
AF306764.1), which belong to the glycoside hydrolase
ORF Finder analysis of the 2600-bp RAPD fragment family 54 [13,15,25]. The phylogenetic relationships of that
isolated previously [19], identified a potential open reading family showed that the putative abfB gene of Fod is one of
frame (ORF) of 1086-bp located at the 3 0 end of the its new members (Fig. 3), indicating the common evol-
fragment which exhibits 67% aminoacid identity in the utionary and functional features of this ABFs, e.g. all are
predicted aminoacid sequence with the amino terminal encoded in intronless genes, all are of fungal origin and all
region of ABFs of Penicillium purpurogenum and Asper- share a high degree of sequence similarity.
gillus oryzae reported in the database. The sequence The predicted protein had an estimated molecular mass
analysis also indicated that the 2600-bp RAPD fragment of 53 kDa and a cleavage site for a signal peptide is
comprised around two third of the abf gene codons (CDS). predicted to be located between aa positions 20 and 21 [33].
In order to amplify the missing portion of the gene, AP-PCR
technique was used. Fig. 1 shows an enriched band of 876- 3.2. Transcriptional expression of abfB gene
bp which was subsequently purified, sequenced and then
assembled with the 2600-bp RAPD fragment. ORF Finder To determine if the putative abfB gene of Fod is
analysis of the resulting sequence predicted the existence of expressed in l-arabitol induced cultures, a RT-PCR
an ORF encoding for a protein similar to other ABFs of experiment was conducted using total RNA. The ABF
filamentous fungi, suggesting that this ORF is an abf gene of mRNA was detected using the specific primers AAF and
Fod. The putative Fod abfB gene has a length consists in an AAR. The 1500-bp RT-PCR product was identical to the
ORF of 1500-bp encoding 499 aa. fragment amplified by PCR using the same primers and Fod
Analysis of the 5 0 noncoding region revealed putative genomic DNA as template (Fig. 4A). The amplified size of
promoter elements such as a TATA box, CAAT and CT the cDNA of Fod abfB gene confirmed the absence of
stretches (Fig. 2). Further analysis of the gene using splicing signals inside the ORF. RT-PCR experiments also
SplicePredictor program showed that the putative abfB demonstrated that the enzyme is expressed in infected
gene did not contain splicing consensus sequences. carnation plants (Fig. 4B).
Therefore, the length comprising the ORF is identical to
the CDS, indicating an eukaryotic intronless gene. Southern 3.3. Protein expression of the abfB gene in E. coli
blot analysis of Fod genomic DNA cut with different
restriction enzymes and hybridised with an internal frag- To clone and express the putative abfB gene, primers
ment of the gene as a probe, strongly suggest that abfB is AAF and AAR (Table 1) were designed and used to PCR
present in this genome in single copy (data not shown). amplify this gene from Fod genomic DNA excluding the
Comparison of the deduced aminoacid sequences of the signal peptide region. The amplified fragment of 1453-bp
abfB gene against others ABFs showed high similarities hybridised with an internal region of the putative abfB gene
with arabinofuranosidases such as the ABF B of A. oryzae probe (data not shown). This 1453-bp fragment was
digested with EcoR I and Xho I, cloned in pET-23c(C),
and the insert sequence was further confirmed. The resultant
plasmid was transformed in E. coli BL21GoldDE3 cells.
Expression of the recombinant protein was obtained by the
addition of IPTG. After induction, a high level of expression
was observed, and the expressed protein was accumulated in
inclusion bodies in an insoluble and inactive form (Fig. 5).
To obtain an active enzyme, the protein was solubilized
after a selective isolation of the inclusion bodies, and
refolded by dialysis. This protein was further on used to
determine enzymatic activity. As estimated by SDS-PAGE,
the expressed protein showed a molecular mass of 58 kDa
(Fig. 5) in accordance to the expected native protein
molecular mass of 53 kDa.
Fig. 1. AP-PCR from Fusarium oxysporum f. sp. dianthi race 2 genomic 3.4. Enzymatic activity of ABF B
DNA showing an enriched band of 876-bp. Lane 1: negative control
without F. oxysporum f. sp. dianthi DNA; lane 2: first round of
amplification with primers ARB1, ARB6 and Fod Dir; lane 3: second The enzymatic activity of ABF was determined from
round of amplification with primers ARB2 and ARA1; lane 4: gene ruler culture filtrates of Fod and from the refolded
molecular weight markers (KPL, ME, USA). recombinant enzyme. ABF activity was assayed

5. ´ ´
C.A. Chacon-Martınez et al. / Physiological and Molecular Plant Pathology 64 (2004) 201–208 205
Fig. 2. Nucleotide and deduced aminoacid sequences of a-L-arabinofuranosidase B of F. oxysporum f. sp. dianthi race 2. The putative TATA boxes, CAAT
motifs, CT-stretch and translation initiation site are underlined. The putative signal peptide is in italic and gray. The ABF B conserved domain is indicated in
gray box.

6. 206 ´ ´
C.A. Chacon-Martınez et al. / Physiological and Molecular Plant Pathology 64 (2004) 201–208
Fig. 2 (continued)
following the standard method (see Section 2). The and characterization of a Fod gene with a specific function.
specific activity observed in culture filtrates of Fod was The ABF B of Fod reported in this paper seems to be
1.48 IU mgK1 protein and the activity observed from the different from the extracellular a-L-arabinofuranosidase
refolded expressed protein was 1.07 IU mgK1 protein. from F. oxysporum F3 isolated from cumin which had a
Both, the recombinant and the native ABF enzyme had molecular mass of 66 kDa and optimal activity at pH 6.0
an optimal activity at pH 4.0 and 50 8C. Expression and and 60 8C of temperature [10]. However, it is difficult to do a
detection of the ABF activity from this protein in a more extensive comparison because nucleotide or N-term-
heterologous host provided a definitive proof of the inal sequence of this gene/protein has not been determined.
functional identity of the abf gene, since E. coli does not The presence of ABF A and ABF B have been reported in
produce an endogenous equivalent of this activity. A. niger [13,14] and A. kawachii (GenBank acc. no.
AB085904: AB085903), and these two enzymes do not
have significant similarity either at the nucleotide or at the
4. Discussion aminoacid sequence levels. Therefore, it is very likely that
Fod could host more than one ABF type protein.
In this work, we are reporting the cloning, the expression The mRNA of the Fod abfB gene was detected in
and the nucleotide sequence of the abfB gene of Fod, which induced cultures of the fungus by RT-PCR, using oat
is, to our knowledge, the first report on the cloning spelt xylan as inducer, and its corresponding enzyme was
Fig. 3. Phylogenetic tree obtained by N–J method of a CLUSTAL W alignment of 13 a-L-arabinofuranosidase protein sequences belonging to the glycoside
hydrolase family 54 (at http://afmb.cnrs-mrs.fr/CAZY/GH_54.html) including the sequence described in this work. A cluster of sequences belonging to
glycoside hydrolase families 43, 51 and 62 was used as an outgroup. Sequences are designated with DDBJ/EMBL/GenBank accession number, organism of
origin, strain name and gene abbreviation. Bar represents 5 aa changes per 100 aa. Bootstrap values above 50% from 1000 neighbor-joining trees are indicated
at the left of the nodes.

7. ´ ´
C.A. Chacon-Martınez et al. / Physiological and Molecular Plant Pathology 64 (2004) 201–208 207
functionally expressed in E. coli, confirming that this
gene is biologically functional. It is generally accepted
that cell wall-degrading enzymes may be important in at
least two key stages of the development of vascular wilt
disease. First, during penetration of the organisms
through the different layers of the root cortex, and
second, during colonization of the host by enabling the
organism to upward through the xylem vessels [6].
Xylanases are produced by a number of plant
pathogenic fungi and it has been suggested that they
may play a role during infection [34]. Specifically,
F. oxysporum secretes a number of xylanases [1,10,21]
and at least three xylanases genes are expressed by the
Fox f. sp. lycopersici during different stages of infection
on tomato plants [17]. Nevertheless, the expression of
xylanases in Fod has not been reported yet. Regarding
the possible role of Fod ABF B in nature, in vivo
experiments to detect active gene expression of abfB
mRNA showed that this gene is actively transcribed in
Fig. 4. Expression of the F. oxysporum f. sp. dianthi race 2 a-L-
arabinofuranosidase B. (A) Expression of Fod ABF B in induced cultures
infected carnation plants. The active transcription of the
upon 72 h of oat spelt xylan induction determined by RT-PCR. Lane 1: Fod abfB gene during infection suggests that this enzyme
molecular weight markers 100 bp ladder (Invitrogen); lane 2: RT-PCR of could be involved in the pathogen ability to either
Fod total RNA with specific primers AAF and AAR; lane 3: genomic DNA penetrate or colonize carnations. Phytopathogenicity
of Fod amplified with the specific primers AAF and AAR; lane 4: negative assays using Fod abfB knockout mutants will be
control, total RNA of Fod amplified with the specific primers AAF and AAR
without AMV; lane 5: Access RT-PCR positive control (Promega).
necessary in order to determine the specific role of this
(B) Expression of Fod ABF B in infected carnation plants determined by enzyme in the pathogenesis of the fungus.
RT-PCR with specific primers ARJM 1.2 and FUS7. Lane 1: molecular
weight markers 1 kb ladder (Invitrogen); lane 2: Infected carnation total
RNA; lane 3: Infected carnation total RNA without AMV Reverse
Transcriptase; lane 4: Uninfected carnation total RNA; lane 5: Uninfected Acknowledgements
carnation total RNA without AMV Reverse Transcriptase; lane 6: Positive
control, induced culture of Fod total RNA; lane 7: Induced culture of Fod
total RNA without AMV Reverse Transcriptase; lane 8: Access RT-PCR This work was supported by the Colombian agency for
positive control (Promega); lane 9: molecular weight markers 100 bp ladder. research support COLCIENCIAS grant No. 209-2000.
References
´
[1] Alconada T, Martınez M. Purification and characterization of an
extracellular endo-1,4-beta-xylanase from the tomato vascular
pathogen Fusarium oxysporum f. sp. melonis. FEMS Microbiol Lett
1994;118:305–10.
[2] Altschul S, Gish W, Miller W, Myers E, Lipman D. Basic local
alignment search tool. J Mol Biol 1990;215:403–10.
[3] Apel-Birkhold P, Walton J. Cloning, disruption and expression of two
endo-beta-1,4-xylanase genes, XYL2 and XYL3, from Cochiobolus
carbonum. Appl Environ Microbiol 1996;62:4129–35.
´ ´
[4] Arbelaez G, Calderon O. Determination of the physiological races of
Fusarium oxysporum f. sp. dianthi on carnation in Colombia. Acta
Horticulturae 1992;300:43–9.
[5] Baayen R, van Dreven F, Krijger M, Waalwijk C. Genetic diversity in
Fig. 5. SDS-PAGE analysis of the recombinant a-L-arabinofuranosidase B Fusarium oxysporum f. sp. dianthi and Fusarium redolens f. sp.
protein expressed in E. coli BL21GoldDE3. Cellular localization of the dianthi. Eur J Plant Pathol 1997;103:395–408.
expressed ABF B protein. Lane 1: molecular weight markers protein mid- [6] Beckman C. The nature of wilt diseases of plants. St Paul, MN:
range (Promega); lane 2: cell extract of E. coli BL21GoldDE3 harboring American Phytopathological Society; 1987.
pET-23c(C); lane 3: extracellular fraction of E. coli BL21GoldDE3 [7] Brendel V, Xing L, Zhu W. Gene structure prediction from consensus
harboring pET-AF; lane 4: periplasmic fraction of E. coli BL21GoldDE3 spliced alignment of multiple ESTs matching the same genomic locus.
harboring pET-AF; lane 5: soluble intracellular fraction of E. coli Bioinformatics 2004;20:1157–69.
BL21GoldDE3 harboring pET-AF; lane 6: insoluble intracellular fraction [8] Caetano-Annoles G. Amplifying DNA with arbitrary oligonucleotide
(inclusion bodies) of E. coli BL21GoldDE3 harboring pET-AF. primers. J PCR Methods Appl 1993;3:85–92.

8. 208 ´ ´
C.A. Chacon-Martınez et al. / Physiological and Molecular Plant Pathology 64 (2004) 201–208
[9] Carvallo M, De Ioannes P, Navarro C, Chavez R, Peirano A, Bull P, [22] Kaneko S, Arimoto M, Kobayashi H, Ishii T, Kusakabe I. Purification
Eyzaguirre J. Characterization of an alpha-L-arabinofuranosidase gene and substrate specificities of two alpha-L-arabinofuranosidases from
(abf 1) from Penicillium purpurogenum and its expression. Mycolo- Aspergillus awamori IFO 4033. Appl Environ Microbiol 1998;64:
gycal Res 2003;107:388–94. 4021–7.
[10] Christakopoulos P, Katapodis P, Hatzinikolaou D, Kekos D, Macris B. [23] Laemmli U. Cleavage of structure proteins during the assembly of the
Purification and characterization of an extracellular alpha-L-arabino- head of bacteriophage T4. Nature 1970;227:680–5.
furanosidase from Fusarium oxysporum. Appl Biochem Biotechnol [24] Manulis S, Kogan N, Reuven M, Ben-Yephet Y. Use of the RAPD
2000;87:127–33. technique for identification of Fusarium oxysporum f. sp. dianthi from
[11] Crous J, Pretorius I, van Zyl W. Cloning and expression of alpha - carnation. Phytopathology 1993;84:98–101.
L-arabinofuranosidase gene (ABF2) of Aspergillus niger in [25] Margolles-Clark E, Tenkanen M, Nakari-Setala T, Penttila M.
Saccharomyces cerevisiae. Appl Microbiol Biotechnol 1996;46: Cloning of genes encoding alpha-L-arabinofuranosidase and beta-
256–60. xylosidase from Trichoderma reesei by expression in Saccharomyces
[12] Degefu Y, Paulin L, Lubeck P. Cloning, sequencing and expression of cerevisiae. Appl Environ Microbiol 1996;62:3840–6.
a xylanase gene from the maize pathogen Helminthosporium [26] Nielsen H, Engelbrecht J, Brunak S, von Heijne G. Identification of
turcicum. Eur J Plant Pathol 2001;107:457–65. prokaryotic and eukaryotic signal peptides and prediction of their
[13] Flipphi M, van Heuvel M, van der Veen P, Visser J, de Graff L. cleavage sites. Protein Eng 1997;10.
Cloning and characterization of the abfB gene coding for the major [27] O’Toole G, Kolter R. Initiation of biofilm formation in Pseudomonas
alpha-L-arabinofuranosidase (ABF B) of Aspergillus niger. Curr fluorescens WCS365 proceeds via multiple, convergent signalling
Genet 1993;24:525–32. pathways: a genetic analysis. Mol Microbiol 1998;28:449–61.
[14] Flipphi M, Visser J, van der Veen P, de Graff L. Cloning of the [28] Ruiz M, Roncero M, Di Pietro A. Purification and characterization of
Aspergillus niger gene encoding alpha-L-arabinofuranosidase A. Appl an acid endo-beta-1,4-xylanase from the tomato vascular pathogen
Environ Microbiol 1993;39:335–40. Fusarium oxysporum f. sp. lycopersici. FEMS Microbiol Lett 1997;
[15] Gielkens M, Gonzalez-Candelas L, Sanchez-Torres P, van de 148:75–82.
Vondervoort P, de Graaff L, Visser J, Ramon D. The abfB gene [29] Ruiz-Roldan M, Di Pietro A, Huertas-Gonzales M, Romero M. Two
encoding the major alpha-L-arabinofuranosidase of Aspergillus xylanase genes in the vascular wilt pathogen Fusarium oxysporum are
nidulans: nucleotide sequence, regulation and construction of a differentially expressed during infection on tomato plants. Mol Gen
disrupted strain. Microbiology 1999;145:735–41. Genet 1999;261:530–6.
[16] Gilead S, Shoham Y. Purification and characterization of an alpha- [30] Saha B. Alpha-L-arabinofuranosidases: biochemistry, molecular
L-arabinofuranosidase from Bacillus stearothermophilus T-6. Appl biology and applications in biotechnology. Biotechnol Adv 2000;
Environ Microbiol 1995;61:170–4. 18:403–23.
´ ´ ´ ´
[17] Gomez-Gomez E, Ruız-Roldan M, Di Pietro A, Roncero M, Hera C. [31] Sambrook J, Fritsh E, Maniatis T. Molecular cloning: a laboratory
Role in pathogenesis of two endo-beta-1,4-xylanase genes from the manual. New York: Cold Spring Harbour Press; 1989.
vascular wilt fungus Fusarium oxysporum. Fungal Genet Biol 2002; [32] Sheve-yann C, Kwang-huei L. Purification of active eukaryotic
35:213–22. proteins from the inclusion bodies in E. coli. Benchmark, Biotechni-
[18] Henrissat H, Bairoch A. Updating the sequence-based classification of ques 1991;11:748–53.
glycosyl hydrolases. Biochem J 1996;316:695–6. [33] von Heijne G. A new method for predicting signal sequence cleavage
´
[19] Hernandez J, Posada M, Arbelaez G, Del Portillo P. Identification of sites. Nucleic Acids Res 1986;14:4683–90.
molecular markers of Fusarium oxysporum f.sp. dianthi by RAPDs. [34] Walton J. Deconstructing the cell wall. J Plant Physiol 1994;104:
Acta Horticulturae 1998;482:123–8. 1113–8.
[20] Huang X, Madan A. CAP3: a DNA sequence assembly program. [35] Wong K, Tan L, Saddler J. Multiplicity of beta-1,4-xylanase in
Genome Res 1999;9:868–77. microorganisms: functions and applications. Microbiol Rev 1998;52:
[21] Jones T, Anderson A, Albersheim P. Host pathogen interactions. IV. 305–17.
Studies in the polysaccharide-degrading enzymes secreted by [36] Wu S-C, Kyung-Sick H, Darvill A, Albersheim P. Deletion of two
Fusarium oxysporum f. sp. lycopersici. Physiol Plant Pathol 1972;2: endo-beta-1,4-xylanase genes reveals additional isozymes secreted by
153–66. the rice blast fungus. Mol Plant–Microbe Interact 1997;10:700–8.