SlideShare a Scribd company logo
1 of 28
.
CREDIT SEMINAR
NUCLEIC ACID ANALYSIS IN NEMATODE
SYSTEMATICS
Presented By:
Mahnur Ali
A.A.U.
Deptt. of Nematology.
Introduction
Pathway to Molecular Diagnostics
Molecular identification & Morphological
identification
Steps involve in nucleic acid analysis
Extraction, Quantification, Amplification,
Separation, Analysis and interpretation
Utilization of different molecular
techniques for nematode systematic
Summary
.
INTRODUCTION
 Due to release of various metabolites by different (host &
non-host) crops and environmental effects there may be
change in the morphological characteristic of nematodes.
To reveal the actual variation and true identification, nucleic
acid analysis is important.
Variation present in nucleotide sequence cannot be observe
under microscope.
.
NUCLEIC ACIDS
DNA
RNA
Genome sizes
Caenorhabditis elegens = 100 MB
Meloidogyne incognita = 82 MB
Meloidogyne hapla = 54 MB
•Nucleic acids are polymers
•Nucleotides are monomers
Nitrogenous bases
-Purines
-Pyrimidine
Sugar
-Ribose
-Deoxyribose
Phosphates +
Nucleoside=Nucleotides
Nucleosides
.
.
Pathway to Molecular Diagnostics
1865 – G. Mendel, Law of Heredity
1866 –Johann Miescher, , Purification of DNA
1953 – Watson and Crick, Structure of DNA
1977 – DNA sequencing
1985 – Kary Mullis, in vitro Amplification of
DNA (PCR)
1998 – C. elegans the first multi-
cellular organism sequenced
Why Molecular Identification ?
. Morphological Identification Molecular Identification
Set-up cost Low High
Long-term cost High Low
Employee requirement Highly trained, experienced Minimal training
Length of process Slower More rapid
Morphological characters Variable NA
Females required Yes No
Mixed species
populations
Difficult to distinguish No
STEPS INVOLVE IN NUCLEIC ACID
ANALYSIS
Extraction and isolation of DNA
Quantification
Amplification by PCR
Techniques used
Analysis and & interpretation
Extraction of DNA from Nematodes
.
Single nematode
Entire communityMultiple nematode (~25)
Extraction from soil
Extraction of DNA from Nematodes
Single/Multiple Nematodes Nematode Community Nematodes in Soil
Cut nematodes with
scalpel to disrupt cuticle
Use a bead beater to disrupt
nematode cuticle
Kit that contains beads
(Powersoil, Powermax)
Use Nematode Extraction
Buffer which includes
Proteinase K
Use Nematode Extraction
Buffer which includes
Proteinase K
Place soil directly
in tube
Cooling and heating steps
required
Cooling and heating steps
required
Follow recipe
AMPLIFICATION BY PCR
5’
3’
3’
5’
Target
1. Denature
2. Anneal primers
3. Extend primers
Two copies
of target
1. Denature
2. Anneal primers
3. Extend primers
Four copies
of target
Restriction Fragment
Analysis
Nucleic
acids
analysis
techniques
DNA-DNA Hybridization
Nucleotide Sequencing
For systematics
Divided into
1.
3.
2.
1.Restriction Fragment Analysis
• This technique uses restriction enzymes to cleave DNA at
specific sites along the DNA molecule.
• Enzyme will digest DNA at specific sequence to generate
fragments of DNA
• Fragments are separated through gel electrophoresis.
• The banding patterns are visualized under florescent stain
(ethidium bromid) or by autoradiography.
Techniques involved in Restriction
Fragment Analysis
1. RFLP ( Restriction Fragment Length Polymorphism )
2. RAPD ( Random Amplified Polymorphic DNA )
3. AFLP ( Amplified Fragment Length Polymorphism )
RFLPs involves fragmenting
a sample of DNA by a
restriction enzyme, which can
recognize and cut DNA
wherever a specific short
sequence occurs.
A RFLP occurs when the
length of a detected fragment
varies between individuals.
 PCR based product but
the segments of DNA that
are amplified are random
we can amplify restricted
fragments and reduces the
complexity of material to be
analyzed (approx 1000
folds).
it can be used for
comparison between closely
related species only.
1 32
Enzyme Site Recognition in
RFLP
.
Restriction site Palindrome
Fragment 1 Fragment 2
• enzyme will digests (cuts) DNA at a
specific sequence = restriction site
• Enzymes recognize 4- or 6- base
pair, palindromic sequences
(e.g. GAATTC)
.
Power Supply
Agarose gel
Electrophoresis
 Electrical current
carries negatively-
charged DNA
through gel
towards positive
(red) electrode.
 Small fragments
move faster than
large fragments
.
Gel running
.
.
Utilisation of different techniques for
Restriction Fragment Analysis
Method use limitations Application example
1. RFLP
-Suited to differentiate
between closely related
taxa based on presence/
absence of restriction
fragment bands
-Lacks homology of
characters
- Requires large amounts of
PCR products to use for
different restriction
enzymes
-Detection of population within
Steinernema spp. (Curran et al. 1985,
(Oliveira et al., 2006; Barsi et al.,
2008).
2.AFLP -Suited to assess variation
among individuals of the
same species
-Lengthy procedure -Detection of species in Heterodera
avenae group (Subbotin et al.,
1999),.study of intra specific variation
in Radopholus similes (Elbadri et al.,
2002).
3.RAPD - Unlike AFLP this
method doesn’t require a
restriction step
- Simple and rapid
- Sensitive to variations in
primer and DNA
concentration
-Detection of Globodera
rostochiensis,G. pallida, Meloidogyne
incognita, M. javanica, and M.
arenaria. (Fullaondo et al., 1999;
Zijlstra et al. 2000)
.
.
2.DNA-DNA HYBRIDIZATION
What is
it?
What it
does?
Why it is
done?
Extracted DNA
..
DNA Samples
Separated strands
allow to Cool or ( re-anneal )
Heated
Low Tm=not closely related High Tm= closely related
0% homology
100% homology
M. hapla from M. arenaria , M. incognita M. Javanica
(C. Sereno, 2006 )
Process of determining precise order of nucleotides
within a DNA molecule.
Sequencing is done
NUCLEOTIDE SEQUENCING
 To confirm the identity of genes isolated by hybridization or
amplified PCR.
 For determine the DNA sequence of promoters and other
regulatory sequence.
 Reveal the fine structure of genes and other DNA.
 To confirm the sequence of cDNA .
 To identify mutation.
METHOD
 Principle- Use of dideoxynucleotide triphosphate
(ddNTP’s) as DNA chain terminator.
Method requires :-
1. Single stranded DNA template.
2. DNA primer.
3. DNA polymerase.
4. Normal dideoxynucleotide phosphates (dNTP’s ).
5. Modified nucleotides (ddNTP’s) that terminate DNA
strand elongation.
Chain-termination
method(Sanger method). F. Sanger in 1977By
.
Complementary strand
Template strand3’
3’5’
5’
primer
5’3’
1. DNA
polymerase
2. dNTP’s
3. ddNTP’s
+ Dideoxy ATP + Dideoxy TTP + Dideoxy CTP + Dideoxy GTP
DNA strand
.
1 2 3 4
3’
5’
T
G
G
T
A
C
G
Position of nucleotides from 5’ to 3’
.
Method Use Limitations Application example
DNA
Sequencing
Variation in primer
and DNA
concentration, DNA
template quality, gel
electrophoresis, and
the type of DNA
polymerase) can be
controlled and the
sequencing step can
be optimized.
- Fast and accurate
Difficult in finding
an ideal gene for
phylogenetic
inference , that
works in all
nematode groups.
Choice of marker is
still an open issue.
Used in case of family
Hoplolaimidae,
(Subbotin et al., 2007),
order Tylenchida
(Subbotin et al., 2006),
suborder
Criconematina (Subbotin
et al., 2005),
suborder Cephalobina
(Nadler et al.,2006) , .
.
,
M. arenaria TCGGCGATAGAGGTAAATGAC
TCGAGGGCATCTAATAAAGG
420 bp
950bp
Zijlstra et al., 2000
Dong et al., 2001
M. chitwoodi CCAATGATAGAGATAGGAAC
GATCTATGGCAGATGGTATGGA
TGGAGAGCAGCAGGAGAAAGA
400 bp
900 bp
800 bp
Williamson et al., 1997
Petersen et al., 1997
Zijlstra, 2000
M. exigua CATCCGTGCTGTAGCTGCGAG
CTCCGTGGGAAGAAAGACTG
562 bp Randig et al., 2002
M. hapla CAGGCCCTTCCAGCTAAAGA
TGACGGCGGTGAGTGCGA
GGCTGAGCATAGTAGATGATGTT
GGATGGCGTGCTTTCAAC
960 bp
610 bp
1500 bp
440 bp
Williamson et al., 1997
Zijlstra, 2000
Dong et al., 2001bp
Wishart et al., 2002
M. incognita CTCTGCCCAATGAGCTGTCC
TAGGCAGTAGGTTGTCGGG
GGGATGTGTAAATGCTCCTG
GTGAGGATTCAGCTCCCCAG
1200 bp
1350 bp
399 bp
955 bp
Zijlstra et al., 2000
Dong et al., 2001
Randig et al., 2002
Meng et al., 2004
M. javanica CCTTAATGTCAACACTAGAGCC
GGTGCGCGATTGAACTGAGC
ACGCTAGAATTCGACCCTGG
1650 bp
670 bp
519 bp
Dong et al., 2001b
Zijlstra et al., 2000
Meng et al., 2004
M. mayaguensis GAAATTGCTTTATTGTTACTAAG 322 bp Blok et al., 2002
M. naasi CTCTTTATGGAGAATAATCGT 433 bp Zijlstra et al., 2004
M. paranaensis GCCCGACTCCATTTGACGGA 208 bp Randig et al., 2002
Species Primer set ( 5’-3’ ) Amplicon length Reference
SUMMARY
Molecular techniques in the field of biology has helped
us to get the accurate identification of nematode
species and to detect the smallest variations within
species and even within individual strains.
 One can see the degree of relationship among
different species of nematodes by hybridization
technique.
 Nucleotide sequencing methods are most informative
in the study of systematic of nematode species. The
data obtained from such studies are used to construct
phylogenetic trees
 Traditional methods are although important
but molecular evidences could be final or
confirmatory evidences.
Gel electrophoresis can separate fragments of
DNA on the basis of their sizes, base pair and
form a useful method to characterize nematode
species.
By comparing the base sequences of nematode
species, one can determine the exact number of
mutational variations.
.
.

More Related Content

What's hot

MOLECULARBIOLOGYSEMINAR
MOLECULARBIOLOGYSEMINARMOLECULARBIOLOGYSEMINAR
MOLECULARBIOLOGYSEMINARValentinaSerna
 
Dna extraction from blood and forensic samples
Dna extraction from blood and forensic samplesDna extraction from blood and forensic samples
Dna extraction from blood and forensic samplesCAS0609
 
Personalized nanomedicine for the treatment of vascular hypertension
Personalized nanomedicine for the treatment of vascular hypertensionPersonalized nanomedicine for the treatment of vascular hypertension
Personalized nanomedicine for the treatment of vascular hypertensionSusanta Kumar Rout
 
DNA- Basics on isolation, quantification, storage
DNA- Basics on isolation, quantification, storageDNA- Basics on isolation, quantification, storage
DNA- Basics on isolation, quantification, storageNaveen Rajeshwar B
 
Techniques of DNA Extraction, Purification and Quantification
Techniques of DNA Extraction, Purification and QuantificationTechniques of DNA Extraction, Purification and Quantification
Techniques of DNA Extraction, Purification and QuantificationBHUMI GAMETI
 
DNA Barcoding of Stone Fish Uranoscopus Oligolepis: Intra Species Delineation...
DNA Barcoding of Stone Fish Uranoscopus Oligolepis: Intra Species Delineation...DNA Barcoding of Stone Fish Uranoscopus Oligolepis: Intra Species Delineation...
DNA Barcoding of Stone Fish Uranoscopus Oligolepis: Intra Species Delineation...journal ijrtem
 
Production of gold nanoparticles by Streptomyces djakartensis isolate B-5
Production of gold nanoparticles by Streptomyces djakartensis isolate B-5Production of gold nanoparticles by Streptomyces djakartensis isolate B-5
Production of gold nanoparticles by Streptomyces djakartensis isolate B-5Nanomedicine Journal (NMJ)
 
Plant dna extraction method
Plant dna extraction methodPlant dna extraction method
Plant dna extraction methodphrrupom
 
The International Journal of Engineering and Science (IJES)
The International Journal of Engineering and Science (IJES)The International Journal of Engineering and Science (IJES)
The International Journal of Engineering and Science (IJES)theijes
 

What's hot (17)

MOLECULARBIOLOGYSEMINAR
MOLECULARBIOLOGYSEMINARMOLECULARBIOLOGYSEMINAR
MOLECULARBIOLOGYSEMINAR
 
Dna extraction from blood and forensic samples
Dna extraction from blood and forensic samplesDna extraction from blood and forensic samples
Dna extraction from blood and forensic samples
 
Personalized nanomedicine for the treatment of vascular hypertension
Personalized nanomedicine for the treatment of vascular hypertensionPersonalized nanomedicine for the treatment of vascular hypertension
Personalized nanomedicine for the treatment of vascular hypertension
 
DNA- Basics on isolation, quantification, storage
DNA- Basics on isolation, quantification, storageDNA- Basics on isolation, quantification, storage
DNA- Basics on isolation, quantification, storage
 
Dna isolation
Dna isolationDna isolation
Dna isolation
 
Techniques of DNA Extraction, Purification and Quantification
Techniques of DNA Extraction, Purification and QuantificationTechniques of DNA Extraction, Purification and Quantification
Techniques of DNA Extraction, Purification and Quantification
 
Sub1559
Sub1559Sub1559
Sub1559
 
Dna quantification
Dna quantificationDna quantification
Dna quantification
 
Isolation & Purification of DNA
Isolation & Purification of  DNAIsolation & Purification of  DNA
Isolation & Purification of DNA
 
DNA Barcoding of Stone Fish Uranoscopus Oligolepis: Intra Species Delineation...
DNA Barcoding of Stone Fish Uranoscopus Oligolepis: Intra Species Delineation...DNA Barcoding of Stone Fish Uranoscopus Oligolepis: Intra Species Delineation...
DNA Barcoding of Stone Fish Uranoscopus Oligolepis: Intra Species Delineation...
 
H A N D O U T B I U1102 15 12 09
H A N D O U T  B I U1102 15 12 09H A N D O U T  B I U1102 15 12 09
H A N D O U T B I U1102 15 12 09
 
Publication
PublicationPublication
Publication
 
Final Project (Final Version)
Final Project (Final Version)Final Project (Final Version)
Final Project (Final Version)
 
DNA isolation
DNA  isolationDNA  isolation
DNA isolation
 
Production of gold nanoparticles by Streptomyces djakartensis isolate B-5
Production of gold nanoparticles by Streptomyces djakartensis isolate B-5Production of gold nanoparticles by Streptomyces djakartensis isolate B-5
Production of gold nanoparticles by Streptomyces djakartensis isolate B-5
 
Plant dna extraction method
Plant dna extraction methodPlant dna extraction method
Plant dna extraction method
 
The International Journal of Engineering and Science (IJES)
The International Journal of Engineering and Science (IJES)The International Journal of Engineering and Science (IJES)
The International Journal of Engineering and Science (IJES)
 

Similar to Nuclic acid analysis in nematode systematic

Genetic mapping and sequencing
Genetic mapping and sequencingGenetic mapping and sequencing
Genetic mapping and sequencingAamna Tabassum
 
Dna finger printing
Dna finger printingDna finger printing
Dna finger printingAFSATH
 
Molecular markers - EASY!!
Molecular markers - EASY!!Molecular markers - EASY!!
Molecular markers - EASY!!Shovan Das
 
Dna based tools in fish identification
Dna based tools in fish identificationDna based tools in fish identification
Dna based tools in fish identificationDEVIKA ANTHARJANAM
 
DNA Fingerprinting & its techniques by Shiv Kalia (M.Pharma in Analytical Che...
DNA Fingerprinting & its techniques by Shiv Kalia (M.Pharma in Analytical Che...DNA Fingerprinting & its techniques by Shiv Kalia (M.Pharma in Analytical Che...
DNA Fingerprinting & its techniques by Shiv Kalia (M.Pharma in Analytical Che...Shiv Kalia
 
Molecular markers used in biotechnology
Molecular markers used in biotechnology Molecular markers used in biotechnology
Molecular markers used in biotechnology sana sana
 
Role of molecular markers in vegetable crops
Role of molecular markers in vegetable cropsRole of molecular markers in vegetable crops
Role of molecular markers in vegetable cropsvanisree Padmanabhan
 
Random Amplified polymorphic DNA. RAPD
Random Amplified polymorphic DNA. RAPDRandom Amplified polymorphic DNA. RAPD
Random Amplified polymorphic DNA. RAPDUniversity of Mumbai
 
Marker and marker assisted breeding in flower crops
Marker and marker assisted breeding in flower crops Marker and marker assisted breeding in flower crops
Marker and marker assisted breeding in flower crops Tabinda Wani
 
using molecular marker technology in studying genetic diversity
using molecular marker technology in studying genetic diversity using molecular marker technology in studying genetic diversity
using molecular marker technology in studying genetic diversity salmasaud8892
 

Similar to Nuclic acid analysis in nematode systematic (20)

Genetic mapping and sequencing
Genetic mapping and sequencingGenetic mapping and sequencing
Genetic mapping and sequencing
 
Dna finger printing
Dna finger printingDna finger printing
Dna finger printing
 
Molecular markers
Molecular markersMolecular markers
Molecular markers
 
Molecular markers - EASY!!
Molecular markers - EASY!!Molecular markers - EASY!!
Molecular markers - EASY!!
 
RAPD
RAPDRAPD
RAPD
 
Dna based tools in fish identification
Dna based tools in fish identificationDna based tools in fish identification
Dna based tools in fish identification
 
DNA Fingerprinting & its techniques by Shiv Kalia (M.Pharma in Analytical Che...
DNA Fingerprinting & its techniques by Shiv Kalia (M.Pharma in Analytical Che...DNA Fingerprinting & its techniques by Shiv Kalia (M.Pharma in Analytical Che...
DNA Fingerprinting & its techniques by Shiv Kalia (M.Pharma in Analytical Che...
 
DNA FINGERPRINTING TECHNIQUE FOR IDENTIFICATION OF DRUGS OF NATURAL ORIGIN AN...
DNA FINGERPRINTING TECHNIQUE FOR IDENTIFICATION OF DRUGS OF NATURAL ORIGIN AN...DNA FINGERPRINTING TECHNIQUE FOR IDENTIFICATION OF DRUGS OF NATURAL ORIGIN AN...
DNA FINGERPRINTING TECHNIQUE FOR IDENTIFICATION OF DRUGS OF NATURAL ORIGIN AN...
 
Molecular markers used in biotechnology
Molecular markers used in biotechnology Molecular markers used in biotechnology
Molecular markers used in biotechnology
 
Marcadores.ppt
Marcadores.pptMarcadores.ppt
Marcadores.ppt
 
Role of molecular markers in vegetable crops
Role of molecular markers in vegetable cropsRole of molecular markers in vegetable crops
Role of molecular markers in vegetable crops
 
RFLP.pdf
RFLP.pdfRFLP.pdf
RFLP.pdf
 
Random Amplified polymorphic DNA. RAPD
Random Amplified polymorphic DNA. RAPDRandom Amplified polymorphic DNA. RAPD
Random Amplified polymorphic DNA. RAPD
 
Marker and marker assisted breeding in flower crops
Marker and marker assisted breeding in flower crops Marker and marker assisted breeding in flower crops
Marker and marker assisted breeding in flower crops
 
using molecular marker technology in studying genetic diversity
using molecular marker technology in studying genetic diversity using molecular marker technology in studying genetic diversity
using molecular marker technology in studying genetic diversity
 
Blotting techniques ppt
Blotting techniques pptBlotting techniques ppt
Blotting techniques ppt
 
REVERSE GENETICS
REVERSE GENETICSREVERSE GENETICS
REVERSE GENETICS
 
Non-PCR-based Molecular Methods
Non-PCR-based Molecular MethodsNon-PCR-based Molecular Methods
Non-PCR-based Molecular Methods
 
Molecular taxonomy
Molecular taxonomyMolecular taxonomy
Molecular taxonomy
 
Blotting techniques
Blotting techniquesBlotting techniques
Blotting techniques
 

Recently uploaded

Panet vs.Plastics - Earth Day 2024 - 22 APRIL
Panet vs.Plastics - Earth Day 2024 - 22 APRILPanet vs.Plastics - Earth Day 2024 - 22 APRIL
Panet vs.Plastics - Earth Day 2024 - 22 APRILChristina Parmionova
 
VIP Mumbai Call Girls Andheri West Just Call 9920874524 with A/C Room Cash on...
VIP Mumbai Call Girls Andheri West Just Call 9920874524 with A/C Room Cash on...VIP Mumbai Call Girls Andheri West Just Call 9920874524 with A/C Room Cash on...
VIP Mumbai Call Girls Andheri West Just Call 9920874524 with A/C Room Cash on...Garima Khatri
 
2024: The FAR, Federal Acquisition Regulations - Part 27
2024: The FAR, Federal Acquisition Regulations - Part 272024: The FAR, Federal Acquisition Regulations - Part 27
2024: The FAR, Federal Acquisition Regulations - Part 27JSchaus & Associates
 
(SUHANI) Call Girls Pimple Saudagar ( 7001035870 ) HI-Fi Pune Escorts Service
(SUHANI) Call Girls Pimple Saudagar ( 7001035870 ) HI-Fi Pune Escorts Service(SUHANI) Call Girls Pimple Saudagar ( 7001035870 ) HI-Fi Pune Escorts Service
(SUHANI) Call Girls Pimple Saudagar ( 7001035870 ) HI-Fi Pune Escorts Serviceranjana rawat
 
Take action for a healthier planet and brighter future.
Take action for a healthier planet and brighter future.Take action for a healthier planet and brighter future.
Take action for a healthier planet and brighter future.Christina Parmionova
 
How the Congressional Budget Office Assists Lawmakers
How the Congressional Budget Office Assists LawmakersHow the Congressional Budget Office Assists Lawmakers
How the Congressional Budget Office Assists LawmakersCongressional Budget Office
 
Call Girls Service Race Course Road Just Call 7001305949 Enjoy College Girls ...
Call Girls Service Race Course Road Just Call 7001305949 Enjoy College Girls ...Call Girls Service Race Course Road Just Call 7001305949 Enjoy College Girls ...
Call Girls Service Race Course Road Just Call 7001305949 Enjoy College Girls ...narwatsonia7
 
Action Toolkit - Earth Day 2024 - April 22nd.
Action Toolkit - Earth Day 2024 - April 22nd.Action Toolkit - Earth Day 2024 - April 22nd.
Action Toolkit - Earth Day 2024 - April 22nd.Christina Parmionova
 
history of 1935 philippine constitution.pptx
history of 1935 philippine constitution.pptxhistory of 1935 philippine constitution.pptx
history of 1935 philippine constitution.pptxhellokittymaearciaga
 
Cunningham Road Call Girls Bangalore WhatsApp 8250192130 High Profile Service
Cunningham Road Call Girls Bangalore WhatsApp 8250192130 High Profile ServiceCunningham Road Call Girls Bangalore WhatsApp 8250192130 High Profile Service
Cunningham Road Call Girls Bangalore WhatsApp 8250192130 High Profile ServiceHigh Profile Call Girls
 
YHR Fall 2023 Issue (Joseph Manning Interview) (2).pdf
YHR Fall 2023 Issue (Joseph Manning Interview) (2).pdfYHR Fall 2023 Issue (Joseph Manning Interview) (2).pdf
YHR Fall 2023 Issue (Joseph Manning Interview) (2).pdfyalehistoricalreview
 
(PRIYA) Call Girls Rajgurunagar ( 7001035870 ) HI-Fi Pune Escorts Service
(PRIYA) Call Girls Rajgurunagar ( 7001035870 ) HI-Fi Pune Escorts Service(PRIYA) Call Girls Rajgurunagar ( 7001035870 ) HI-Fi Pune Escorts Service
(PRIYA) Call Girls Rajgurunagar ( 7001035870 ) HI-Fi Pune Escorts Serviceranjana rawat
 
Russian Call Girl Hebbagodi ! 7001305949 ₹2999 Only and Free Hotel Delivery 2...
Russian Call Girl Hebbagodi ! 7001305949 ₹2999 Only and Free Hotel Delivery 2...Russian Call Girl Hebbagodi ! 7001305949 ₹2999 Only and Free Hotel Delivery 2...
Russian Call Girl Hebbagodi ! 7001305949 ₹2999 Only and Free Hotel Delivery 2...narwatsonia7
 
Artificial Intelligence in Philippine Local Governance: Challenges and Opport...
Artificial Intelligence in Philippine Local Governance: Challenges and Opport...Artificial Intelligence in Philippine Local Governance: Challenges and Opport...
Artificial Intelligence in Philippine Local Governance: Challenges and Opport...CedZabala
 
Goa Escorts WhatsApp Number South Goa Call Girl … 8588052666…
Goa Escorts WhatsApp Number South Goa Call Girl … 8588052666…Goa Escorts WhatsApp Number South Goa Call Girl … 8588052666…
Goa Escorts WhatsApp Number South Goa Call Girl … 8588052666…nishakur201
 
“Exploring the world: One page turn at a time.” World Book and Copyright Day ...
“Exploring the world: One page turn at a time.” World Book and Copyright Day ...“Exploring the world: One page turn at a time.” World Book and Copyright Day ...
“Exploring the world: One page turn at a time.” World Book and Copyright Day ...Christina Parmionova
 
Call Girls Connaught Place Delhi reach out to us at ☎ 9711199012
Call Girls Connaught Place Delhi reach out to us at ☎ 9711199012Call Girls Connaught Place Delhi reach out to us at ☎ 9711199012
Call Girls Connaught Place Delhi reach out to us at ☎ 9711199012rehmti665
 
Call Girls Bangalore Saanvi 7001305949 Independent Escort Service Bangalore
Call Girls Bangalore Saanvi 7001305949 Independent Escort Service BangaloreCall Girls Bangalore Saanvi 7001305949 Independent Escort Service Bangalore
Call Girls Bangalore Saanvi 7001305949 Independent Escort Service Bangalorenarwatsonia7
 
EDUROOT SME_ Performance upto March-2024.pptx
EDUROOT SME_ Performance upto March-2024.pptxEDUROOT SME_ Performance upto March-2024.pptx
EDUROOT SME_ Performance upto March-2024.pptxaaryamanorathofficia
 

Recently uploaded (20)

Panet vs.Plastics - Earth Day 2024 - 22 APRIL
Panet vs.Plastics - Earth Day 2024 - 22 APRILPanet vs.Plastics - Earth Day 2024 - 22 APRIL
Panet vs.Plastics - Earth Day 2024 - 22 APRIL
 
VIP Mumbai Call Girls Andheri West Just Call 9920874524 with A/C Room Cash on...
VIP Mumbai Call Girls Andheri West Just Call 9920874524 with A/C Room Cash on...VIP Mumbai Call Girls Andheri West Just Call 9920874524 with A/C Room Cash on...
VIP Mumbai Call Girls Andheri West Just Call 9920874524 with A/C Room Cash on...
 
2024: The FAR, Federal Acquisition Regulations - Part 27
2024: The FAR, Federal Acquisition Regulations - Part 272024: The FAR, Federal Acquisition Regulations - Part 27
2024: The FAR, Federal Acquisition Regulations - Part 27
 
(SUHANI) Call Girls Pimple Saudagar ( 7001035870 ) HI-Fi Pune Escorts Service
(SUHANI) Call Girls Pimple Saudagar ( 7001035870 ) HI-Fi Pune Escorts Service(SUHANI) Call Girls Pimple Saudagar ( 7001035870 ) HI-Fi Pune Escorts Service
(SUHANI) Call Girls Pimple Saudagar ( 7001035870 ) HI-Fi Pune Escorts Service
 
Take action for a healthier planet and brighter future.
Take action for a healthier planet and brighter future.Take action for a healthier planet and brighter future.
Take action for a healthier planet and brighter future.
 
How the Congressional Budget Office Assists Lawmakers
How the Congressional Budget Office Assists LawmakersHow the Congressional Budget Office Assists Lawmakers
How the Congressional Budget Office Assists Lawmakers
 
Call Girls Service Race Course Road Just Call 7001305949 Enjoy College Girls ...
Call Girls Service Race Course Road Just Call 7001305949 Enjoy College Girls ...Call Girls Service Race Course Road Just Call 7001305949 Enjoy College Girls ...
Call Girls Service Race Course Road Just Call 7001305949 Enjoy College Girls ...
 
Action Toolkit - Earth Day 2024 - April 22nd.
Action Toolkit - Earth Day 2024 - April 22nd.Action Toolkit - Earth Day 2024 - April 22nd.
Action Toolkit - Earth Day 2024 - April 22nd.
 
history of 1935 philippine constitution.pptx
history of 1935 philippine constitution.pptxhistory of 1935 philippine constitution.pptx
history of 1935 philippine constitution.pptx
 
Cunningham Road Call Girls Bangalore WhatsApp 8250192130 High Profile Service
Cunningham Road Call Girls Bangalore WhatsApp 8250192130 High Profile ServiceCunningham Road Call Girls Bangalore WhatsApp 8250192130 High Profile Service
Cunningham Road Call Girls Bangalore WhatsApp 8250192130 High Profile Service
 
YHR Fall 2023 Issue (Joseph Manning Interview) (2).pdf
YHR Fall 2023 Issue (Joseph Manning Interview) (2).pdfYHR Fall 2023 Issue (Joseph Manning Interview) (2).pdf
YHR Fall 2023 Issue (Joseph Manning Interview) (2).pdf
 
(PRIYA) Call Girls Rajgurunagar ( 7001035870 ) HI-Fi Pune Escorts Service
(PRIYA) Call Girls Rajgurunagar ( 7001035870 ) HI-Fi Pune Escorts Service(PRIYA) Call Girls Rajgurunagar ( 7001035870 ) HI-Fi Pune Escorts Service
(PRIYA) Call Girls Rajgurunagar ( 7001035870 ) HI-Fi Pune Escorts Service
 
Russian Call Girl Hebbagodi ! 7001305949 ₹2999 Only and Free Hotel Delivery 2...
Russian Call Girl Hebbagodi ! 7001305949 ₹2999 Only and Free Hotel Delivery 2...Russian Call Girl Hebbagodi ! 7001305949 ₹2999 Only and Free Hotel Delivery 2...
Russian Call Girl Hebbagodi ! 7001305949 ₹2999 Only and Free Hotel Delivery 2...
 
Artificial Intelligence in Philippine Local Governance: Challenges and Opport...
Artificial Intelligence in Philippine Local Governance: Challenges and Opport...Artificial Intelligence in Philippine Local Governance: Challenges and Opport...
Artificial Intelligence in Philippine Local Governance: Challenges and Opport...
 
Goa Escorts WhatsApp Number South Goa Call Girl … 8588052666…
Goa Escorts WhatsApp Number South Goa Call Girl … 8588052666…Goa Escorts WhatsApp Number South Goa Call Girl … 8588052666…
Goa Escorts WhatsApp Number South Goa Call Girl … 8588052666…
 
“Exploring the world: One page turn at a time.” World Book and Copyright Day ...
“Exploring the world: One page turn at a time.” World Book and Copyright Day ...“Exploring the world: One page turn at a time.” World Book and Copyright Day ...
“Exploring the world: One page turn at a time.” World Book and Copyright Day ...
 
Call Girls Connaught Place Delhi reach out to us at ☎ 9711199012
Call Girls Connaught Place Delhi reach out to us at ☎ 9711199012Call Girls Connaught Place Delhi reach out to us at ☎ 9711199012
Call Girls Connaught Place Delhi reach out to us at ☎ 9711199012
 
Hot Sexy call girls in Palam Vihar🔝 9953056974 🔝 escort Service
Hot Sexy call girls in Palam Vihar🔝 9953056974 🔝 escort ServiceHot Sexy call girls in Palam Vihar🔝 9953056974 🔝 escort Service
Hot Sexy call girls in Palam Vihar🔝 9953056974 🔝 escort Service
 
Call Girls Bangalore Saanvi 7001305949 Independent Escort Service Bangalore
Call Girls Bangalore Saanvi 7001305949 Independent Escort Service BangaloreCall Girls Bangalore Saanvi 7001305949 Independent Escort Service Bangalore
Call Girls Bangalore Saanvi 7001305949 Independent Escort Service Bangalore
 
EDUROOT SME_ Performance upto March-2024.pptx
EDUROOT SME_ Performance upto March-2024.pptxEDUROOT SME_ Performance upto March-2024.pptx
EDUROOT SME_ Performance upto March-2024.pptx
 

Nuclic acid analysis in nematode systematic

  • 1. .
  • 2. CREDIT SEMINAR NUCLEIC ACID ANALYSIS IN NEMATODE SYSTEMATICS Presented By: Mahnur Ali A.A.U. Deptt. of Nematology.
  • 3. Introduction Pathway to Molecular Diagnostics Molecular identification & Morphological identification Steps involve in nucleic acid analysis Extraction, Quantification, Amplification, Separation, Analysis and interpretation Utilization of different molecular techniques for nematode systematic Summary .
  • 4. INTRODUCTION  Due to release of various metabolites by different (host & non-host) crops and environmental effects there may be change in the morphological characteristic of nematodes. To reveal the actual variation and true identification, nucleic acid analysis is important. Variation present in nucleotide sequence cannot be observe under microscope.
  • 5. . NUCLEIC ACIDS DNA RNA Genome sizes Caenorhabditis elegens = 100 MB Meloidogyne incognita = 82 MB Meloidogyne hapla = 54 MB •Nucleic acids are polymers •Nucleotides are monomers Nitrogenous bases -Purines -Pyrimidine Sugar -Ribose -Deoxyribose Phosphates + Nucleoside=Nucleotides Nucleosides
  • 6. . . Pathway to Molecular Diagnostics 1865 – G. Mendel, Law of Heredity 1866 –Johann Miescher, , Purification of DNA 1953 – Watson and Crick, Structure of DNA 1977 – DNA sequencing 1985 – Kary Mullis, in vitro Amplification of DNA (PCR) 1998 – C. elegans the first multi- cellular organism sequenced
  • 7. Why Molecular Identification ? . Morphological Identification Molecular Identification Set-up cost Low High Long-term cost High Low Employee requirement Highly trained, experienced Minimal training Length of process Slower More rapid Morphological characters Variable NA Females required Yes No Mixed species populations Difficult to distinguish No
  • 8. STEPS INVOLVE IN NUCLEIC ACID ANALYSIS Extraction and isolation of DNA Quantification Amplification by PCR Techniques used Analysis and & interpretation
  • 9. Extraction of DNA from Nematodes . Single nematode Entire communityMultiple nematode (~25) Extraction from soil
  • 10. Extraction of DNA from Nematodes Single/Multiple Nematodes Nematode Community Nematodes in Soil Cut nematodes with scalpel to disrupt cuticle Use a bead beater to disrupt nematode cuticle Kit that contains beads (Powersoil, Powermax) Use Nematode Extraction Buffer which includes Proteinase K Use Nematode Extraction Buffer which includes Proteinase K Place soil directly in tube Cooling and heating steps required Cooling and heating steps required Follow recipe
  • 11. AMPLIFICATION BY PCR 5’ 3’ 3’ 5’ Target 1. Denature 2. Anneal primers 3. Extend primers Two copies of target 1. Denature 2. Anneal primers 3. Extend primers Four copies of target
  • 13. 1.Restriction Fragment Analysis • This technique uses restriction enzymes to cleave DNA at specific sites along the DNA molecule. • Enzyme will digest DNA at specific sequence to generate fragments of DNA • Fragments are separated through gel electrophoresis. • The banding patterns are visualized under florescent stain (ethidium bromid) or by autoradiography.
  • 14. Techniques involved in Restriction Fragment Analysis 1. RFLP ( Restriction Fragment Length Polymorphism ) 2. RAPD ( Random Amplified Polymorphic DNA ) 3. AFLP ( Amplified Fragment Length Polymorphism ) RFLPs involves fragmenting a sample of DNA by a restriction enzyme, which can recognize and cut DNA wherever a specific short sequence occurs. A RFLP occurs when the length of a detected fragment varies between individuals.  PCR based product but the segments of DNA that are amplified are random we can amplify restricted fragments and reduces the complexity of material to be analyzed (approx 1000 folds). it can be used for comparison between closely related species only. 1 32
  • 15. Enzyme Site Recognition in RFLP . Restriction site Palindrome Fragment 1 Fragment 2 • enzyme will digests (cuts) DNA at a specific sequence = restriction site • Enzymes recognize 4- or 6- base pair, palindromic sequences (e.g. GAATTC)
  • 16. . Power Supply Agarose gel Electrophoresis  Electrical current carries negatively- charged DNA through gel towards positive (red) electrode.  Small fragments move faster than large fragments . Gel running
  • 17. . . Utilisation of different techniques for Restriction Fragment Analysis Method use limitations Application example 1. RFLP -Suited to differentiate between closely related taxa based on presence/ absence of restriction fragment bands -Lacks homology of characters - Requires large amounts of PCR products to use for different restriction enzymes -Detection of population within Steinernema spp. (Curran et al. 1985, (Oliveira et al., 2006; Barsi et al., 2008). 2.AFLP -Suited to assess variation among individuals of the same species -Lengthy procedure -Detection of species in Heterodera avenae group (Subbotin et al., 1999),.study of intra specific variation in Radopholus similes (Elbadri et al., 2002). 3.RAPD - Unlike AFLP this method doesn’t require a restriction step - Simple and rapid - Sensitive to variations in primer and DNA concentration -Detection of Globodera rostochiensis,G. pallida, Meloidogyne incognita, M. javanica, and M. arenaria. (Fullaondo et al., 1999; Zijlstra et al. 2000)
  • 19. Extracted DNA .. DNA Samples Separated strands allow to Cool or ( re-anneal ) Heated Low Tm=not closely related High Tm= closely related 0% homology 100% homology M. hapla from M. arenaria , M. incognita M. Javanica (C. Sereno, 2006 )
  • 20. Process of determining precise order of nucleotides within a DNA molecule. Sequencing is done NUCLEOTIDE SEQUENCING  To confirm the identity of genes isolated by hybridization or amplified PCR.  For determine the DNA sequence of promoters and other regulatory sequence.  Reveal the fine structure of genes and other DNA.  To confirm the sequence of cDNA .  To identify mutation.
  • 21. METHOD  Principle- Use of dideoxynucleotide triphosphate (ddNTP’s) as DNA chain terminator. Method requires :- 1. Single stranded DNA template. 2. DNA primer. 3. DNA polymerase. 4. Normal dideoxynucleotide phosphates (dNTP’s ). 5. Modified nucleotides (ddNTP’s) that terminate DNA strand elongation. Chain-termination method(Sanger method). F. Sanger in 1977By
  • 22. . Complementary strand Template strand3’ 3’5’ 5’ primer 5’3’ 1. DNA polymerase 2. dNTP’s 3. ddNTP’s + Dideoxy ATP + Dideoxy TTP + Dideoxy CTP + Dideoxy GTP DNA strand
  • 23. . 1 2 3 4 3’ 5’ T G G T A C G Position of nucleotides from 5’ to 3’
  • 24. . Method Use Limitations Application example DNA Sequencing Variation in primer and DNA concentration, DNA template quality, gel electrophoresis, and the type of DNA polymerase) can be controlled and the sequencing step can be optimized. - Fast and accurate Difficult in finding an ideal gene for phylogenetic inference , that works in all nematode groups. Choice of marker is still an open issue. Used in case of family Hoplolaimidae, (Subbotin et al., 2007), order Tylenchida (Subbotin et al., 2006), suborder Criconematina (Subbotin et al., 2005), suborder Cephalobina (Nadler et al.,2006) , .
  • 25. . , M. arenaria TCGGCGATAGAGGTAAATGAC TCGAGGGCATCTAATAAAGG 420 bp 950bp Zijlstra et al., 2000 Dong et al., 2001 M. chitwoodi CCAATGATAGAGATAGGAAC GATCTATGGCAGATGGTATGGA TGGAGAGCAGCAGGAGAAAGA 400 bp 900 bp 800 bp Williamson et al., 1997 Petersen et al., 1997 Zijlstra, 2000 M. exigua CATCCGTGCTGTAGCTGCGAG CTCCGTGGGAAGAAAGACTG 562 bp Randig et al., 2002 M. hapla CAGGCCCTTCCAGCTAAAGA TGACGGCGGTGAGTGCGA GGCTGAGCATAGTAGATGATGTT GGATGGCGTGCTTTCAAC 960 bp 610 bp 1500 bp 440 bp Williamson et al., 1997 Zijlstra, 2000 Dong et al., 2001bp Wishart et al., 2002 M. incognita CTCTGCCCAATGAGCTGTCC TAGGCAGTAGGTTGTCGGG GGGATGTGTAAATGCTCCTG GTGAGGATTCAGCTCCCCAG 1200 bp 1350 bp 399 bp 955 bp Zijlstra et al., 2000 Dong et al., 2001 Randig et al., 2002 Meng et al., 2004 M. javanica CCTTAATGTCAACACTAGAGCC GGTGCGCGATTGAACTGAGC ACGCTAGAATTCGACCCTGG 1650 bp 670 bp 519 bp Dong et al., 2001b Zijlstra et al., 2000 Meng et al., 2004 M. mayaguensis GAAATTGCTTTATTGTTACTAAG 322 bp Blok et al., 2002 M. naasi CTCTTTATGGAGAATAATCGT 433 bp Zijlstra et al., 2004 M. paranaensis GCCCGACTCCATTTGACGGA 208 bp Randig et al., 2002 Species Primer set ( 5’-3’ ) Amplicon length Reference
  • 26. SUMMARY Molecular techniques in the field of biology has helped us to get the accurate identification of nematode species and to detect the smallest variations within species and even within individual strains.  One can see the degree of relationship among different species of nematodes by hybridization technique.  Nucleotide sequencing methods are most informative in the study of systematic of nematode species. The data obtained from such studies are used to construct phylogenetic trees
  • 27.  Traditional methods are although important but molecular evidences could be final or confirmatory evidences. Gel electrophoresis can separate fragments of DNA on the basis of their sizes, base pair and form a useful method to characterize nematode species. By comparing the base sequences of nematode species, one can determine the exact number of mutational variations. .
  • 28. .