SlideShare a Scribd company logo
1 of 44
DNA and Genes
Things to find out:
• What is DNA?
• The Genetic Code
• The Human Genome
Diversity of Life
• All biological
systems are
composed of the
same types of
molecules
• Similar
organization
principles are used
at the cellular level
The Cell
• Basic component of
life
• Two main categories,
prokarytic and
eukaryotic cells
• Differences in the
nucleus
• Prokaryotes: no
defined nucleus and
a simplified internal
structure
• Eukaryotes:
membrane limited
nucleus and
complicated internal
structure
• Three branches of
life
• Genetic material is located in nucleus
• The genetic information is stored in
Deoxyribonucleic acid, DNA
• DNA contains the information needed to build
an individual
What is DNA needed for?
• Genetic information is
transferred from DNA and
converted to protein
•RNA molecules work as
messengers
•Proteins are the biological
workers
•Information of the DNA is copied to a RNA
molecule in transcription
•RNA directs the
protein synthesis in a
translation
•Protein’s 3D structure
determines it’s function
•Information transfer
only in one direction
DNA (Deoxyribo Nucleic Acid)
•a polymer of nucleotide monomers
•2’-deoxyribose sugar
•Four bases:
•Adenine, A
•Guanine, G
•Thymine, T
•Cytosine, C
Sugar part
Base part
Four bases...
Purine bases
• Adenine and
guanine
• Two carbon rings
Pyrimidine bases
• Thymine and
cytosine
• A single carbon
ring
DNA chains
• Nucleotides are
joined with
phosphodiesteri bond
• Sequence of bases
vary  genetic
information
• Extremely long
chains!
DNA Molecules
• Two polynucleotide
chains are joined
• Double helix,
twisted in right
handed way
• Full circle in every
10 bases
•”ladder-structure”
–Bases = steps
–Sugars and phosphates =
supporting pilars
•Two nucleotide chains
run in opposite directions
chemical direction
(5´-3´)
Complementary Pairing
• Bases pair with other bases
• Space between the chains is limited 
Purines with two carbon rings pair only with
single ring pyrimidines
A + T
G + C
• Complementary pairing is vital for the use and
storage of the genetic information!
•Interaction is stabilized by
hydrogen bonds
The Genetic Code
• Describes how nucleotide sequence is
converted to protein sequence
• Unit of three nucleotides = a codon
• A codon codes for a specific amino
acid (structural component of protein)
• The four bases can
form 64 different
codons
• 20 amino acids are
found from the
nature
• Regulatory codons
Frame 1
Met F P P S G S T G L I P P S H F Q A R P L S T L P R Met A P T W L S D I
P L V Q
Frame 2
C F H L Q V P L G Stop F P P P T F K L G P F Q L C Q E W L P P G S Q T F
P W S N
Frame 1
G L D Q G N V Stop E P G G S H S W Q S Stop K G P S L K V G G G N Q
P S G T Stop R W K H
•Right reading frame is obligatory!
•Part of the sequence from psoriasis associated gene HCR
• Three different reading frames can be used, but only one is the right one
•Translate tools are found from the internet
atgtttccac cttcaggttc cactgggctg attcccccct cccactttca agctcggccc
ctttcaactc tgccaagaat ggctcccacc tggctctcag acattcccct ggtccaaccc
The right one
DNA
chromatin
chromatin fibers
fibers connected to
chromosome scaffold
Condenced scaffold
Chromosome
Genes
• A gene: DNA sequence that is needed to encode
amino acid sequence of a protein
• Composed of exons, introns and different control
elements
• Exon – protein coding sequence
• Intron – intervening sequence
• Genes vary a lot in size:
Humans: average 3000bp
largest 2.4 million bp
•Genes are separated by sequences with
unknown function
•Only one strand of the DNA carries
biological information  template strand
•Potential to store biological information is
enormous
That’s all for this time!
The Human Genome and Inheritance
• 3 billion base pairs
• about 22 000 genes
• Only 2 % of the DNA encode proteins
• Genes include exons and introns
• Beside coding areas also additional secuences are found
• 50 % repeated sequences (”junk DNA”)
The Human genome...
The different types of sequences that make up
the total DNA of a human cell
• 23 chromosome pairs  46 chromosomes
• 44 autosomes, 2 sex chromosomes
• X and Y –chromosomes
• XX  female
• XY  Male
Chromosomes carrying
the same genes are
called homologous
Mutations
• Alterations in DNA sequence
• Some are part of normal DNA variation
• Caused by chemical and physiological agents
and errors in DNA replication
• Cells can repaire some mistakes
• If not repaired changes in DNA sequence
are made permanent by DNA replication
Point mutations:
Single base mutations:
1. Missense mutation: leads to
an amino acid change
2. Silent mutation: does not
change the amino acid
3. Nonsense mutation: causes
premature stop-codon
• Frameshift mutations:
insertion/deletion
dublication
translocation
Altered reading frame
 Severe impacts on protein structure
Passing on the genetic information:
• Information passed on in the sexual reproduction
• Needed for new characteristics to develop
• Offspring recieve genes by inheriting chromosomes
Two important terms...
Phenotype: The outlook of an organism
Genotype: The genetic information written in DNA
ATGTTTCCACCTTCAGGTTCC
ACTGGGCTGATTCCCCCCTC
C
CACTTTCAAGCTCGGCCCCT
T
TCAACTCAGAGAGGCGGCTA
GACACCCAGAGACCTCAAGT
GACCATGTGGGAACGGGATG
GCCAAGAATGGCTCCCACC
T
GGCTCTCAGACATTCCCCT
GGTCCAACCCCCAGGCCAT
CAAGATGTCTCAGAGAGGC
GGCTAGACACCCAGAGACC
TCAAGTGACCATGTGGGAA
CGGGATGTTTCCAGTGACA
GGCA
Genotype
Phenotypes
Genotype
All somatic cells
• 23 chromosome pairs
(46 chromosomes)
• Diploid cells, 2n
Sperm cell
• 23 chromosomes
• Haploid cell, n
Egg cell
• 23 chromosomes
• Haploid cell, n
Fertilization:
n n
+
Fertilized egg
• 2n
• 46 chromosomes
A chromosome pare:
• A locus
• An allele
Mitosis
• Division of somatic cells
• Products two daughter cells from
one parent cell
• The number of chromosomes
does not change
• DNA duplicates before entering
the mitosis
• Takes 1-2 hours
Meiosis
• Only in gamete formation
• One diploidic parent cell produces
four haploid gametosytes
• Mature gametocytes have 23
chromosomes (n)
• Chromatids change parts
between homologous chromatids
during the meiosis
• Causes redistribution of heridary
material between the homologous
chromosomes
 number of genes doesn’t
change
 new allele combinations
are formed
Crossing over:
Inherited diseases
• DNA mutations are significant in development of diseases
• Inherited diseases are caused by mutations passed from
a parent to a offspring
• Monogenic diseases: disease is caused by one mutation in
one gene
• Multifactiorial diseases: disease is caused by interaction
of different mutations and environmental factors
• Mendelian inheritance: Presence or absence of the
phenotype depends on the genotype at a single locus
• Dominant character: only one allele needed to cause the
phenotype (heterozygous)
• Recessive character: both allels needed to cause the
phenotype (homozygous)
Autosomal dominant inheritance:
Aa aa
Aa
Aa
aa
Autosomal recessive inheritance:
aa
aa
aa
Aa
Aa
Aa
AA
aa
Aa
X-chromosome linked recessive inheritance:
X-chromosome linked dominant inheritance:
DNA_and_inheritance.ppt

More Related Content

Similar to DNA_and_inheritance.ppt

cell biology class 17th N ovember mitochondria 2015.ppt
cell biology  class 17th N ovember mitochondria 2015.pptcell biology  class 17th N ovember mitochondria 2015.ppt
cell biology class 17th N ovember mitochondria 2015.ppt
subhashree533922
 
BIOINFORMATICS.ppt
BIOINFORMATICS.pptBIOINFORMATICS.ppt
BIOINFORMATICS.ppt
TSaiteja2
 
Introduction to Bioinformatics Molecular Biology Primer
Introduction to Bioinformatics Molecular Biology PrimerIntroduction to Bioinformatics Molecular Biology Primer
Introduction to Bioinformatics Molecular Biology Primer
vanessajoytimoteogar
 
Molecular basis of inheritance by mohanbio
Molecular basis of inheritance by mohanbioMolecular basis of inheritance by mohanbio
Molecular basis of inheritance by mohanbio
mohan bio
 
Unit 1 genetics nucleic acids dna
Unit 1 genetics nucleic acids dnaUnit 1 genetics nucleic acids dna
Unit 1 genetics nucleic acids dna
jane namane
 
Unit 1 genetics nucleic acids dna
Unit 1 genetics nucleic acids dnaUnit 1 genetics nucleic acids dna
Unit 1 genetics nucleic acids dna
Dudrah Moyo
 

Similar to DNA_and_inheritance.ppt (20)

eukaryotics.pptx
eukaryotics.pptxeukaryotics.pptx
eukaryotics.pptx
 
cell biology class 17th N ovember mitochondria 2015.ppt
cell biology  class 17th N ovember mitochondria 2015.pptcell biology  class 17th N ovember mitochondria 2015.ppt
cell biology class 17th N ovember mitochondria 2015.ppt
 
Recombinant DNA Technology
Recombinant DNA Technology Recombinant DNA Technology
Recombinant DNA Technology
 
Genomics and proteomics (Bioinformatics)
Genomics and proteomics (Bioinformatics)Genomics and proteomics (Bioinformatics)
Genomics and proteomics (Bioinformatics)
 
BIOINFORMATICS.ppt
BIOINFORMATICS.pptBIOINFORMATICS.ppt
BIOINFORMATICS.ppt
 
Introduction to Bioinformatics
Introduction to BioinformaticsIntroduction to Bioinformatics
Introduction to Bioinformatics
 
111 ch 15 online.pptx
111 ch 15 online.pptx111 ch 15 online.pptx
111 ch 15 online.pptx
 
Genetics of Mitochondria
Genetics of MitochondriaGenetics of Mitochondria
Genetics of Mitochondria
 
Cell division 2 DNA Replication
Cell division 2 DNA ReplicationCell division 2 DNA Replication
Cell division 2 DNA Replication
 
BioPrimer.ppt
BioPrimer.pptBioPrimer.ppt
BioPrimer.ppt
 
BioPrimer (1).ppt
BioPrimer (1).pptBioPrimer (1).ppt
BioPrimer (1).ppt
 
Introduction to Bioinformatics Molecular Biology Primer
Introduction to Bioinformatics Molecular Biology PrimerIntroduction to Bioinformatics Molecular Biology Primer
Introduction to Bioinformatics Molecular Biology Primer
 
Molecular basis of inheritance by mohanbio
Molecular basis of inheritance by mohanbioMolecular basis of inheritance by mohanbio
Molecular basis of inheritance by mohanbio
 
Introduction to Bioinformatics DNA, RNA, Transcriotion, Genes
Introduction to Bioinformatics DNA, RNA, Transcriotion, GenesIntroduction to Bioinformatics DNA, RNA, Transcriotion, Genes
Introduction to Bioinformatics DNA, RNA, Transcriotion, Genes
 
Unit 1 genetics nucleic acids dna
Unit 1 genetics nucleic acids dnaUnit 1 genetics nucleic acids dna
Unit 1 genetics nucleic acids dna
 
Unit 1 genetics nucleic acids dna
Unit 1 genetics nucleic acids dnaUnit 1 genetics nucleic acids dna
Unit 1 genetics nucleic acids dna
 
an introduction in molecular biology.ppt
an introduction in molecular biology.pptan introduction in molecular biology.ppt
an introduction in molecular biology.ppt
 
Introduction to molecular genetics -LM _1_ copy.pptx
Introduction to molecular genetics -LM _1_ copy.pptxIntroduction to molecular genetics -LM _1_ copy.pptx
Introduction to molecular genetics -LM _1_ copy.pptx
 
4c dna and protein
4c   dna and protein4c   dna and protein
4c dna and protein
 
Gene discovery
Gene discoveryGene discovery
Gene discovery
 

More from Sani191640 (20)

II & III. RR,CVS.ppt
II & III. RR,CVS.pptII & III. RR,CVS.ppt
II & III. RR,CVS.ppt
 
Drug book 2010.pdf
Drug book 2010.pdfDrug book 2010.pdf
Drug book 2010.pdf
 
Unit 1 Intro ss.pptx
Unit 1 Intro ss.pptxUnit 1 Intro ss.pptx
Unit 1 Intro ss.pptx
 
Acid base titration III [Compatibility Mode].pdf
Acid base titration III [Compatibility Mode].pdfAcid base titration III [Compatibility Mode].pdf
Acid base titration III [Compatibility Mode].pdf
 
10 Neurology.pdf
10 Neurology.pdf10 Neurology.pdf
10 Neurology.pdf
 
Seizure final.ppt
Seizure final.pptSeizure final.ppt
Seizure final.ppt
 
Chronic_Complications_of_Diabetes_Mellitus.pdf
Chronic_Complications_of_Diabetes_Mellitus.pdfChronic_Complications_of_Diabetes_Mellitus.pdf
Chronic_Complications_of_Diabetes_Mellitus.pdf
 
anemia.pptx
anemia.pptxanemia.pptx
anemia.pptx
 
7 Principles of pediatric pharmacotherapy.pptx
7 Principles of pediatric pharmacotherapy.pptx7 Principles of pediatric pharmacotherapy.pptx
7 Principles of pediatric pharmacotherapy.pptx
 
Abyou (pediatrics).pptx
Abyou (pediatrics).pptxAbyou (pediatrics).pptx
Abyou (pediatrics).pptx
 
Unit I. Introduction.pptx
Unit I. Introduction.pptxUnit I. Introduction.pptx
Unit I. Introduction.pptx
 
CVD.pptx
CVD.pptxCVD.pptx
CVD.pptx
 
Unit II. Respiratory system disorders.pptx
Unit II.  Respiratory system disorders.pptxUnit II.  Respiratory system disorders.pptx
Unit II. Respiratory system disorders.pptx
 
Unit I. Musculoskeletal disorders.pptx
Unit I. Musculoskeletal disorders.pptxUnit I. Musculoskeletal disorders.pptx
Unit I. Musculoskeletal disorders.pptx
 
DM.pdf
DM.pdfDM.pdf
DM.pdf
 
Pediatric nutrition.ppt
Pediatric nutrition.pptPediatric nutrition.ppt
Pediatric nutrition.ppt
 
2.1 Female pelvis.pptx
2.1 Female pelvis.pptx2.1 Female pelvis.pptx
2.1 Female pelvis.pptx
 
15. Rheumatoid Arthritis.pptx
15. Rheumatoid Arthritis.pptx15. Rheumatoid Arthritis.pptx
15. Rheumatoid Arthritis.pptx
 
HF.pptx
HF.pptxHF.pptx
HF.pptx
 
16 Gout.pptx
16 Gout.pptx16 Gout.pptx
16 Gout.pptx
 

Recently uploaded

Call Girl In Pune 👉 Just CALL ME: 9352988975 💋 Call Out Call Both With High p...
Call Girl In Pune 👉 Just CALL ME: 9352988975 💋 Call Out Call Both With High p...Call Girl In Pune 👉 Just CALL ME: 9352988975 💋 Call Out Call Both With High p...
Call Girl In Pune 👉 Just CALL ME: 9352988975 💋 Call Out Call Both With High p...
chetankumar9855
 
🌹Attapur⬅️ Vip Call Girls Hyderabad 📱9352852248 Book Well Trand Call Girls In...
🌹Attapur⬅️ Vip Call Girls Hyderabad 📱9352852248 Book Well Trand Call Girls In...🌹Attapur⬅️ Vip Call Girls Hyderabad 📱9352852248 Book Well Trand Call Girls In...
🌹Attapur⬅️ Vip Call Girls Hyderabad 📱9352852248 Book Well Trand Call Girls In...
Call Girls In Delhi Whatsup 9873940964 Enjoy Unlimited Pleasure
 

Recently uploaded (20)

Russian Call Girls Service Jaipur {8445551418} ❤️PALLAVI VIP Jaipur Call Gir...
Russian Call Girls Service  Jaipur {8445551418} ❤️PALLAVI VIP Jaipur Call Gir...Russian Call Girls Service  Jaipur {8445551418} ❤️PALLAVI VIP Jaipur Call Gir...
Russian Call Girls Service Jaipur {8445551418} ❤️PALLAVI VIP Jaipur Call Gir...
 
Pondicherry Call Girls Book Now 9630942363 Top Class Pondicherry Escort Servi...
Pondicherry Call Girls Book Now 9630942363 Top Class Pondicherry Escort Servi...Pondicherry Call Girls Book Now 9630942363 Top Class Pondicherry Escort Servi...
Pondicherry Call Girls Book Now 9630942363 Top Class Pondicherry Escort Servi...
 
Top Rated Bangalore Call Girls Richmond Circle ⟟ 9332606886 ⟟ Call Me For Ge...
Top Rated Bangalore Call Girls Richmond Circle ⟟  9332606886 ⟟ Call Me For Ge...Top Rated Bangalore Call Girls Richmond Circle ⟟  9332606886 ⟟ Call Me For Ge...
Top Rated Bangalore Call Girls Richmond Circle ⟟ 9332606886 ⟟ Call Me For Ge...
 
Top Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any Time
Top Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any TimeTop Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any Time
Top Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any Time
 
Premium Bangalore Call Girls Jigani Dail 6378878445 Escort Service For Hot Ma...
Premium Bangalore Call Girls Jigani Dail 6378878445 Escort Service For Hot Ma...Premium Bangalore Call Girls Jigani Dail 6378878445 Escort Service For Hot Ma...
Premium Bangalore Call Girls Jigani Dail 6378878445 Escort Service For Hot Ma...
 
Call Girls Ahmedabad Just Call 9630942363 Top Class Call Girl Service Available
Call Girls Ahmedabad Just Call 9630942363 Top Class Call Girl Service AvailableCall Girls Ahmedabad Just Call 9630942363 Top Class Call Girl Service Available
Call Girls Ahmedabad Just Call 9630942363 Top Class Call Girl Service Available
 
Call Girls Kurnool Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Kurnool Just Call 8250077686 Top Class Call Girl Service AvailableCall Girls Kurnool Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Kurnool Just Call 8250077686 Top Class Call Girl Service Available
 
Model Call Girls In Chennai WhatsApp Booking 7427069034 call girl service 24 ...
Model Call Girls In Chennai WhatsApp Booking 7427069034 call girl service 24 ...Model Call Girls In Chennai WhatsApp Booking 7427069034 call girl service 24 ...
Model Call Girls In Chennai WhatsApp Booking 7427069034 call girl service 24 ...
 
Manyata Tech Park ( Call Girls ) Bangalore ✔ 6297143586 ✔ Hot Model With Sexy...
Manyata Tech Park ( Call Girls ) Bangalore ✔ 6297143586 ✔ Hot Model With Sexy...Manyata Tech Park ( Call Girls ) Bangalore ✔ 6297143586 ✔ Hot Model With Sexy...
Manyata Tech Park ( Call Girls ) Bangalore ✔ 6297143586 ✔ Hot Model With Sexy...
 
Call Girl In Pune 👉 Just CALL ME: 9352988975 💋 Call Out Call Both With High p...
Call Girl In Pune 👉 Just CALL ME: 9352988975 💋 Call Out Call Both With High p...Call Girl In Pune 👉 Just CALL ME: 9352988975 💋 Call Out Call Both With High p...
Call Girl In Pune 👉 Just CALL ME: 9352988975 💋 Call Out Call Both With High p...
 
Call Girls Shimla Just Call 8617370543 Top Class Call Girl Service Available
Call Girls Shimla Just Call 8617370543 Top Class Call Girl Service AvailableCall Girls Shimla Just Call 8617370543 Top Class Call Girl Service Available
Call Girls Shimla Just Call 8617370543 Top Class Call Girl Service Available
 
VIP Hyderabad Call Girls Bahadurpally 7877925207 ₹5000 To 25K With AC Room 💚😋
VIP Hyderabad Call Girls Bahadurpally 7877925207 ₹5000 To 25K With AC Room 💚😋VIP Hyderabad Call Girls Bahadurpally 7877925207 ₹5000 To 25K With AC Room 💚😋
VIP Hyderabad Call Girls Bahadurpally 7877925207 ₹5000 To 25K With AC Room 💚😋
 
The Most Attractive Hyderabad Call Girls Kothapet 𖠋 9332606886 𖠋 Will You Mis...
The Most Attractive Hyderabad Call Girls Kothapet 𖠋 9332606886 𖠋 Will You Mis...The Most Attractive Hyderabad Call Girls Kothapet 𖠋 9332606886 𖠋 Will You Mis...
The Most Attractive Hyderabad Call Girls Kothapet 𖠋 9332606886 𖠋 Will You Mis...
 
Top Rated Bangalore Call Girls Mg Road ⟟ 9332606886 ⟟ Call Me For Genuine S...
Top Rated Bangalore Call Girls Mg Road ⟟   9332606886 ⟟ Call Me For Genuine S...Top Rated Bangalore Call Girls Mg Road ⟟   9332606886 ⟟ Call Me For Genuine S...
Top Rated Bangalore Call Girls Mg Road ⟟ 9332606886 ⟟ Call Me For Genuine S...
 
🌹Attapur⬅️ Vip Call Girls Hyderabad 📱9352852248 Book Well Trand Call Girls In...
🌹Attapur⬅️ Vip Call Girls Hyderabad 📱9352852248 Book Well Trand Call Girls In...🌹Attapur⬅️ Vip Call Girls Hyderabad 📱9352852248 Book Well Trand Call Girls In...
🌹Attapur⬅️ Vip Call Girls Hyderabad 📱9352852248 Book Well Trand Call Girls In...
 
Top Rated Bangalore Call Girls Majestic ⟟ 9332606886 ⟟ Call Me For Genuine S...
Top Rated Bangalore Call Girls Majestic ⟟  9332606886 ⟟ Call Me For Genuine S...Top Rated Bangalore Call Girls Majestic ⟟  9332606886 ⟟ Call Me For Genuine S...
Top Rated Bangalore Call Girls Majestic ⟟ 9332606886 ⟟ Call Me For Genuine S...
 
Top Rated Hyderabad Call Girls Chintal ⟟ 9332606886 ⟟ Call Me For Genuine Se...
Top Rated  Hyderabad Call Girls Chintal ⟟ 9332606886 ⟟ Call Me For Genuine Se...Top Rated  Hyderabad Call Girls Chintal ⟟ 9332606886 ⟟ Call Me For Genuine Se...
Top Rated Hyderabad Call Girls Chintal ⟟ 9332606886 ⟟ Call Me For Genuine Se...
 
VIP Service Call Girls Sindhi Colony 📳 7877925207 For 18+ VIP Call Girl At Th...
VIP Service Call Girls Sindhi Colony 📳 7877925207 For 18+ VIP Call Girl At Th...VIP Service Call Girls Sindhi Colony 📳 7877925207 For 18+ VIP Call Girl At Th...
VIP Service Call Girls Sindhi Colony 📳 7877925207 For 18+ VIP Call Girl At Th...
 
Most Beautiful Call Girl in Bangalore Contact on Whatsapp
Most Beautiful Call Girl in Bangalore Contact on WhatsappMost Beautiful Call Girl in Bangalore Contact on Whatsapp
Most Beautiful Call Girl in Bangalore Contact on Whatsapp
 
Call Girls in Delhi Triveni Complex Escort Service(🔝))/WhatsApp 97111⇛47426
Call Girls in Delhi Triveni Complex Escort Service(🔝))/WhatsApp 97111⇛47426Call Girls in Delhi Triveni Complex Escort Service(🔝))/WhatsApp 97111⇛47426
Call Girls in Delhi Triveni Complex Escort Service(🔝))/WhatsApp 97111⇛47426
 

DNA_and_inheritance.ppt

  • 2. Things to find out: • What is DNA? • The Genetic Code • The Human Genome
  • 3. Diversity of Life • All biological systems are composed of the same types of molecules • Similar organization principles are used at the cellular level
  • 4. The Cell • Basic component of life • Two main categories, prokarytic and eukaryotic cells • Differences in the nucleus
  • 5. • Prokaryotes: no defined nucleus and a simplified internal structure • Eukaryotes: membrane limited nucleus and complicated internal structure • Three branches of life
  • 6. • Genetic material is located in nucleus • The genetic information is stored in Deoxyribonucleic acid, DNA • DNA contains the information needed to build an individual
  • 7. What is DNA needed for? • Genetic information is transferred from DNA and converted to protein •RNA molecules work as messengers •Proteins are the biological workers
  • 8. •Information of the DNA is copied to a RNA molecule in transcription •RNA directs the protein synthesis in a translation •Protein’s 3D structure determines it’s function •Information transfer only in one direction
  • 9. DNA (Deoxyribo Nucleic Acid) •a polymer of nucleotide monomers •2’-deoxyribose sugar •Four bases: •Adenine, A •Guanine, G •Thymine, T •Cytosine, C Sugar part Base part
  • 10. Four bases... Purine bases • Adenine and guanine • Two carbon rings Pyrimidine bases • Thymine and cytosine • A single carbon ring
  • 11. DNA chains • Nucleotides are joined with phosphodiesteri bond • Sequence of bases vary  genetic information • Extremely long chains!
  • 12. DNA Molecules • Two polynucleotide chains are joined • Double helix, twisted in right handed way • Full circle in every 10 bases
  • 13. •”ladder-structure” –Bases = steps –Sugars and phosphates = supporting pilars •Two nucleotide chains run in opposite directions chemical direction (5´-3´)
  • 14. Complementary Pairing • Bases pair with other bases • Space between the chains is limited  Purines with two carbon rings pair only with single ring pyrimidines A + T G + C • Complementary pairing is vital for the use and storage of the genetic information! •Interaction is stabilized by hydrogen bonds
  • 15. The Genetic Code • Describes how nucleotide sequence is converted to protein sequence • Unit of three nucleotides = a codon • A codon codes for a specific amino acid (structural component of protein)
  • 16. • The four bases can form 64 different codons • 20 amino acids are found from the nature • Regulatory codons
  • 17. Frame 1 Met F P P S G S T G L I P P S H F Q A R P L S T L P R Met A P T W L S D I P L V Q Frame 2 C F H L Q V P L G Stop F P P P T F K L G P F Q L C Q E W L P P G S Q T F P W S N Frame 1 G L D Q G N V Stop E P G G S H S W Q S Stop K G P S L K V G G G N Q P S G T Stop R W K H •Right reading frame is obligatory! •Part of the sequence from psoriasis associated gene HCR • Three different reading frames can be used, but only one is the right one •Translate tools are found from the internet atgtttccac cttcaggttc cactgggctg attcccccct cccactttca agctcggccc ctttcaactc tgccaagaat ggctcccacc tggctctcag acattcccct ggtccaaccc The right one
  • 18. DNA chromatin chromatin fibers fibers connected to chromosome scaffold Condenced scaffold Chromosome
  • 19. Genes • A gene: DNA sequence that is needed to encode amino acid sequence of a protein • Composed of exons, introns and different control elements • Exon – protein coding sequence • Intron – intervening sequence
  • 20. • Genes vary a lot in size: Humans: average 3000bp largest 2.4 million bp •Genes are separated by sequences with unknown function •Only one strand of the DNA carries biological information  template strand •Potential to store biological information is enormous
  • 21. That’s all for this time!
  • 22. The Human Genome and Inheritance
  • 23. • 3 billion base pairs • about 22 000 genes • Only 2 % of the DNA encode proteins • Genes include exons and introns • Beside coding areas also additional secuences are found • 50 % repeated sequences (”junk DNA”) The Human genome... The different types of sequences that make up the total DNA of a human cell
  • 24. • 23 chromosome pairs  46 chromosomes • 44 autosomes, 2 sex chromosomes • X and Y –chromosomes • XX  female • XY  Male
  • 25. Chromosomes carrying the same genes are called homologous
  • 26. Mutations • Alterations in DNA sequence • Some are part of normal DNA variation • Caused by chemical and physiological agents and errors in DNA replication • Cells can repaire some mistakes • If not repaired changes in DNA sequence are made permanent by DNA replication
  • 27. Point mutations: Single base mutations: 1. Missense mutation: leads to an amino acid change 2. Silent mutation: does not change the amino acid 3. Nonsense mutation: causes premature stop-codon
  • 28. • Frameshift mutations: insertion/deletion dublication translocation Altered reading frame  Severe impacts on protein structure
  • 29. Passing on the genetic information: • Information passed on in the sexual reproduction • Needed for new characteristics to develop • Offspring recieve genes by inheriting chromosomes
  • 30. Two important terms... Phenotype: The outlook of an organism Genotype: The genetic information written in DNA ATGTTTCCACCTTCAGGTTCC ACTGGGCTGATTCCCCCCTC C CACTTTCAAGCTCGGCCCCT T TCAACTCAGAGAGGCGGCTA GACACCCAGAGACCTCAAGT GACCATGTGGGAACGGGATG GCCAAGAATGGCTCCCACC T GGCTCTCAGACATTCCCCT GGTCCAACCCCCAGGCCAT CAAGATGTCTCAGAGAGGC GGCTAGACACCCAGAGACC TCAAGTGACCATGTGGGAA CGGGATGTTTCCAGTGACA GGCA Genotype Phenotypes Genotype
  • 31. All somatic cells • 23 chromosome pairs (46 chromosomes) • Diploid cells, 2n Sperm cell • 23 chromosomes • Haploid cell, n Egg cell • 23 chromosomes • Haploid cell, n Fertilization: n n + Fertilized egg • 2n • 46 chromosomes
  • 32. A chromosome pare: • A locus • An allele
  • 33. Mitosis • Division of somatic cells • Products two daughter cells from one parent cell • The number of chromosomes does not change • DNA duplicates before entering the mitosis • Takes 1-2 hours
  • 34. Meiosis • Only in gamete formation • One diploidic parent cell produces four haploid gametosytes • Mature gametocytes have 23 chromosomes (n)
  • 35. • Chromatids change parts between homologous chromatids during the meiosis • Causes redistribution of heridary material between the homologous chromosomes  number of genes doesn’t change  new allele combinations are formed Crossing over:
  • 36.
  • 37. Inherited diseases • DNA mutations are significant in development of diseases • Inherited diseases are caused by mutations passed from a parent to a offspring • Monogenic diseases: disease is caused by one mutation in one gene • Multifactiorial diseases: disease is caused by interaction of different mutations and environmental factors • Mendelian inheritance: Presence or absence of the phenotype depends on the genotype at a single locus
  • 38. • Dominant character: only one allele needed to cause the phenotype (heterozygous) • Recessive character: both allels needed to cause the phenotype (homozygous)
  • 39.