Next Steps for Adolescent and Young Adult Oncology - Basic Biology-Melanoma
1. Next Steps for Adolescent
and Young Adult
Oncology
Basic Biology
September 16-17, 2013
2. BBWG Members
Cary Anders Charles Mullighan
Donald Blair Nita Seibel
Archie Bleyer Beverly Teicher
Lisa Boardman Magdalena Thurin
Brandon Hayes-Lattin James Tricoli
Javed Khan Cheryl Willman
Sivaani Kummar
Stephen Hunger
Melinda Merchant
4. AYA Survival Disparities
• Acute Lymphocytic Leukemia
– Children have an 80% cure rate
– Teenagers and young adults have a five year
survival rate of only 50%
• Ewing’s Sarcoma
– Five year survival rate
• <10 years old 70%
• 10-17 years old 60%
• >18 years old 44%
5. Explanation for this Phenomenon
• Low enrollment for this age group in clinical
trials
– 30-50% of child cancer patients participate
– 1-2% of AYA cancer patients participate
• Distinctive biology for these patients and their
tumors
– Developmental and hormonal differences
6. History
• NCI Progress Review Group report on AYA Cancers,
2006 (NCI and Lance Armstrong Foundation)
• NCI Adolescent and Young Adult Oncology (AYAO)
working group formed in 2006
• NCI/Lance Armstrong Foundation AYA Cancers
Workshop, June 9 and 10, 2009
• Publication of the AYA Workshop paper “Unique
Characteristics of Adolescent and Young Adult Acute
Lymphoblastic Leukemia, Breast Cancer, and Colon
Cancer” JNCI 103: 628-635, 2011
7. What is known about the incidence, outcome and
molecular characterization according to patient
age of CRC in the AYAO age group?
• Comprise 2-6% of total annual colorectal cancer (CRC)
cases
- Approximately 800 deaths annually
• Poorer prognosis and more aggressive disease than in
adults
• Greater frequency of the following than in adult CRC
- Mucinous and signet ring histology
- Microsatellite instability high (MSI-H)
- Mutations in Mis-match repair (MMR) genes
• Lower frequency of the following than in adult CRC
- K-ras mutations, 17p and 18q LOH
• Lower p53 protein levels than found in adult CRC
8. Are there current studies investigating
the molecular characterization of this
tumor type in the AYAO age group?
• Hill et al., Journal Clinical Oncology, 2007
• 77 CRC patients age 7-20 (St. Jude Children’s)
• 48/77 (62%) displayed mucinous histology
• 34/48 (71%) displayed signet ring histology (11-13% in
adult CRC)
• Did significantly more poorly than adult CRC patients
despite being on adult protocols
• Liu et al., Nature Medicine,1995
• 189 CRC patients with no evidence of HNPCC analyzed using
4-5 microsatellite markers per tumor (Johns Hopkins)
• 31 patients were 35 or younger
- 18 (58%) displayed MSI
• 46 patients were 36-55
- 8 (17%) displayed MSI
• 112 patients were 55 or older
- 11 (10%) displayed MSI
9. What are the current studies ongoing in older or
younger age groups that would provide further
insight into the biology of this tumor?
• The Cancer Genome Anatomy (TCGA) project has
provided data on genes that are frequently mutated in
adult CRC
• TCGA has identified several genes that exhibit
amplification and elevated expression in adult CRC,
including IGF-2
• There are also consensus gene sets that exhibit
mutations in adult CRC that have been identified
(Vogelstein)
10. Clinical Questions
• What contributes to the more aggressive clinical nature
of AYA CRC tumors?
• How can we better predict disease response in this
group of patients?
• What are the underlying reasons for the poor
therapeutic response in this group of patients?
11. Scientific Questions
• Why such a high frequency of MSI in the AYA group?
- Hypermethylation of hMLH1 gene known to occur
• What about other MMR genes?
• What are the molecular reasons for poorer outcome for
MSI-H patients in the AYA group?
• What is the reason for the high frequency of the
mucinous phenotype in the AYA group?
• Why the difference in p53, K-ras and DCC
characteristics in the AYA group?
13. • Breast cancer is the most frequent cancer in women in
the AYA population
• ~1 in 200 AYA women will develop breast cancer
• The disease is more likely to be aggressive, and to
exhibit a triple negative, basel-cell phenotype
• It often presents at a higher grade with a poorer
prognosis
• Molecular studies suggesting a novel gene expression
pattern in AYA breast cancers have been controversial
What is known about the incidence, outcome and
molecular characterization according to patient
age of Breast Cancer in the AYAO age group?
14. • Differential gene expression studies have investigated whether there is a
unique pattern for AYA breast tumors in comparison to older women, but
the results are conflicting and controversial [Anders et al, J. Clin. Oncol
2011,29:e18-e20; Azim Jr. et al, 2012 Clin Ca Res, 2012 1341-1351; Servant et. al. 2012
Clin Ca Res 1704-1715; Colleoni and Anders, the Oncologist 2013, 18:e13-15]
• Studies suggest an association between germline TP53 mutations and
early onset HER2-positive breast cancer, which could lead to elucidation
of molecular pathways involved in breast cancer [Cancer 2012, 118(4): 908–
913; Rath et al Breast Ca Res Treat 2013 139(1):193-198]
• BRCA mutations have been linked to susceptibility and early onset of
breast cancer [Infante et al. Breast Ca Res 2010 122(2):567-571, Andres et al Clin
Transl Onc, 2013, 10.1007/s12094-013-1070-9, ]
Are there current studies investigating the
molecular characterization of this tumor type in
the AYAO age group?
15. Clinical Questions
• Do women in the AYA population show different
responses to therapy than older patients despite the
fact that the biology of the tumor itself appears to be
similar?
• Can the response of AYA patients to current therapies
inform us about underlying mechanisms in this
population
• Can we identify a biological basis for the apparent
greater tendency for AYA breast tumors to
metastasize independent of the greater number of
more aggressive tumors in this population?
16. • Are there genetic susceptibility patterns that can be identified as being
associated with the early onset of breast cancer independent of tumor
type?
• Is there a biological mechanism underlying the recent report suggesting
that the incidence of advanced breast cancer in the AYA population has
increased? [Johnson et al, 2013 JAMA 309 :800-805]
• What mechanistic role does obestity play in early onset breast cancer?
• Do AYA tumors show differences in tumor microenvironment that
promote the development of more aggressive tumor types?
• Are factors such as metabolism and micro-RNA different in AYA as
compared to older patients, and can these factors be linked to tumor
aggressiveness and poor therapeutic responses?
Scientific Questions
19. AYA Melanoma
• Melanoma is the 3d most common cancer diagnosed and the most lethal form of
skin cancer among adolescents and young adults (aged 15-39 years) in the US.
• The 5-year OS is 65% for regional and 15% distant metastatic site.
• Melanoma incidence is higher among females compared with males.
• Melanoma of the trunk are overrepresented in this age group.
• Accuracy of melanoma cases reporting is limited because of incompleteness or
nonspecific reporting including large proportion of unspecified histology.
Known risk factors:
• Adolescents and young adults appear to be at particular risk for developing
melanoma because of UV exposure early in life.
• Giant congenital nevi, neurocuataneous melanosis, xeroderma pigmentosum,
Werner syndrome, retinoblastoma and immunosupression.
• Transplant or chemotherapy for primary tumors.
• Higher number of melanocytic nevi> 2mm in diameter.
• Fair complexion, facial freckling, and family history of melanoma.
• Understanding risk factors in AYA group is important to develop cancer control
activities aimed at reducing melanoma incidence and death in this age group.
20. Biopathology of melanoma in the AYA population
• The biopathology of melanoma have been the subject of controversy because of
inability to distinguish conventional melanomas from a subgroup of melanocytic
neoplasms with Spitz nevus-like morphology commonly seen in AYA patients.
• Pathologically, these melanocytic lesions have spindle and epithelioid cell
cytology, exhibit epithelial hyperplasia, giant melanocytes at the dermo-epithelial
junction, various degree of pagetoid spread in the epidermis, Kamino bodies and
others.
• The outcome of melanoma in the younger, as compared to the older populations
has been shown to differ substantially:
o Metastases to sentinel nodes (SNL) are found more frequently in AYA
groups with melanoma than would be expected in adults with the same
stage of disease.
o Melanoma in young patients is less likely to recur in distant organs.
• Occurrence of more frequent LN metastases in young people suggests that
melanoma cells in the young differ biologically and are more prone to
progression and invasion.
21. Molecular studies
• Comparative genomic hybridization (CGH) demonstrated multiple chromosomal
aberrations in 95% of the melanomas with spitzoid morphology whereas typical
Spitz nevi did not reveal more than an isolated gain in the region of chromosome
11 (11p).
• The nevi that revealed an increase in 11p also showed frequent mutations in the
gene encoding H-RAS (67%).
• Spitz nevi lack the BRAF mutations that are common in melanocytic nevi and
melanomas.
• CGH may be used to distinguish spitzoid melanoma from Spitz nevus when
pathological features are in question but the value of assessing mutations in the
BRAF, N-RAS and H-RAS genes is not established for melanocytic lesions in
AYA patients.
• Spitz nevi as a group show high levels of p16 expression.
• A group of miRNA-regulators of cell growth, proliferation, invasion, and survival
that is differentially upregulated in younger patients melanomas compared to
adults has been recently characterized. miRNA-337-5p appear to be involved in
cell growth and migration and targets Lyn TK. cyclin-D-1, D3, A and CDK4 are
target genes of miRNA-let-7b that is overexpressed in AYA melanoma.
22. Challenges
• AYA participation rates in clinical trials are drastically lower than for pediatric
patients and also lower than for adults.
• Few trials have enough AYA participation to have the statistical power to allow
analysis stratified by age.
• AYA continue to be treated under guidelines created for older adults.
• Lower rates of medical comorbidities and polypharmacy may permit AYAs to
tolerate higher doses of anticancer therapy. Therapy can be optimized at the
highest-dose treatment level such as high dose IL-2 and high dose interferon
IFNa-2b.
• Chemotherapy is poorly studied in this group.
• The genetic and progression markers of melanoma in the young are likely also
to differ from those in melanoma of elderly populations, but this has yet to be
studied.
• The different biology of melanoma in AYA population suggests that the
outcomes for younger patients may be improved over those of adults but the
outcomes need to be studied in clinical trials of adequate size and maturity, with
stratification for age.
23. Sarcoma
• From the Greek sarx meaning "flesh“
• Cancer that arises from transformed cells of
mesenchymal origin.
• Bone, cartilage, fat, muscle, vascular, neural
supportive tissues, soft tissue, etc.
• Molecularly and clinically heterogeneous group:
>50 types; rhabdomyosarcoma, Ewing’s
sarcoma, osteosarcoma, chondrosarcoma,
synovial, liposarcoma, desmoplastic small
round-cell tumor, clear cell sarcoma, etc.
• Incidence varies with age and diagnosis
24. Survival rate is lower for AYA
with Ewing’s sarcoma
Modified from: Bleyer, A., Barr, R., Hayes-Lattin, B., Thomas, D., Ellis, C.,
and Anderson, B. 2008. The distinctive biology of cancer in adolescents
and young adults. Nat Rev Cancer 8:288-298.
25. Sarcoma-Biology
Many driven by fusion oncogenes
Function of most unknown:
Transcriptional/Epigenetic Action
Sarcoma type Cytogenetics Fusion genes gene Frequency
Angiomatoid fibrous histiocytoma t(2;16)(q34;p11) FUS-CREB1 bZIP 89%
Angiomatoid fibrous histiocytoma t(12;16)(q13;p11) FUS-ATF1 bZIP 11%
Alveolar Soft Part Sarcoma t(X;17)(p11;q25) ASPSCR1-TFE3
microphthalmia-TFE, basic
helix-loop helix, leucine zipper
100%
Alveolar rhabdomyosarcoma t(2;2)(q35;p23) PAX3–NCOA1 Paired box/homeodomain Rare
Alveolar rhabdomyosarcoma t(2;13)(q35;q14) PAX3-FKHR Paired box/homeodomain 95%
Alveolar rhabdomyosarcoma t(1;13)(p36;q14) PAX7-FKHR Paired box/homeodomain 5%
Ew ing sarcoma t(11;22)(q24;q12) EWSR1-FLI1 Ets-like 85%
Ew ing sarcoma t(21;22)(q22;q12) EWSR1-ERG Ets-like 10%
Ew ing sarcoma t(7;22)(p22;q12) EWSR1-ETV1 Ets-like rare
Ew ing sarcoma t(17;22)(q12;q12) EWSR1-ETV4 Ets-like rare
Ew ing sarcoma t(2;22)(q33;q12) EWSR1-FEV Ets-like rare
Desmoplastic small round-cell tumor t(11;22)(p13;q12) EWSR1-WT1 Zinc finger 95%
Inflammatory myofibroblastic tumor t(1;2)(q25;p23) ALK-TPM3 Tyrosine kinase not know n
Inflammatory myofibroblastic tumor t(2;19)(p23;p13) ALK-TPM4 Tyrosine kinase not know n
Inflammatory myofibroblastic tumor t(2;17)(p23;q23) ALK-CLTC Tyrosine kinase not know n
Myxoid liposarcoma t(12;16)(q13;p11) FUS-DDIT3 bZIP 95%
Myxoid liposarcoma t(12;22)(q13;q12) EWSR1-ATF1 bZIP 5%
Myxoid chondrosarcoma t(9;22)(q22;q12) EWSR1-NR4A3 bZIP 75%
Myxoid chondrosarcoma t(9;15)(q22;q21) TFC12-NR4A3 basic helix-loop helix not know n
Myxoid chondrosarcoma t(9;17)(q22;q11) TAF15- NR4A3 bZIP not know n
Clear Cell Sarcoma t(12;22)(q13;q12) EWSR1-ATF1 bZIP not know n
Liposarcoma t(12;16)(q13,p11) FUS-ATF1 bZIP not know n
Synovial sarcoma t(X;18)(p11;q11) SYT-SSX1 Kruppel-associated box 65%
Synovial sarcoma t(X;18)(p11;q11) SYT-SSX2 Kruppel-associated box 35%
Synovial sarcoma t(X;18)(p11;q11) SYT-SSX4 Kruppel-associated box rare
Synovial sarcoma t(X;20) SS18L1-SSX1 Kruppel-associated box rare
Synovial sarcoma t(X;20) SS18L1-SSX2 Kruppel-associated box rare
Dermatofibrosarcoma protuberans t(17;22)(q22;q13) COL1A1-PDGFB Tyrosine kinase not know n
Endometrial stromal sarcoma t(7;17)(p15;q21) JAZF1-JJAZ1 Polycomb group complexes not know n
Congenital fibrosarcoma and mesoblastic
nephroma
t(12;15)(p13;q25) EVT6-NTRK3 HLH, Tyrosine kinase not know n
Small round-cell sarcoma inv 22q EWSR1-ZSG Zinc finger not know n
26. Sarcoma-Biology
Challenges and Opportunities
• Fusion genes are drivers for many sarcomas
• Ideal targets because not expressed in normal tissues
• Likely that fusion genes alter signal transduction, cell cycle
progression, transcriptional regulation and epigenetic
modification. Heterogeneous group and function of majority of
largely unknown.
• Difficult to target fusion genes if their primary role transcriptional
regulation. Basic science research is needed.
• The other genomic alterations aside from fusion genes, are
largely unknown. >3000 tumor samples have been reported in
sequencing studies 0 of them are AYA Sarcoma
• Metastatic AYA sarcomas difficult to treat, largely chemo-
insensitive.
• Difference between AYA and childhood sarcomas unknown
• Lack of animal models for AYA sarcoma
27. Current studies investigating the
molecular characterization of this tumor
type in the AYAO age group
• Individual laboratories including the NCIs intramural
program are performing next generation sequencing of
Rhabdomyosarcoma, Osteosarcoma (largely pediatric)
• NCI has completed a screen for a direct inhibitor of the
EWS-FLI1 transcription factor
• NCI is launching a screen for a direct inhibitor of the
PAX3-FOXO1 transcription factor.
• NCI trial NCT01109394 enrolls AYA patients for
comprhensive “Omics” studies
• NCI trial: Cediranib, in patients with ASPS
demonstrated an overall response rate of 35% with a
disease control rate of 84% at 24 weeks.
28. Are there specific molecular targets in this
tumor type in AYAO patients that make it more
vulnerable to specific therapeutic treatments.
• PARP-1 inhibition trials in EWS underway.
• Mithramycin was found to directly inhibit the EWS-FLI1
transcription factor scrreeing by high throughput; NCI trial
open.
• EWS-FLI1 fusion gene requires binding to RNA helicase A
for oncogenic function. Strategies to inhibit interaction with
RNA helicase A are underway.
• Novel agents targeting the MET and VEGFR therapy
pathway for tumors (ASPS) carrying the ASPL-TFE-3
fusion transcript ; e.g. a trial with caboxantinib, a dual
inhibitor of VEGFR and MET, in these patients is underway
[NCT01755195].
29. Genomic DNA
or RNA
Fragmentation
Fragment
Size Selection
Adaptors Ligation
DNA Fragments of
Similar Sizes
Genomic DNA Library
Amplification and Sequencing
Ref. Genome
AGCTGCTCGTCGCGAAACTCCGATCGACTGCTGATCGACTCGATCACTCGATCGTAGTCGAGAGTACTCGATGCT
Align (Map) Reads
to Ref. Genome
Genome Sequence
Massively Parallel Sequencing
(Next-Generation Sequencing)
30. Genomic Landscape of AYA Sarcomas:
What is known?
?
>3000 tumor samples have been reported
in next generation sequencing studies 0
of them are for AYA Sarcoma
31. Tumor
Biomarkers: Diagnostic & Prognostic
Biology: Drivers
Therapeutic Targets: Mutations or Over Expressed Genes
Copy Number
Gene Rearrangement
Epigenome
Damaging Mutations
Gene Expression
Fusion Genes
Splice Variants
Novel Transcript
Expressed Mutations
Germ line
RNA
DNA
Messenger RNA Non coding RNA
microRNA Other
Genome Partition
(e.g. Whole Exome)
Whole
Genome
Epigenetic
Landscape
Next Generation Sequencing
Genomic Approaches for the Comprehensive
Analysis of the AYA Cancer Genome- Catalog “ALL”
the Changes in the Genome
33. Next Generation Sequencing of
Rhabdomyosarcoma (RMS): Fusion Positive
RMS Have Lower Somatic Mutations Rate
Implications
1. Fusion Gene is
the Driver
2. Other Driver
Mutations in
fusion negative
sarcoma
37. Sarcoma
Future Directions
• Rare heterogeneous tumors, small numbers, requires a
national/international strategy
• Tumor bank that systematically collects blood, serum,
plasma, fresh frozen tumor and FFPE tissues with
clinical information database is required.
• Next generation sequencing project and other “Omics”
studies should be undertaken to catalog all genomic
changes begin with exome and transcriptome
• Biological function of fusion genes
• Direct inhibitor of the fusion genes
• Novel drugs/therapeutic strategies
