SlideShare a Scribd company logo
1 of 17
Next Generation
Sequencing
Basics of NGS
• Fragmentation of DNA into a Library of smaller fragments.
• Libraries are then sequenced to be duplicated.
• Bioinformatics piece together the small fragments to create a map
and reference it to the human genome.
Differences between methods
PCR

Detects aneuploidy
Detects gene defects
Detects mitotic errors
1-2 month of Preparation
Requires affected proband
Applicable to any case
* Karyomapping using BlueGnome

PCR +
aCGH

SNP
Next Gen
arrays* Sequencing

no
yes
no
yes
no
yes

yes
yes
yes
yes
no
yes

yes
yes
no
no
yes
no

yes
yes
yes
no
no
yes
Next Generation Sequencing (NGS)
Fragmentation Each region of the genome
sequenced multiple times

GTACCATAGGATACGACTTGCAGCGGCA

ATATTGCGTATA

Millions of short sequences produced
CAGCGGCAGATGATTCGGGGATATTG
AGGATACGACTTGCAGCGGCAGATGATT
TGCGTATAGG
Sequences are compared to the known human
CAGATGATTCGGGGATATTGCGTA
genome
ACCATAGGATACGACTTGCAGCGGC
TAGAGTACCATAGGATACGACTTGCAACGGCAGATGATTCGGGGATATTGCGTATAGGCTA
Known sequence (CFTR gene chromosome 7)
Mutations identified and amount of DNA (aneuploidy) revealed
Multiplexing
Chart Title
900

800

700

600

Cost

500
Number of samples

400

Price

300

200

100

0
1 3 5 7 9 111315171921232527293133353739414345474951535557596163
Number of Samples

Sample
1
2
3
4
5
6
7
8
9
10
11
12
54
55
56
57
58
59
60
61
62
63
64

Cost
819.9811
435.7911
307.7278
243.6961
205.2771
179.6644
161.3697
147.6486
136.9766
128.4391
121.4538
115.6328
65.83035
65.57164
65.32216
65.08144
64.84902
64.62448
64.40742
64.19748
63.99432
63.7976
63.60703
PGD for aneuploidy and gene defects
using NGS: Method
• With WGA only <10% is sequenced

• Solution: enrich the sequences of interest prior to NGS. An
aliquot of the WGA product was used to amplify by PCR the CF
ΔF508 mutation site on a cell line
• The gene was sequenced with a x30 depth
• All cells were found to be euploid and homozygotic for ΔF508.

• Conclusion: useful for DIRECT mutation analysis and aneuploid
D Wells, KKaur, A Rico, J Grifo, S Anderson, J Sherlock, JC Taylor , S Munne (submitted) Rapid genetic analysis of single
cells using a next generation sequencing methodology: application to human embryos reveals aneuploidy and DNA
sequence mutations
PGD for aneuploidy and gene defects
using NGS: Results
Cystic fibrosis gene (CFTR) F508 mutation sequenced in a single blastomere

D Wells, KKaur, A Rico, J Grifo, S Anderson, J Sherlock, JC Taylor , S Munne (submitted) Rapid genetic analysis of single
cells using a next generation sequencing methodology: application to human embryos reveals aneuploidy and DNA
sequence mutations
•

38 blastocysts from 13 couples with structural chromosomal
abnormalities

•

Whole genome sequence by Illumina HiSeq2000

•

Results: 0.07x depth with average 5.5% genome coverage

•

26 (68%) blastocysts euploid, 6 (16%) aneuploid, 4 (11%)
unbalanced only, 2 (5%) unbalanced and aneuploid

•

Highly concordant with SNP array results
Yin et al (2013) Biol Reprod 88, 69
•

21 blastocysts from couples at risk of cystic fibrosis and one of
Walker-Warburg syndrome

•

Whole genome amplification was followed by targeted Taqman
amplification of mutation site, sequenced by Ion Torrent and 8
barcoded samples per chip

•

Real time qPCR used for 24 chromosome aneuploidy testing

•

17 (81%) blastocysts euploid, 4 (19%) aneuploid

•

100% concordance of mutation status with STR and minisequencing
Treff et al (2013) Fertility and Sterility 99, 1377-1384
PGD for aneuploidy and gene defects
using NGS: Results
• A homozygotic cell line for ΔF508 was used
• The gene was sequenced with a x30 depth
• All cells were found to be euploid and homozygotic for ΔF508.

• Conclusion: this method can be use for DIRECT mutation
analysis and aneuploid
• Other methods such as SNPs can only do haplotype analysis

D Wells, KKaur, A Rico, J Grifo, S Anderson, J Sherlock, JC Taylor , S Munne (submitted) Rapid genetic analysis of single
cells using a next generation sequencing methodology: application to human embryos reveals aneuploidy and DNA
sequence mutations
Summary Next Gene Sequencing

Current Advantages:
- Same resolution for chromosome abnormalities than aCGH
- Detection of mitochondrial DNA: potentially useful
- Simultaneous detection of aneuploidy and gene defects
Future advantages:
- Whole gene sequencing
Vendors of Next Generation Sequencing
Company

Models

Benchtop Chemistry

Roche (454)

GS FLX/GS
Junior

Yes

Illumina

MiSeq/HiSeq/Ge Yes
nome Analyzer

Sequencing by synthesis

Ion Torrent

PGM/Proton/SO
LiD 4

Yes

Semiconductor sequencing

PACBio

PACBIO RS II

No

SMRT technology

Pyrosequencing
Vendors of Next Generation Sequencing
or Equivalent
Company

Models

Benchtop

Chemistry

Oxford Nanopore
Technologies

GridION System/MinION

No

Nanopore Sensing

RainDance Technologies

ThunderStorm
System/RDT 1000

Yes

High-Throughput/LowMed Targeted Sequencing

Helicos (Bankrupt)

N/A

N/A

N/A

Complete Genomics

Proprietary Sequencing

N/A

Proprietary (Long
Fragment Reads?)
Ion Torrent for Aneuploidy Validation
• 10 single cells from cell lines with known aneuploidies
• 40 embryo cells (previously diagnosed using aCGH)
•
•
•
•

Calculated amount of sequence from each chromosome
50/50 (100%) of samples gave a result
48 separate aneuploidies detected
100% diagnostic accuracy (in a blinded experiment)
First baby born from NGS
First NGS baby:
David Levy

A collaboration of
Reprogenetics-US and
Reprogenetics-UK
(Dagan Wells) and Main
Line Fertility (Dr.
Glassner)
Helpful tools for NGS
• https://genohub.com/next-gen-sequencing-services/

More Related Content

What's hot

Verifying the role of AID in Chronic Lymphocytic Leukemia
Verifying the role of AID in Chronic Lymphocytic LeukemiaVerifying the role of AID in Chronic Lymphocytic Leukemia
Verifying the role of AID in Chronic Lymphocytic LeukemiaCharlotte Broadbent
 
Understanding mechanisms underlying human gene expression variation with RNA ...
Understanding mechanisms underlying human gene expression variation with RNA ...Understanding mechanisms underlying human gene expression variation with RNA ...
Understanding mechanisms underlying human gene expression variation with RNA ...Joseph Pickrell
 
Insilico analysis of pkd genes in polycystic kidney disease patients
Insilico analysis of pkd genes in polycystic kidney disease patientsInsilico analysis of pkd genes in polycystic kidney disease patients
Insilico analysis of pkd genes in polycystic kidney disease patientsVeeramuthumariPandia1
 
Genetic polymorphism
Genetic polymorphismGenetic polymorphism
Genetic polymorphismmanorama12
 
tumor suppressor gene, prb, p53 gene
tumor suppressor gene, prb, p53 genetumor suppressor gene, prb, p53 gene
tumor suppressor gene, prb, p53 geneKAUSHAL SAHU
 
Gabbay Award Lecture
Gabbay Award LectureGabbay Award Lecture
Gabbay Award Lectureahandyside
 
Whole Exome Sequencing at Stanford University
Whole Exome Sequencing at Stanford UniversityWhole Exome Sequencing at Stanford University
Whole Exome Sequencing at Stanford UniversityGolden Helix
 
Apoptosis and the response to chemotherapy
Apoptosis and the response to chemotherapyApoptosis and the response to chemotherapy
Apoptosis and the response to chemotherapymeducationdotnet
 
Application of FISH in hematologic malignancies
Application of FISH in hematologic malignanciesApplication of FISH in hematologic malignancies
Application of FISH in hematologic malignanciesspa718
 
Single nucleotide polymorphism
Single nucleotide polymorphismSingle nucleotide polymorphism
Single nucleotide polymorphismSimon Silvan
 
Transhumanismo y Mejoramiento Genético mediante CRISPR
Transhumanismo y Mejoramiento Genético mediante CRISPRTranshumanismo y Mejoramiento Genético mediante CRISPR
Transhumanismo y Mejoramiento Genético mediante CRISPRBioeticared
 
Gene knockout in mice
Gene knockout in miceGene knockout in mice
Gene knockout in miceAbuKarulai
 

What's hot (20)

Cell death 2013
Cell death 2013Cell death 2013
Cell death 2013
 
Vision Research Symposium Conference Presentation
Vision Research Symposium Conference PresentationVision Research Symposium Conference Presentation
Vision Research Symposium Conference Presentation
 
Verifying the role of AID in Chronic Lymphocytic Leukemia
Verifying the role of AID in Chronic Lymphocytic LeukemiaVerifying the role of AID in Chronic Lymphocytic Leukemia
Verifying the role of AID in Chronic Lymphocytic Leukemia
 
Understanding mechanisms underlying human gene expression variation with RNA ...
Understanding mechanisms underlying human gene expression variation with RNA ...Understanding mechanisms underlying human gene expression variation with RNA ...
Understanding mechanisms underlying human gene expression variation with RNA ...
 
Shahbaz Str
Shahbaz StrShahbaz Str
Shahbaz Str
 
Junk DNA And The Human Genome
Junk DNA And The Human GenomeJunk DNA And The Human Genome
Junk DNA And The Human Genome
 
Insilico analysis of pkd genes in polycystic kidney disease patients
Insilico analysis of pkd genes in polycystic kidney disease patientsInsilico analysis of pkd genes in polycystic kidney disease patients
Insilico analysis of pkd genes in polycystic kidney disease patients
 
Genetic polymorphism
Genetic polymorphismGenetic polymorphism
Genetic polymorphism
 
tumor suppressor gene, prb, p53 gene
tumor suppressor gene, prb, p53 genetumor suppressor gene, prb, p53 gene
tumor suppressor gene, prb, p53 gene
 
Gabbay Award Lecture
Gabbay Award LectureGabbay Award Lecture
Gabbay Award Lecture
 
Whole Exome Sequencing at Stanford University
Whole Exome Sequencing at Stanford UniversityWhole Exome Sequencing at Stanford University
Whole Exome Sequencing at Stanford University
 
Apoptosis and the response to chemotherapy
Apoptosis and the response to chemotherapyApoptosis and the response to chemotherapy
Apoptosis and the response to chemotherapy
 
Application of FISH in hematologic malignancies
Application of FISH in hematologic malignanciesApplication of FISH in hematologic malignancies
Application of FISH in hematologic malignancies
 
Microarray
Microarray Microarray
Microarray
 
Single nucleotide polymorphism
Single nucleotide polymorphismSingle nucleotide polymorphism
Single nucleotide polymorphism
 
Knock out technology (final)
Knock out technology (final)Knock out technology (final)
Knock out technology (final)
 
Transhumanismo y Mejoramiento Genético mediante CRISPR
Transhumanismo y Mejoramiento Genético mediante CRISPRTranshumanismo y Mejoramiento Genético mediante CRISPR
Transhumanismo y Mejoramiento Genético mediante CRISPR
 
Microsatellite
MicrosatelliteMicrosatellite
Microsatellite
 
Single nucleotide polymorphism (sn ps)
Single nucleotide polymorphism (sn ps)Single nucleotide polymorphism (sn ps)
Single nucleotide polymorphism (sn ps)
 
Gene knockout in mice
Gene knockout in miceGene knockout in mice
Gene knockout in mice
 

Similar to Embed Repro Test

Nextgenerationsequencing ngs 131218163555-phpapp02
Nextgenerationsequencing     ngs  131218163555-phpapp02Nextgenerationsequencing     ngs  131218163555-phpapp02
Nextgenerationsequencing ngs 131218163555-phpapp02鋒博 蔡
 
Nextgenerationsequencing 131218163555-phpapp02
Nextgenerationsequencing 131218163555-phpapp02Nextgenerationsequencing 131218163555-phpapp02
Nextgenerationsequencing 131218163555-phpapp02t7260678
 
Applications of Single Cell Analysis
Applications of Single  Cell AnalysisApplications of Single  Cell Analysis
Applications of Single Cell AnalysisQIAGEN
 
Aug2013 Heidi Rehm integrating large scale sequencing into clinical practice
Aug2013 Heidi Rehm integrating large scale sequencing into clinical practiceAug2013 Heidi Rehm integrating large scale sequencing into clinical practice
Aug2013 Heidi Rehm integrating large scale sequencing into clinical practiceGenomeInABottle
 
Advances and Applications Enabled by Single Cell Technology
Advances and Applications Enabled by Single Cell TechnologyAdvances and Applications Enabled by Single Cell Technology
Advances and Applications Enabled by Single Cell TechnologyQIAGEN
 
Next Generation Sequencing
Next Generation SequencingNext Generation Sequencing
Next Generation SequencingShelomi Karoon
 
Gabbay81109pre07 12588919989864-phpapp02
Gabbay81109pre07 12588919989864-phpapp02Gabbay81109pre07 12588919989864-phpapp02
Gabbay81109pre07 12588919989864-phpapp02t7260678
 
Next Generation Sequencing
Next Generation SequencingNext Generation Sequencing
Next Generation SequencingAamir Wahab
 
GTC group 8 - Next Generation Sequencing
GTC group 8 - Next Generation SequencingGTC group 8 - Next Generation Sequencing
GTC group 8 - Next Generation SequencingYanqi Chan
 
SNPs analysis methods
SNPs analysis methodsSNPs analysis methods
SNPs analysis methodshad89
 
diagnosis of genetic defects.pptx
diagnosis of genetic defects.pptxdiagnosis of genetic defects.pptx
diagnosis of genetic defects.pptxAishwarya Sinha
 
diagnosis of genetic defects.pptx
diagnosis of genetic defects.pptxdiagnosis of genetic defects.pptx
diagnosis of genetic defects.pptxAishwarya Sinha
 
Molecular techniques for pathology research - MDX .pdf
Molecular techniques for pathology research - MDX .pdfMolecular techniques for pathology research - MDX .pdf
Molecular techniques for pathology research - MDX .pdfsabyabby
 
6. Molek tech.pptx [Repaired].pptx
6. Molek tech.pptx [Repaired].pptx6. Molek tech.pptx [Repaired].pptx
6. Molek tech.pptx [Repaired].pptxArdiansyahPrayitno2
 
Genome in a bottle april 30 2015 hvp Leiden
Genome in a bottle april 30 2015 hvp LeidenGenome in a bottle april 30 2015 hvp Leiden
Genome in a bottle april 30 2015 hvp LeidenGenomeInABottle
 
Towards Precision Medicine: Tute Genomics, a cloud-based application for anal...
Towards Precision Medicine: Tute Genomics, a cloud-based application for anal...Towards Precision Medicine: Tute Genomics, a cloud-based application for anal...
Towards Precision Medicine: Tute Genomics, a cloud-based application for anal...Reid Robison
 

Similar to Embed Repro Test (20)

Nextgenerationsequencing ngs 131218163555-phpapp02
Nextgenerationsequencing     ngs  131218163555-phpapp02Nextgenerationsequencing     ngs  131218163555-phpapp02
Nextgenerationsequencing ngs 131218163555-phpapp02
 
Nextgenerationsequencing 131218163555-phpapp02
Nextgenerationsequencing 131218163555-phpapp02Nextgenerationsequencing 131218163555-phpapp02
Nextgenerationsequencing 131218163555-phpapp02
 
Applications of Single Cell Analysis
Applications of Single  Cell AnalysisApplications of Single  Cell Analysis
Applications of Single Cell Analysis
 
Aug2013 Heidi Rehm integrating large scale sequencing into clinical practice
Aug2013 Heidi Rehm integrating large scale sequencing into clinical practiceAug2013 Heidi Rehm integrating large scale sequencing into clinical practice
Aug2013 Heidi Rehm integrating large scale sequencing into clinical practice
 
Cancer genome
Cancer genomeCancer genome
Cancer genome
 
Recent advances in PGT
Recent advances in PGTRecent advances in PGT
Recent advances in PGT
 
Advances and Applications Enabled by Single Cell Technology
Advances and Applications Enabled by Single Cell TechnologyAdvances and Applications Enabled by Single Cell Technology
Advances and Applications Enabled by Single Cell Technology
 
Next Generation Sequencing
Next Generation SequencingNext Generation Sequencing
Next Generation Sequencing
 
New generation Sequencing
New generation Sequencing New generation Sequencing
New generation Sequencing
 
Gabbay81109pre07 12588919989864-phpapp02
Gabbay81109pre07 12588919989864-phpapp02Gabbay81109pre07 12588919989864-phpapp02
Gabbay81109pre07 12588919989864-phpapp02
 
Next Generation Sequencing
Next Generation SequencingNext Generation Sequencing
Next Generation Sequencing
 
GTC group 8 - Next Generation Sequencing
GTC group 8 - Next Generation SequencingGTC group 8 - Next Generation Sequencing
GTC group 8 - Next Generation Sequencing
 
SNPs analysis methods
SNPs analysis methodsSNPs analysis methods
SNPs analysis methods
 
diagnosis of genetic defects.pptx
diagnosis of genetic defects.pptxdiagnosis of genetic defects.pptx
diagnosis of genetic defects.pptx
 
diagnosis of genetic defects.pptx
diagnosis of genetic defects.pptxdiagnosis of genetic defects.pptx
diagnosis of genetic defects.pptx
 
Molecular techniques for pathology research - MDX .pdf
Molecular techniques for pathology research - MDX .pdfMolecular techniques for pathology research - MDX .pdf
Molecular techniques for pathology research - MDX .pdf
 
6. Molek tech.pptx [Repaired].pptx
6. Molek tech.pptx [Repaired].pptx6. Molek tech.pptx [Repaired].pptx
6. Molek tech.pptx [Repaired].pptx
 
Genome in a bottle april 30 2015 hvp Leiden
Genome in a bottle april 30 2015 hvp LeidenGenome in a bottle april 30 2015 hvp Leiden
Genome in a bottle april 30 2015 hvp Leiden
 
Towards Precision Medicine: Tute Genomics, a cloud-based application for anal...
Towards Precision Medicine: Tute Genomics, a cloud-based application for anal...Towards Precision Medicine: Tute Genomics, a cloud-based application for anal...
Towards Precision Medicine: Tute Genomics, a cloud-based application for anal...
 
Dna microarray application in vp research mehran
Dna microarray application in vp research  mehranDna microarray application in vp research  mehran
Dna microarray application in vp research mehran
 

Recently uploaded

Automating Google Workspace (GWS) & more with Apps Script
Automating Google Workspace (GWS) & more with Apps ScriptAutomating Google Workspace (GWS) & more with Apps Script
Automating Google Workspace (GWS) & more with Apps Scriptwesley chun
 
2024: Domino Containers - The Next Step. News from the Domino Container commu...
2024: Domino Containers - The Next Step. News from the Domino Container commu...2024: Domino Containers - The Next Step. News from the Domino Container commu...
2024: Domino Containers - The Next Step. News from the Domino Container commu...Martijn de Jong
 
Scaling API-first – The story of a global engineering organization
Scaling API-first – The story of a global engineering organizationScaling API-first – The story of a global engineering organization
Scaling API-first – The story of a global engineering organizationRadu Cotescu
 
Boost PC performance: How more available memory can improve productivity
Boost PC performance: How more available memory can improve productivityBoost PC performance: How more available memory can improve productivity
Boost PC performance: How more available memory can improve productivityPrincipled Technologies
 
Data Cloud, More than a CDP by Matt Robison
Data Cloud, More than a CDP by Matt RobisonData Cloud, More than a CDP by Matt Robison
Data Cloud, More than a CDP by Matt RobisonAnna Loughnan Colquhoun
 
The Codex of Business Writing Software for Real-World Solutions 2.pptx
The Codex of Business Writing Software for Real-World Solutions 2.pptxThe Codex of Business Writing Software for Real-World Solutions 2.pptx
The Codex of Business Writing Software for Real-World Solutions 2.pptxMalak Abu Hammad
 
GenCyber Cyber Security Day Presentation
GenCyber Cyber Security Day PresentationGenCyber Cyber Security Day Presentation
GenCyber Cyber Security Day PresentationMichael W. Hawkins
 
08448380779 Call Girls In Friends Colony Women Seeking Men
08448380779 Call Girls In Friends Colony Women Seeking Men08448380779 Call Girls In Friends Colony Women Seeking Men
08448380779 Call Girls In Friends Colony Women Seeking MenDelhi Call girls
 
EIS-Webinar-Prompt-Knowledge-Eng-2024-04-08.pptx
EIS-Webinar-Prompt-Knowledge-Eng-2024-04-08.pptxEIS-Webinar-Prompt-Knowledge-Eng-2024-04-08.pptx
EIS-Webinar-Prompt-Knowledge-Eng-2024-04-08.pptxEarley Information Science
 
A Domino Admins Adventures (Engage 2024)
A Domino Admins Adventures (Engage 2024)A Domino Admins Adventures (Engage 2024)
A Domino Admins Adventures (Engage 2024)Gabriella Davis
 
Boost Fertility New Invention Ups Success Rates.pdf
Boost Fertility New Invention Ups Success Rates.pdfBoost Fertility New Invention Ups Success Rates.pdf
Boost Fertility New Invention Ups Success Rates.pdfsudhanshuwaghmare1
 
The 7 Things I Know About Cyber Security After 25 Years | April 2024
The 7 Things I Know About Cyber Security After 25 Years | April 2024The 7 Things I Know About Cyber Security After 25 Years | April 2024
The 7 Things I Know About Cyber Security After 25 Years | April 2024Rafal Los
 
Real Time Object Detection Using Open CV
Real Time Object Detection Using Open CVReal Time Object Detection Using Open CV
Real Time Object Detection Using Open CVKhem
 
Tata AIG General Insurance Company - Insurer Innovation Award 2024
Tata AIG General Insurance Company - Insurer Innovation Award 2024Tata AIG General Insurance Company - Insurer Innovation Award 2024
Tata AIG General Insurance Company - Insurer Innovation Award 2024The Digital Insurer
 
TrustArc Webinar - Stay Ahead of US State Data Privacy Law Developments
TrustArc Webinar - Stay Ahead of US State Data Privacy Law DevelopmentsTrustArc Webinar - Stay Ahead of US State Data Privacy Law Developments
TrustArc Webinar - Stay Ahead of US State Data Privacy Law DevelopmentsTrustArc
 
Slack Application Development 101 Slides
Slack Application Development 101 SlidesSlack Application Development 101 Slides
Slack Application Development 101 Slidespraypatel2
 
Finology Group – Insurtech Innovation Award 2024
Finology Group – Insurtech Innovation Award 2024Finology Group – Insurtech Innovation Award 2024
Finology Group – Insurtech Innovation Award 2024The Digital Insurer
 
[2024]Digital Global Overview Report 2024 Meltwater.pdf
[2024]Digital Global Overview Report 2024 Meltwater.pdf[2024]Digital Global Overview Report 2024 Meltwater.pdf
[2024]Digital Global Overview Report 2024 Meltwater.pdfhans926745
 
Axa Assurance Maroc - Insurer Innovation Award 2024
Axa Assurance Maroc - Insurer Innovation Award 2024Axa Assurance Maroc - Insurer Innovation Award 2024
Axa Assurance Maroc - Insurer Innovation Award 2024The Digital Insurer
 
A Call to Action for Generative AI in 2024
A Call to Action for Generative AI in 2024A Call to Action for Generative AI in 2024
A Call to Action for Generative AI in 2024Results
 

Recently uploaded (20)

Automating Google Workspace (GWS) & more with Apps Script
Automating Google Workspace (GWS) & more with Apps ScriptAutomating Google Workspace (GWS) & more with Apps Script
Automating Google Workspace (GWS) & more with Apps Script
 
2024: Domino Containers - The Next Step. News from the Domino Container commu...
2024: Domino Containers - The Next Step. News from the Domino Container commu...2024: Domino Containers - The Next Step. News from the Domino Container commu...
2024: Domino Containers - The Next Step. News from the Domino Container commu...
 
Scaling API-first – The story of a global engineering organization
Scaling API-first – The story of a global engineering organizationScaling API-first – The story of a global engineering organization
Scaling API-first – The story of a global engineering organization
 
Boost PC performance: How more available memory can improve productivity
Boost PC performance: How more available memory can improve productivityBoost PC performance: How more available memory can improve productivity
Boost PC performance: How more available memory can improve productivity
 
Data Cloud, More than a CDP by Matt Robison
Data Cloud, More than a CDP by Matt RobisonData Cloud, More than a CDP by Matt Robison
Data Cloud, More than a CDP by Matt Robison
 
The Codex of Business Writing Software for Real-World Solutions 2.pptx
The Codex of Business Writing Software for Real-World Solutions 2.pptxThe Codex of Business Writing Software for Real-World Solutions 2.pptx
The Codex of Business Writing Software for Real-World Solutions 2.pptx
 
GenCyber Cyber Security Day Presentation
GenCyber Cyber Security Day PresentationGenCyber Cyber Security Day Presentation
GenCyber Cyber Security Day Presentation
 
08448380779 Call Girls In Friends Colony Women Seeking Men
08448380779 Call Girls In Friends Colony Women Seeking Men08448380779 Call Girls In Friends Colony Women Seeking Men
08448380779 Call Girls In Friends Colony Women Seeking Men
 
EIS-Webinar-Prompt-Knowledge-Eng-2024-04-08.pptx
EIS-Webinar-Prompt-Knowledge-Eng-2024-04-08.pptxEIS-Webinar-Prompt-Knowledge-Eng-2024-04-08.pptx
EIS-Webinar-Prompt-Knowledge-Eng-2024-04-08.pptx
 
A Domino Admins Adventures (Engage 2024)
A Domino Admins Adventures (Engage 2024)A Domino Admins Adventures (Engage 2024)
A Domino Admins Adventures (Engage 2024)
 
Boost Fertility New Invention Ups Success Rates.pdf
Boost Fertility New Invention Ups Success Rates.pdfBoost Fertility New Invention Ups Success Rates.pdf
Boost Fertility New Invention Ups Success Rates.pdf
 
The 7 Things I Know About Cyber Security After 25 Years | April 2024
The 7 Things I Know About Cyber Security After 25 Years | April 2024The 7 Things I Know About Cyber Security After 25 Years | April 2024
The 7 Things I Know About Cyber Security After 25 Years | April 2024
 
Real Time Object Detection Using Open CV
Real Time Object Detection Using Open CVReal Time Object Detection Using Open CV
Real Time Object Detection Using Open CV
 
Tata AIG General Insurance Company - Insurer Innovation Award 2024
Tata AIG General Insurance Company - Insurer Innovation Award 2024Tata AIG General Insurance Company - Insurer Innovation Award 2024
Tata AIG General Insurance Company - Insurer Innovation Award 2024
 
TrustArc Webinar - Stay Ahead of US State Data Privacy Law Developments
TrustArc Webinar - Stay Ahead of US State Data Privacy Law DevelopmentsTrustArc Webinar - Stay Ahead of US State Data Privacy Law Developments
TrustArc Webinar - Stay Ahead of US State Data Privacy Law Developments
 
Slack Application Development 101 Slides
Slack Application Development 101 SlidesSlack Application Development 101 Slides
Slack Application Development 101 Slides
 
Finology Group – Insurtech Innovation Award 2024
Finology Group – Insurtech Innovation Award 2024Finology Group – Insurtech Innovation Award 2024
Finology Group – Insurtech Innovation Award 2024
 
[2024]Digital Global Overview Report 2024 Meltwater.pdf
[2024]Digital Global Overview Report 2024 Meltwater.pdf[2024]Digital Global Overview Report 2024 Meltwater.pdf
[2024]Digital Global Overview Report 2024 Meltwater.pdf
 
Axa Assurance Maroc - Insurer Innovation Award 2024
Axa Assurance Maroc - Insurer Innovation Award 2024Axa Assurance Maroc - Insurer Innovation Award 2024
Axa Assurance Maroc - Insurer Innovation Award 2024
 
A Call to Action for Generative AI in 2024
A Call to Action for Generative AI in 2024A Call to Action for Generative AI in 2024
A Call to Action for Generative AI in 2024
 

Embed Repro Test

  • 2. Basics of NGS • Fragmentation of DNA into a Library of smaller fragments. • Libraries are then sequenced to be duplicated. • Bioinformatics piece together the small fragments to create a map and reference it to the human genome.
  • 3. Differences between methods PCR Detects aneuploidy Detects gene defects Detects mitotic errors 1-2 month of Preparation Requires affected proband Applicable to any case * Karyomapping using BlueGnome PCR + aCGH SNP Next Gen arrays* Sequencing no yes no yes no yes yes yes yes yes no yes yes yes no no yes no yes yes yes no no yes
  • 4. Next Generation Sequencing (NGS) Fragmentation Each region of the genome sequenced multiple times GTACCATAGGATACGACTTGCAGCGGCA ATATTGCGTATA Millions of short sequences produced CAGCGGCAGATGATTCGGGGATATTG AGGATACGACTTGCAGCGGCAGATGATT TGCGTATAGG Sequences are compared to the known human CAGATGATTCGGGGATATTGCGTA genome ACCATAGGATACGACTTGCAGCGGC TAGAGTACCATAGGATACGACTTGCAACGGCAGATGATTCGGGGATATTGCGTATAGGCTA Known sequence (CFTR gene chromosome 7) Mutations identified and amount of DNA (aneuploidy) revealed
  • 5. Multiplexing Chart Title 900 800 700 600 Cost 500 Number of samples 400 Price 300 200 100 0 1 3 5 7 9 111315171921232527293133353739414345474951535557596163 Number of Samples Sample 1 2 3 4 5 6 7 8 9 10 11 12 54 55 56 57 58 59 60 61 62 63 64 Cost 819.9811 435.7911 307.7278 243.6961 205.2771 179.6644 161.3697 147.6486 136.9766 128.4391 121.4538 115.6328 65.83035 65.57164 65.32216 65.08144 64.84902 64.62448 64.40742 64.19748 63.99432 63.7976 63.60703
  • 6.
  • 7. PGD for aneuploidy and gene defects using NGS: Method • With WGA only <10% is sequenced • Solution: enrich the sequences of interest prior to NGS. An aliquot of the WGA product was used to amplify by PCR the CF ΔF508 mutation site on a cell line • The gene was sequenced with a x30 depth • All cells were found to be euploid and homozygotic for ΔF508. • Conclusion: useful for DIRECT mutation analysis and aneuploid D Wells, KKaur, A Rico, J Grifo, S Anderson, J Sherlock, JC Taylor , S Munne (submitted) Rapid genetic analysis of single cells using a next generation sequencing methodology: application to human embryos reveals aneuploidy and DNA sequence mutations
  • 8. PGD for aneuploidy and gene defects using NGS: Results Cystic fibrosis gene (CFTR) F508 mutation sequenced in a single blastomere D Wells, KKaur, A Rico, J Grifo, S Anderson, J Sherlock, JC Taylor , S Munne (submitted) Rapid genetic analysis of single cells using a next generation sequencing methodology: application to human embryos reveals aneuploidy and DNA sequence mutations
  • 9. • 38 blastocysts from 13 couples with structural chromosomal abnormalities • Whole genome sequence by Illumina HiSeq2000 • Results: 0.07x depth with average 5.5% genome coverage • 26 (68%) blastocysts euploid, 6 (16%) aneuploid, 4 (11%) unbalanced only, 2 (5%) unbalanced and aneuploid • Highly concordant with SNP array results Yin et al (2013) Biol Reprod 88, 69
  • 10. • 21 blastocysts from couples at risk of cystic fibrosis and one of Walker-Warburg syndrome • Whole genome amplification was followed by targeted Taqman amplification of mutation site, sequenced by Ion Torrent and 8 barcoded samples per chip • Real time qPCR used for 24 chromosome aneuploidy testing • 17 (81%) blastocysts euploid, 4 (19%) aneuploid • 100% concordance of mutation status with STR and minisequencing Treff et al (2013) Fertility and Sterility 99, 1377-1384
  • 11. PGD for aneuploidy and gene defects using NGS: Results • A homozygotic cell line for ΔF508 was used • The gene was sequenced with a x30 depth • All cells were found to be euploid and homozygotic for ΔF508. • Conclusion: this method can be use for DIRECT mutation analysis and aneuploid • Other methods such as SNPs can only do haplotype analysis D Wells, KKaur, A Rico, J Grifo, S Anderson, J Sherlock, JC Taylor , S Munne (submitted) Rapid genetic analysis of single cells using a next generation sequencing methodology: application to human embryos reveals aneuploidy and DNA sequence mutations
  • 12. Summary Next Gene Sequencing Current Advantages: - Same resolution for chromosome abnormalities than aCGH - Detection of mitochondrial DNA: potentially useful - Simultaneous detection of aneuploidy and gene defects Future advantages: - Whole gene sequencing
  • 13. Vendors of Next Generation Sequencing Company Models Benchtop Chemistry Roche (454) GS FLX/GS Junior Yes Illumina MiSeq/HiSeq/Ge Yes nome Analyzer Sequencing by synthesis Ion Torrent PGM/Proton/SO LiD 4 Yes Semiconductor sequencing PACBio PACBIO RS II No SMRT technology Pyrosequencing
  • 14. Vendors of Next Generation Sequencing or Equivalent Company Models Benchtop Chemistry Oxford Nanopore Technologies GridION System/MinION No Nanopore Sensing RainDance Technologies ThunderStorm System/RDT 1000 Yes High-Throughput/LowMed Targeted Sequencing Helicos (Bankrupt) N/A N/A N/A Complete Genomics Proprietary Sequencing N/A Proprietary (Long Fragment Reads?)
  • 15. Ion Torrent for Aneuploidy Validation • 10 single cells from cell lines with known aneuploidies • 40 embryo cells (previously diagnosed using aCGH) • • • • Calculated amount of sequence from each chromosome 50/50 (100%) of samples gave a result 48 separate aneuploidies detected 100% diagnostic accuracy (in a blinded experiment)
  • 16. First baby born from NGS First NGS baby: David Levy A collaboration of Reprogenetics-US and Reprogenetics-UK (Dagan Wells) and Main Line Fertility (Dr. Glassner)
  • 17. Helpful tools for NGS • https://genohub.com/next-gen-sequencing-services/

Editor's Notes

  1. Above is Illumina created pictureBarcode adapters contain sequences that are optimized to provide equal representation of all barcodes in a pool
  2. Usinga different approach i.e. Using an initial targeted PCR to enrich the region in which the mutation is located Treff and colleagues have shown accurate mutation detation and 100% concordance with STR and minisequencing. However, for aneuploidy parallel analysis by real time qPCR was used.... So not clear that there is any advantage in using the sequencer as minisequencing is well established and accurate etc...
  3. Pyrosequencing – taking a single strand of the DNA to be sequenced and then synthesizing its complementary strand enzymaticallySequencing by synthesis - massively parallel sequencing of short reads using solid phase sequencing by reversible terminatorsSemiconductor sequencing – millions of wells capture chemical information that is related to a nucleotide.SMRT Technology – Phospholinked nucleotides are introduced to the DNA strand – occurs in real time
  4. Nanopore sensing – events that create characteristic disruption in current.