Isolasi dan Karakterisasi Fragmen cDNA dari Gen Penyandi  Metallothionein  dari Kedelai Kultivar Slamet YASSIER ANWAR P055...
Latar Belakang Kebutuhan kedelai dalam negeri 2 juta ton/tahun Produksi kedelai dalam negeri 0.8 juta ton/tahun   Impor ke...
Kedelai Slamet <ul><li>Sumber gen untuk mekanisme toleran Al </li></ul><ul><li>Kultivar lokal yang toleran terhadap tanah ...
Metallothionein Studi MT Pada Kedelai <ul><li>Protein pengikat ion logam, mengandung banyak asam amino  </li></ul><ul><li>...
Mengisolasi dan mengkarakterisasi fragmen cDNA  dari gen penyandi  metallothionein  tipe 2 dari  G. max  ( GmMt2 ) kultiva...
Tempat Penelitian BIORIN BMST (PSSHB IPB) Waktu Penelitian September 2007 s/d April 2008 METODOLOGI PENELITIAN
2. pGEM-T Easy 1. Tanaman Kedelai Bahan Tempat  penyisipan
3.  E. coli  galur DH5α 4. Primer spesifik MF &   M7R Primer aktin ActF & ActR
Isolasi RNA total Sintesis cDNA total Verifikasi cDNA Isolasi Fragmen cDNA  Mt2 Pengklonan Fragmen cDNA  GmMt2 Seleksi  E....
Rasio 1.8 s/d 2 menunjukkan kemurnian tinggi Tidak terkontaminasi oleh protein Hasil Penelitian Isolasi RNA Bahan  Absorba...
Elektroforesis RNA total <ul><li>Integritas RNA tinggi </li></ul><ul><li>Bersih dari Genom </li></ul>28S  18S
RT-PCR <ul><li>cDNA terbentuk </li></ul><ul><li>Bebas DNA </li></ul>RT 1. Terdapat fragmen  GmMt2 2. Ukuran 250 pb mt2   M...
Kloning-transformasi dan Verifikasi vektor  pGEM-T Easy   M  Mt2 1000 pb 250 pb PCR Klon  Rekombinan Koloni biru Koloni pu...
Plasmid Rekombinan pGEM-T Easy + GmMt2
Pensekuenan Fragmen  GmMt2  Sequence ID:  GmMt2   atgtcttgctgtggaggaaactgcggatgtggatctggctgcaagtgcggcaacggttgtggaggttgcaaa...
Deduksi Asam Amino   81 asam amino Open Reading Frame
Analisis Restriksi Tidak mengandung situs restriksi dari MCS pGEM-T Easy
BLAST n
BLAST p
<ul><li>cDNA utuh  GmMt2   telah berhasil diisolasi dari  G. max  L. dengan ukuran 246 pb. </li></ul><ul><li>Fragmen  GmMt...
Terima Kasih <ul><li>Proyek HPTP batch III  </li></ul><ul><li>(atas nama Dr. Ir. SUHARSONO, DEA) </li></ul><ul><li>2. Dr. ...
 
Isolasi RNA Total  1 g sampel digerus dengan N2 cair + 800  μ l TRIzol Inkubasi 3 menit, T ruang + 200  μ l Chloroform Ink...
Sintesis cDNA Total 20 Final Volume 0.8 2 0.2 2 1 4 10 Jumlah ( μ l) No Bahan Kons. 1 RNA 5 μg / μl 2 Buffer RT  1X 3 Prim...
Primer  ActF : ATGGCAGATGCCGAGGATAT   ActR : CAGTTGTGCGACCACTTGCA PCR Aktin No Bahan Kons. Jumlah ( μ l) 1 Template cDNA  ...
Desain Primer Spesifik Searching sequences of  Mt2 Clustering of  Mt2 FASTA Format a Group Primer3 (http://www.primer3.com...
Primer MF :TCGAGAAAAATGTCTTGCTGTG M7R :CCTTGCACCTGCAAGTGAAG Isolasi Fragmen cDNA  GmMt2 No Bahan Kons. Jumlah ( μ l) 1 Tem...
Ligasi Fragmen  Mt2 Pengklonan & Seleksi Inkubasi 4°C;overnight No Bahan Kons. Volume ( μ l) 1 Produk PCR ± 5 ng 3 2 pGEM-...
Isolasi DNA Plasmid Kultur klon semalam @1.5ml 12000rpm 10‘ 4°C 12000rpm 5‘ 4°C 150µl buffer resuspensi, vortex 150µl buff...
Analisis Plasmid Rekombinan No Bahan Kons. Volume ( μ l) 1 Plasmid rekombinan 13 ng/ μl 15 2 Buffer  Eco R1 (10x) 1X 2 3 E...
<ul><li>Analisis Situs Restriksi </li></ul><ul><li>http://www.firstmarket.com/cutter/cut2.html   </li></ul><ul><li>Transla...
Hasil Sekuen
Biomolekuler Website
Cystein
Verifikasi dengan Aktin <ul><li>Primer aktin dari kedelai </li></ul><ul><li>Primer ActF </li></ul><ul><li>5’ATGGCAGATGCCGA...
 
 
 
 
 
 
 
Upcoming SlideShare
Loading in …5
×

Isolasi Dan Karakterisasi Fragmen C Dna

2,271 views

Published on

Published in: Education, Technology, Business
1 Comment
1 Like
Statistics
Notes
No Downloads
Views
Total views
2,271
On SlideShare
0
From Embeds
0
Number of Embeds
19
Actions
Shares
0
Downloads
79
Comments
1
Likes
1
Embeds 0
No embeds

No notes for slide

Isolasi Dan Karakterisasi Fragmen C Dna

  1. 1. Isolasi dan Karakterisasi Fragmen cDNA dari Gen Penyandi Metallothionein dari Kedelai Kultivar Slamet YASSIER ANWAR P055040011 Pembimbing 1. Dr. Ir. SUHARSONO, DEA 2. Dr. Ir. UTUT WIDYASTUTI, M.Si
  2. 2. Latar Belakang Kebutuhan kedelai dalam negeri 2 juta ton/tahun Produksi kedelai dalam negeri 0.8 juta ton/tahun Impor kedelai 1.2 juta ton/tahun Peningkatan produksi kedelai dengan INTENSIFIKASI EKSTENSIFIKASI Potensi lahan + lahan asam ± 20 juta ha BPS, 2007 Latar Belakang
  3. 3. Kedelai Slamet <ul><li>Sumber gen untuk mekanisme toleran Al </li></ul><ul><li>Kultivar lokal yang toleran terhadap tanah asam </li></ul>
  4. 4. Metallothionein Studi MT Pada Kedelai <ul><li>Protein pengikat ion logam, mengandung banyak asam amino </li></ul><ul><li>cysteine , berat molekul rendah & ditemukan pada berbagai organisme </li></ul><ul><li>dan berbagai tingkat jaringan/organ </li></ul><ul><li>Berperan dalam detoksifikasi logam-logam yang dapat bersifat toksik </li></ul><ul><li>Terlibat dalam proses fisiologis, proliferasi, aktifitas dari metalloenzim, </li></ul><ul><li>dan faktor transkripsi </li></ul><ul><li>Memiliki karakteristik yang unik dari komposisi asam amino cysteine </li></ul><ul><li>Berperan dalam mekanisme homeostasis logam-logam esensial </li></ul><ul><li>Berperan dalam menanggani & mencegah kerusakan akibat cekaman </li></ul><ul><li>oksidatif </li></ul>
  5. 5. Mengisolasi dan mengkarakterisasi fragmen cDNA dari gen penyandi metallothionein tipe 2 dari G. max ( GmMt2 ) kultivar Slamet Tujuan Penelitian
  6. 6. Tempat Penelitian BIORIN BMST (PSSHB IPB) Waktu Penelitian September 2007 s/d April 2008 METODOLOGI PENELITIAN
  7. 7. 2. pGEM-T Easy 1. Tanaman Kedelai Bahan Tempat penyisipan
  8. 8. 3. E. coli galur DH5α 4. Primer spesifik MF & M7R Primer aktin ActF & ActR
  9. 9. Isolasi RNA total Sintesis cDNA total Verifikasi cDNA Isolasi Fragmen cDNA Mt2 Pengklonan Fragmen cDNA GmMt2 Seleksi E. coli pembawa plasmid Isolasi plasmid rekombinan Analisis cDNA Sisipan Sequensing Analisis dan Karakterisasi Simpulan Desain Primer Metode Penelitian
  10. 10. Rasio 1.8 s/d 2 menunjukkan kemurnian tinggi Tidak terkontaminasi oleh protein Hasil Penelitian Isolasi RNA Bahan Absorban pada Rasio λ260/λ280 Total RNA (μg/g sampel segar) λ260 λ280 1g ujung akar 0.223 0.118 1.88 187
  11. 11. Elektroforesis RNA total <ul><li>Integritas RNA tinggi </li></ul><ul><li>Bersih dari Genom </li></ul>28S 18S
  12. 12. RT-PCR <ul><li>cDNA terbentuk </li></ul><ul><li>Bebas DNA </li></ul>RT 1. Terdapat fragmen GmMt2 2. Ukuran 250 pb mt2 M 1000 pb 250 pb M Akar 1000 pb 500 pb
  13. 13. Kloning-transformasi dan Verifikasi vektor pGEM-T Easy M Mt2 1000 pb 250 pb PCR Klon Rekombinan Koloni biru Koloni putih Hasil Transformasi Fragmen GmMt2 berhasil diklonkan ke E. Coli DH5 α 3000 pb 1000 pb 250 pb p M Eco RI
  14. 14. Plasmid Rekombinan pGEM-T Easy + GmMt2
  15. 15. Pensekuenan Fragmen GmMt2 Sequence ID: GmMt2 atgtcttgctgtggaggaaactgcggatgtggatctggctgcaagtgcggcaacggttgtggaggttgcaaaatgtaccctgacttgggattctccggcgagacaaccacaactgagacttttgtcttgggcgttgcaccggcgatgaagaatcagtacgag gcttcaggggagagtaacaacgctgagaacgatgcttgcaagtgtggatctgactgcaagtgtgatccttgcacctgcaagtga Fragmen GmMt2 berukuran 246 pb
  16. 16. Deduksi Asam Amino 81 asam amino Open Reading Frame
  17. 17. Analisis Restriksi Tidak mengandung situs restriksi dari MCS pGEM-T Easy
  18. 18. BLAST n
  19. 19. BLAST p
  20. 20. <ul><li>cDNA utuh GmMt2 telah berhasil diisolasi dari G. max L. dengan ukuran 246 pb. </li></ul><ul><li>Fragmen GmMt2 mempunyai urutan nukleotida dan asam amino yang sama dengan AtMt2A dari A. thaliana . </li></ul><ul><li>Motif urutan asam amino GmM T 2 terdiri dari Cys-Cys, Cys-X-Cys dan Cys-X-X-Cys . </li></ul><ul><li>GmMT2 diduga memiliki peran yang sama dengan AtMT2A yaitu mengikat dan mendetoksifikasi unsur logam dan membatasi kerusakan oksidatif pada tanaman </li></ul>Simpulan
  21. 21. Terima Kasih <ul><li>Proyek HPTP batch III </li></ul><ul><li>(atas nama Dr. Ir. SUHARSONO, DEA) </li></ul><ul><li>2. Dr. Ir. SUHARSONO, DEA </li></ul><ul><li>3. Dr. Ir. UTUT WIDYASTUTI SUHARSONO, M.Si </li></ul><ul><li>4. Dr. Ir. MUHAMMAD JUSUF, DEA </li></ul><ul><li>5. Rekan-rekan di Lab. BIORIN dan BMST </li></ul>
  22. 23. Isolasi RNA Total 1 g sampel digerus dengan N2 cair + 800 μ l TRIzol Inkubasi 3 menit, T ruang + 200 μ l Chloroform Inkubasi 5 menit, T ruang 9000 rpm, 6 ˚C, 15 menit Fase cair dipindahkan, + 500 μl Isopropyl alcohol Pelet + 500μl EtOH 70% Inkubasi 10 menit, T ruang 9000 rpm, 6 ˚C, 10 menit 5700 rpm, 6 ˚C, 5 menit Pelet dikeringkan + 30μl ddH2O-DEPC treated Kuantifikasi (Spektofotometer) Kualifikasi (Elektroforesis)
  23. 24. Sintesis cDNA Total 20 Final Volume 0.8 2 0.2 2 1 4 10 Jumlah ( μ l) No Bahan Kons. 1 RNA 5 μg / μl 2 Buffer RT 1X 3 Primer Oligo (dT) 20 pmol 4 Dithiotreitol (DTT) 10 mM 5 RT enzyme (Invitrogen) 2U/ μ l 6 dNTP mix 2 mM/μl 7 ddH2O(DEPC) - No Suhu (˚C) Waktu (menit) 1 30 10 2 45 50 3 95 5 4 15 10
  24. 25. Primer ActF : ATGGCAGATGCCGAGGATAT ActR : CAGTTGTGCGACCACTTGCA PCR Aktin No Bahan Kons. Jumlah ( μ l) 1 Template cDNA ( ± 200 ng) 10 ng/μl 1 2 Buffer Taq 10x 1 3 Primer ActF 10 pmol 0.5 4 Primer ActR 10 pmol 0.5 5 dNTP mix 2 mM/μl 1 6 DMSO 4 % 0.4 7 Taq Polymerase 5 U /μl 0.1 8 ddH2O - 5.5 Volume final 10 No PCR Suhu Waktu 1 Pra-PCR 95˚C 5 menit 2 Denaturasi 94˚C 30 detik 3 Annealing 55˚C 30 detik 4 Ekstensi 72˚C 1.5 menit 5 Siklus - 37 siklus 6 Final-PCR 72˚C 5 menit 7 Post-PCR 15˚C 5 menit
  25. 26. Desain Primer Spesifik Searching sequences of Mt2 Clustering of Mt2 FASTA Format a Group Primer3 (http://www.primer3.com) Find consensus sequence (BIOEDIT versi 7.0.5.2) Selection of Primer Spesific Primer of Mt2 Primer MF :TCGAGAAAAATGTCTTGCTGTG M7R :CCTTGCACCTGCAAGTGAAG
  26. 27. Primer MF :TCGAGAAAAATGTCTTGCTGTG M7R :CCTTGCACCTGCAAGTGAAG Isolasi Fragmen cDNA GmMt2 No Bahan Kons. Jumlah ( μ l) 1 Template cDNA ( ± 200 ng) 10 ng/μl 2 2 Buffer Taq (10x) 1x 2 3 Primer MF 20 pmol 1 4 primer M7R 20 pmol 1 5 dNTP mix 2 mM/μl 2 6 DMSO 4 % 0.8 7 Taq Polymerase 5 U /μl 0.2 8 ddH2O - 11 Volume final 20 No PCR Suhu Waktu 1 Pra-PCR 95˚C 5 menit 2 Denaturasi 94˚C 30 detik 3 Annealing 58˚C 30 detik 4 Ekstensi 72˚C 1.5 menit 5 Siklus - 37 siklus 6 Final-PCR 72˚C 5 menit 7 Post-PCR 15 ˚C 5 menit
  27. 28. Ligasi Fragmen Mt2 Pengklonan & Seleksi Inkubasi 4°C;overnight No Bahan Kons. Volume ( μ l) 1 Produk PCR ± 5 ng 3 2 pGEM-T Easy ± 10 ng 1 3 Buffer T4 DNA Ligase 10x 1 4 DNA ligase 1U/ μ l 0.5 5 ddH2O - 4.5 Volume final 10 Sel kompeten + hasil ligasi Di es 20 menit Kejutan suhu 42°C selama 45 detik Inkubasi 37°C;250rpm; selama 20menit + 100μl YT Di es 5 menit Sebar di media LA+ Ampisilin Inkubasi 38°C 16 jam Seleksi Biru-Putih E. Coli DH5 α Blue-white selection
  28. 29. Isolasi DNA Plasmid Kultur klon semalam @1.5ml 12000rpm 10‘ 4°C 12000rpm 5‘ 4°C 150µl buffer resuspensi, vortex 150µl buffer lysis, bolak-balik 150µl buffer netralisasi pelet ① ② ③ 12000rpm 5‘ 4°C vortex fase aqueous NaOAc 3M etOH abs 2xvol Inkubasi -20ºC, 2 jam 12000rpm 5‘ 4°C pelet Cuci dg etOH 70% 12000rpm 10‘ 4°C Kering vacuum 30-45’ Dilarutkan dlm TE/ddH 2 O, inkubasi semalam + RNase 0.1x vol Plasmid cek
  29. 30. Analisis Plasmid Rekombinan No Bahan Kons. Volume ( μ l) 1 Plasmid rekombinan 13 ng/ μl 15 2 Buffer Eco R1 (10x) 1X 2 3 Enzim Eco R1 10 U/ μl 1 4 ddH2O - 2 Volume final 20 Inkubasi 37°C; 2 jam
  30. 31. <ul><li>Analisis Situs Restriksi </li></ul><ul><li>http://www.firstmarket.com/cutter/cut2.html </li></ul><ul><li>Translasi (deduksi asam amino) </li></ul><ul><li>http://www.expasy.ch/tools/translate </li></ul><ul><li>BLAST </li></ul><ul><li>http://www.ncbi.nlm.nih.gov/blast </li></ul><ul><li>ORF </li></ul><ul><li>http://www.softberry/bestorf/htm </li></ul><ul><li>Domain </li></ul><ul><li>http://www.myhits/motifscan/htm </li></ul>Analisis Sekuen
  31. 32. Hasil Sekuen
  32. 33. Biomolekuler Website
  33. 34. Cystein
  34. 35. Verifikasi dengan Aktin <ul><li>Primer aktin dari kedelai </li></ul><ul><li>Primer ActF </li></ul><ul><li>5’ATGGCAGATGCCGAGGATAT3’ </li></ul><ul><li>Primer ActR </li></ul><ul><li>5’CAGTTGTGCGACCACTTGCA3’ </li></ul>450 pb cDNA murni Ekson 1 Ekson 2 Ekson 1 Ekson 2 Intron 90 pb 540 pb cDNA tidak murni Template: DNA genom

×