Fontagro comite tecnico templado 2010

537 views

Published on

Published in: Education
0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total views
537
On SlideShare
0
From Embeds
0
Number of Embeds
17
Actions
Shares
0
Downloads
7
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide

Fontagro comite tecnico templado 2010

  1. 1. Proyecto FTG-8009/08 :“Selección asistida por marcadores moleculares para tolerancia al frío del arroz en el cono sur latinoamericano; una estrategia para enfrentar la inestabilidad climática”
  2. 3. Problemática <ul><li>Leve incremento de las temperaturas mínimas </li></ul><ul><li>Aumento en la variabilidad que puede provocar imprevisibilidad y eventos extremos </li></ul>
  3. 4. Temperaturas <ul><li>1973-2009 INIA – URUGUAY * </li></ul>M. Cruz 1981-2000 NARO - HOKKAIDO ** * Fuente:Reporte anual 2008- 2009- INIA URUGUAY ** Fuente: NARO- JAPON
  4. 5. Fin del Proyecto <ul><li>Asegurar la estabilidad y sostenibilidad productiva de los arroceros de Argentina, Uruguay y Sur de Brasil frente a los posibles impactos del cambio climático, mediante la liberación de variedades tolerantes al frío de alto rendimiento, y de alta calidad, asegurando la demanda alimentaría regional e internacional. </li></ul>
  5. 6. Componentes <ul><li>Componente 1 </li></ul><ul><ul><li>_ Validación y estandarización de marcadores y metodologías de SAM desarrolladas en Japón y las que están disponibles al público. </li></ul></ul><ul><ul><li>Componente 2 </li></ul></ul><ul><ul><li>_ Implementación de la SAM en los programas de mejoramiento de las instituciones del consorcio. </li></ul></ul><ul><ul><li>Componente 3 </li></ul></ul><ul><ul><li>_ Evaluación en condiciones naturales de estrés de frío de las poblaciones obtenidas por SAM. </li></ul></ul><ul><ul><li>Componente 4 </li></ul></ul><ul><ul><li>_ Capacitación y divulgación . </li></ul></ul>
  6. 7. Componentes 2009- 2010 <ul><li>Componente 1 </li></ul><ul><ul><li>Validación y estandarización de marcadores y metodologías de SAM desarrolladas en Japón y las que están disponibles al público. </li></ul></ul><ul><li>Componente 4 </li></ul><ul><ul><li>Capacitación y divulgación (Fortalecimiento Institucional). </li></ul></ul>
  7. 8. <ul><li>Técnicos de las instituciones participantes entrenados en NARCH-Japón en evaluación fenotípica y genotípica. </li></ul><ul><li>Alianzas entre instituciones regionales con centros de investigación avanzados. </li></ul><ul><li>Red de información FLAR-CIAT-NARCH-INTA-INIA-IRGA establecida. </li></ul>Capacitación Resultados Esperados
  8. 9. Capacitación
  9. 10. M. Cruz Capacitación
  10. 11. <ul><li>Evaluación preliminar de los marcadores moleculares, desarrollados en el NARCH, en el germoplasma usado por los integrantes del consorcio. </li></ul>Capacitación
  11. 12. C J. Rosas Capacitación
  12. 13. <ul><li>Evaluación de la variabilidad alélica de 371 materiales de arroz, en 21 loci asociados a la tolerancia al frío, en etapa reproductiva. </li></ul>Capacitación
  13. 14. Marcadores moleculares ligados a QTLs de tolerancia al frío en etapa reproductiva . J. Rosas N/D: No Disponible Capacitación Marcador Primer F Primer R QTL Ubicación BAC1 N/D N/D Ctb1 Brazo L cr.4 BAC22 N/D N/D Ctb1 Brazo L cr.4 PNK10 CGTGCATCCCTCTGTAGCATATG GTGTCTGAACATCTCATATGACACC Ctb1 Brazo L cr.4 RM3819 N/D N/D qCtb8 Brazo C cr.8 RM38-2 GCGCCATTGATGACTAATTG ATGGAAGAGGCAAGCAGAAG qCtb8 Brazo C cr.8
  14. 15. Caracterización genotípica M. Cruz T: Tolerante, T?: Por confirmar, H: Heterocigoto y S:Susceptible
  15. 16. Publicaciones <ul><li>Cruz, R.P. da. O arroz no Japão. Lavoura Arrozeira , Porto Alegre, v.57, n.451, p.23-26, Dez.2009 </li></ul><ul><li>Difusión del proyecto en : www.flar.org </li></ul><ul><li>Difusión en Visita Técnica de Investigadores del IRRI, al CIAT. </li></ul>
  16. 17. Publicaciones <ul><li>Aceptación de resumen para presentar en el Congreso Internacional del IRRI, Noviembre 2010, Vietnam. </li></ul><ul><li>Participación en la XI Conferencia Internacional de Arroz para América Latina y el Caribe, Septiembre 2010, Colombia. </li></ul>
  17. 18. Componentes 2009- 2010 <ul><li>Componente 1 </li></ul><ul><ul><li>Validación y estandarización de marcadores y metodologías de SAM desarrolladas en Japón y las que están disponibles al público. </li></ul></ul><ul><li>Componente 4 </li></ul><ul><ul><li>Capacitación y divulgación (Fortalecimiento Institucional). </li></ul></ul>
  18. 19. Componente 1 Resultados esperados <ul><li>Manuales y protocolos de evaluación fenotípica y genotípica para tolerancia al frío; afinamiento de las condiciones experimentales de evaluación genotípica y fenotípica. </li></ul>
  19. 20. Evaluación Fenotípica M. Cruz
  20. 21. Evaluación Fenotípica M. Cruz
  21. 22. Evaluación Fenotípica M. Cruz I = IT x CP J. Rosas
  22. 23. Evaluación Fenotípica <ul><li>Confirmación de la respuesta al frío en etapa reproductiva de 50 cultivares o líneas de arroz. </li></ul>M. Cruz
  23. 24. Evaluación Genotípica Protocolos <ul><li>Siembra y toma de muestras para selección asistida por marcadores moleculares. </li></ul><ul><li>Estandarización de protocolos de extracción del ADN. </li></ul>C. Quintero
  24. 25. Evaluación Genotípica Protocolos C. Quintero Siembra y Toma de muestra Extracción de ADN
  25. 26. Evaluación Genotípica Protocolos <ul><li>C. Estandarización de PCR. </li></ul><ul><li>D. Visualización de fragmentos en geles. </li></ul>C. Quintero
  26. 27. Evaluación Genotípica Protocolos C. Quintero
  27. 28. Evaluación Genotípica Genotipado <ul><li>A. Marcadores de NARCH-Japón. </li></ul><ul><li>B. Marcadores de UC Davis. </li></ul>C. Quintero
  28. 29. Formacion de poblaciones <ul><li>Confirmacion respuesta fenotipica y genotipica en condiciones controladas. </li></ul><ul><li>Informacion del comportamiento en condiciones de campo de variedades y lineas del cono sur latinoamericano. </li></ul>
  29. 30. Formacion de poblaciones <ul><li>Segregación en las lineas F7-FLAR, para la tolerancia al frio en etapa reproductiva. </li></ul><ul><li>Dificultad para el acceso a donantes con los principales marcadores y mejor tipo de planta. </li></ul>
  30. 31. Progenitores Tolerante Intermedio Susceptible Silewah Padi Labou Alumbis L 2825 CA L 3616 INIA TACUARI M 202 INIA OLIMAR IRGA 423 IRGA 424
  31. 32. Utilizacion de la informacion <ul><li>Identificacion de la presencia de marcadores moleculares en plantas F2, en poblaciones del proyecto. </li></ul><ul><li>Programacion de 180 cruzamientos triples del programa FLAR-TEMPLADO. </li></ul>
  32. 33. POA 2010- 2011
  33. 34. Componente 1 Resultados esperados <ul><li>Evaluación fenotípica por tolerancia al frío en etapa reproductiva de 20 cultivares por parte de los socios y 50 en FLAR. </li></ul><ul><li>Marcadores moleculares integrados en un esquema de SAM, replicar resultados en laboratorio de los miembros del consorcio. </li></ul><ul><li>Aplicar la SAM, en las poblaciones BC1F1, previo a efectuar el siguiente retrocruzamiento </li></ul>
  34. 35. Siembra BC1F1
  35. 36. Componente 1 Resultados esperados <ul><li>Avanzar por descendencia de semilla única tres poblaciones. </li></ul><ul><li>Efectuar cruzamientos con los donantes (Japón), una vez se nacionalicen. </li></ul>
  36. 37. Componente 2 Resultados esperados <ul><li>Metodologías de evaluación establecidas en las instituciones participantes. El equipo humano de las mismas aplica rutinariamente en sus programas de mejoramiento las metodologías de evaluación por tolerancia al frío en condiciones controladas, técnicas moleculares y análisis de datos. </li></ul>
  37. 38. Componente 2 Resultados esperados <ul><li>Poblaciones BC1F1 caracterizadas genotípicamente. </li></ul><ul><li>Relación por tolerancia al frío en etapa reproductiva, entre fenotipo y genotipo verificada. </li></ul>
  38. 39. Componente 3 Resultados esperados <ul><li>Relacionar los resultados obtenidos en condiciones controladas con los del estrés por frío en campo. </li></ul><ul><li>Seleccionar familias F3, con buena aceptabilidad fenotípica, dentro de las poblaciones F2 Simples Templado; sembradas en Treinta y Tres (Uruguay). </li></ul>
  39. 40. POA 2010-2011 Componente 4 IOV MDV Supuestos Asistir a entrenamiento y actualización en CIAT-FLAR, en técnicas estandarizadas de SAM para tolerancia al frío Una persona por país miembro actualizada en SAM Informe de avance, reporte de cruzamientos y base de datos. Registro de siembra Las políticas macroeconómicas y de propiedad intelectual permiten o facilitan la adquisición de equipos y tecnologías avanzadas
  40. 41. POA 2010-2011 Componente 4 IOV MDV Supuestos Realizar taller de implementación de la SAM, en el cono sur latinoamericano Tres personas por institución participando en el taller y personal invitado de universidades Informe de avance. Base de datos. Registro de asistencia. Informe de viaje Las políticas macroeconómicas y de propiedad intelectual permiten o facilitan la adquisición de equipos y tecnologías avanzadas
  41. 42. POA 2010-2011 Componente 4 IOV MDV Supuestos <ul><li>Generar Base de Datos </li></ul><ul><li>Participar en Congreso </li></ul><ul><li>Publicaciones </li></ul><ul><li>Red de información establecida </li></ul><ul><li>Asistencia al menos a un congreso </li></ul><ul><li>Una publicación en revista </li></ul><ul><li>Base de datos. </li></ul><ul><li>Registro de asistencia </li></ul><ul><li>Informe de viaje </li></ul><ul><li>Artículo publicado </li></ul>Las políticas macroeconómicas y de propiedad intelectual permiten o facilitan la adquisición de equipos y tecnologías avanzadas
  42. 43. Proyecto FTG-8009/08:“Selección asistida por marcadores moleculares para tolerancia al frío del arroz en el cono sur latinoamericano; una estrategia para enfrentar la inestabilidad climática”
  43. 44. Gracias

×