Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.
Next Generation Molecular Profiling
Lab for Bioinformatics and          computational genomics     10 “genome hackers”   mostly engineers (statistics)        ...
Next Generation Molecular Profiling
Overview           Personalized Medicine,              Biomarkers …              … Molecular Profiling           First Gen...
Overview           Personalized Medicine,              Biomarkers …              … Molecular Profiling           First Gen...
Personalized Medicine• The use of diagnostic tests (aka biomarkers) to identify in advance  which patients are likely to r...
BiomarkerFirst used in 1971 … An objective and  « predictive » measure … at the molecular  level … of normal and pathogeni...
Rationale 1:Why now ? Regulatory path becoming more clear                                                There is more at ...
Why now ?First and maturing second generation molecular  profiling methodologies allow to stratify clinical  trial partici...
Molecular ProfilingThe study of specific patterns (fingerprints) of proteins,DNA, and/or mRNA and how these patterns corre...
Generic Health advice• Exercise (Hypertrophic Cardiomyopathy)• Drink your milk (MCM6 Lactose intolarance)• Eat your green ...
Generic Health advice (UNLESS)• Exercise (Hypertrophic Cardiomyopathy)• Drink your milk (MCM6 Lactose intolarance)• Eat yo...
Generic Health advice (UNLESS)• Exercise (Hypertrophic Cardiomyopathy)• Drink your milk (MCM6 Lactose intolerance)• Eat yo...
Generic Health advice (UNLESS)• Exercise (Hypertrophic Cardiomyopathy)• Drink your milk (MCM6 Lactose intolerance)• Eat yo...
EGFR based therapy in mCRC
Overview           Personalized Medicine,              Biomarkers …              … Molecular Profiling           First Gen...
Before molecular profiling …
Before molecular profiling …
Before molecular profiling …
First Generation Molecular Profiling• Flow cytometry correlates surface markers,  cell size and other parameters• Circulat...
First Generation Molecular Profiling• Gene sequencing for mutation detection• Microarray for m-RNA message detection• RT-P...
Basics of the ―old‖ technology• Clone the DNA.• Generate a ladder of labeled (colored)  molecules that are different by 1 ...
Genetic Variation Among PeopleSingle nucleotide polymorphisms            (SNPs)  GATTTAGATCGCGATAGAG  GATTTAGATCTCGATAGAG ...
The genome fits as an e-mail attachment
First Generation Molecular Profiling• Gene sequencing for mutation detection• Microarray for m-RNA message detection• RT-P...
mRNA Expression Microarray
First Generation Molecular Profiling• Gene sequencing for mutation detection• Microarray for m-RNA message detection• RT-P...
Overview           Personalized Medicine,              Biomarkers …              … Molecular Profiling           First Gen...
Basics of the ―new‖ technology• Get DNA.• Attach it to something.• Extend and amplify signal with some color  scheme.• Det...
Next Generation Technologies• Roche (454)   –Emulsion PCR   –Polymerase   –Natural Nucleotides• 100-500 Mb for 5-15k   –1%...
One additional insight ...
Read Length is Not As Important For Resequencing                                                  100%               % of ...
Short Read Techologies• Illumina GA (HiSeq, MySeq)• ABI SOLID
Other second generation technology: (ABI) SOLID
So what ?
Second generation DNA/RNA profiling
Second Generation DNA profiling• Enrichment Sequencing    • ChIP-Seq (Chromosome      Immunoprecipitation)       • A subst...
Paired End Reads are Important!                                Known Distance               Repetitive DNA                ...
Paired End Reads are Important!                                Known Distance               Repetitive DNA                ...
Second Generation DNA profiling• Exome Sequencing (aka known as  targeted exome capture) is an  efficient strategy to sele...
Second Generation DNA profiling
Second Generation DNA profiling
Bioinformatics tools
Bioinformatics tools
Second Generation RNA profiling                      Besides the 6000 protein coding-genes …                      140 ribo...
Second Generation RNA profiling                       RNA genes can be hard to detects                       UGAGGUAGUAGGU...
Second Generation RNA profiling  Although details of the methods vary, the concept  behind RNA-seq is simple:        • iso...
Second Generation RNA profiling• Comparing to microarray    – Microarray        • Closed technology: Prior knowledge requi...
ncRNAs in human genome tRNA                    600   SRP RNA             1 18S rRNA                200   RNase P RNA      ...
Mapping Structural Variation in Humans           >1 kb segments                   - Thought to be Common                  ...
Size Distribution of CNV in a Human Genome
Next next generation sequencing Third generation sequencing       Now sequencing
Ultra-low-cost SINGLE molecule sequencing
Pacific Biosciences: A Third Generation Sequencing Technology                                                     Eid et a...
Complete genomics
Nanopore Sequencing
Second Generation Protein profiling• Proteomics MS-MS-based  exclusively in discovery mode• Automate diagnostics assay  ge...
MS/MS identificationpipeline overview                                              pipeline                               ...
Second Generation Protein profiling• Proteomics MS-MS-based  exclusively in discovery mode• Automate diagnostics assay  ge...
Overview           Personalized Medicine,              Biomarkers …              … Molecular Profiling           First Gen...
Defining Epigenetics                 Genome                                             DNA           Reversible changes ...
CONFIDENTIALMethylation   I   Epigenetics   |    Oncology    |   Biomarker              I   NEXT-GEN      |   PharmacoDX  ...
Epigenetic Regulation:Post Translational Modifications to Histones and Base Changes in DNA    Epigenetic modifications of...
MGMT BiologyO6 Methyl-GuanineMethyl TransferaseEssential DNA Repair EnzymeRemoves alkyl groups from damaged guaninebasesHe...
MGMT PromoterMethylation PredictsBenefit form DNA-Alkylating Chemotherapy  Post-hoc subgroup analysis of Temozolomide Clin...
Genome-wide methylationby methylation sensitive restriction enzymes                                                       ...
Genome-wide methylationby probes                                                                          CONFIDENTIAL    ...
Genome-wide methylation…. by next generation sequencing  # markers                Discovery                               ...
MBD_SeqCondensed Chromatin                        DNA Sheared                                                             ...
MBD_Seq                                                 Immobilized                                                 Methyl...
MBD_SeqMGMT = dual core                                                                        CONFIDENTIAL       Methylat...
Genome-wide methylation…. by next generation sequencing  # markers 1-2 million                             MBD_Seq methyla...
Data integrationCorrelation tracksexpression                            expression             Corr =-1                   ...
Correlation trackin GBM @ MGMT                                                                         +1                 ...
Genome-wide methylation…. by next generation sequencing  # markers                            MBD_Seq                Disco...
Deep Sequencing                  unmethylated alleles                  methylated alleles     less methylation            ...
Deep MGMTHeterogenic complexity                                                                        CONFIDENTIAL       ...
CONFIDENTIALMethylation   I   Epigenetics   |    Oncology    |   Biomarker                                                ...
Overview           Personalized Medicine,              Biomarkers …              … Molecular Profiling           First Gen...
Bioinformatics, a life science discipline …                                              Math                             ...
Bioinformatics, a life science discipline …                                              Math      Computer Science       ...
Bioinformatics, a life science discipline …                                              Math      Computer Science       ...
Bioinformatics, a life science discipline … management of expectations                                     Math Computer S...
Bioinformatics, a life science discipline … management of expectations                                     Math Computer S...
Translational Medicine: An inconvenient truth  • 1% of genome codes for proteins, however    more than 90% is transcribed ...
Translational Medicine: An inconvenient truth  • 1% of genome codes for proteins, however    more than 90% is transcribed ...
Cellular programming               Epigenetic (meta)information = stem cells
Cellular reprogrammingTumor                         Tumor                         Development                         and ...
Cellular reprogramming              Gene-specific              Epigenetic              reprogramming                119
Molecular profiling 2012
Molecular profiling 2012
Molecular profiling 2012
Molecular profiling 2012
Molecular profiling 2012
Molecular profiling 2012
Molecular profiling 2012
Molecular profiling 2012
Molecular profiling 2012
Molecular profiling 2012
Molecular profiling 2012
Molecular profiling 2012
Molecular profiling 2012
Molecular profiling 2012
Molecular profiling 2012
Molecular profiling 2012
Molecular profiling 2012
Molecular profiling 2012
Molecular profiling 2012
Molecular profiling 2012
Molecular profiling 2012
Molecular profiling 2012
Molecular profiling 2012
Molecular profiling 2012
Molecular profiling 2012
Molecular profiling 2012
Molecular profiling 2012
Molecular profiling 2012
Upcoming SlideShare
Loading in …5

Molecular profiling 2012


Published on

Next Generation Molecular Profiling

Published in: Education
  • Be the first to comment

  • Be the first to like this

Molecular profiling 2012

  1. 1. Next Generation Molecular Profiling
  2. 2. Lab for Bioinformatics and computational genomics 10 “genome hackers” mostly engineers (statistics) 42 scientists technicians, geneticists, clinicians >100 people hardware engineers,mathematicians, molecular biologists
  3. 3. Next Generation Molecular Profiling
  4. 4. Overview Personalized Medicine, Biomarkers … … Molecular Profiling First Generation Molecular Profiling Next Generation Molecular Profiling Next Generation Epigenetic Profiling Concluding Remarks
  5. 5. Overview Personalized Medicine, Biomarkers … … Molecular Profiling First Generation Molecular Profiling Next Generation Molecular Profiling Next Generation Epigenetic Profiling Concluding Remarks
  6. 6. Personalized Medicine• The use of diagnostic tests (aka biomarkers) to identify in advance which patients are likely to respond well to a therapy• The benefits of this approach are to – avoid adverse drug reactions – improve efficacy – adjust the dose to suit the patient – differentiate a product in a competitive market – meet future legal or regulatory requirements• Potential uses of biomarkers – Risk assessment – Initial/early detection – Prognosis – Prediction/therapy selection – Response assessment – Monitoring for recurrence
  7. 7. BiomarkerFirst used in 1971 … An objective and « predictive » measure … at the molecular level … of normal and pathogenic processes and responses to therapeutic interventionsCharacteristic that is objectively measured and evaluated as an indicator of normal biologic or pathogenic processes or pharmacologic response to a drugA biomarker is valid if: – It can be measured in a test system with well established performance characteristics – Evidence for its clinical significance has been established
  8. 8. Rationale 1:Why now ? Regulatory path becoming more clear There is more at stake than efficient drug development. FDA « critical path initiative » Pharmacogenomics guideline Biomarkers are the foundation of « evidence based medicine » - who should be treated, how and with what. Without Biomarkers advances in targeted therapy will be limited and treatment remain largely emperical. It is imperative that Biomarker development be accelarated along with therapeutics
  9. 9. Why now ?First and maturing second generation molecular profiling methodologies allow to stratify clinical trial participants to include those most likely to benefit from the drug candidate—and exclude those who likely will not—pharmacogenomics- basedClinical trials should attain more specific results with smaller numbers of patients. Smaller numbers mean fewer costs (factor 2-10)An additional benefit for trial participants and internal review boards (IRBs) is that stratification, given the correct biomarker, may reduce or eliminate adverse events.
  10. 10. Molecular ProfilingThe study of specific patterns (fingerprints) of proteins,DNA, and/or mRNA and how these patterns correlatewith an individuals physical characteristics orsymptoms of disease.
  11. 11. Generic Health advice• Exercise (Hypertrophic Cardiomyopathy)• Drink your milk (MCM6 Lactose intolarance)• Eat your green beans (glucose-6-phosphate dehydrogenase Deficiency)• & your grains (HLA-DQ2 – Celiac disease)• & your iron (HFE - Hemochromatosis)• Get more rest (HLA-DR2 - Narcolepsy)
  12. 12. Generic Health advice (UNLESS)• Exercise (Hypertrophic Cardiomyopathy)• Drink your milk (MCM6 Lactose intolarance)• Eat your green beans (glucose-6-phosphate dehydrogenase Deficiency)• & your grains (HLA-DQ2 – Celiac disease)• & your iron (HFE - Hemochromatosis)• Get more rest (HLA-DR2 - Narcolepsy)
  13. 13. Generic Health advice (UNLESS)• Exercise (Hypertrophic Cardiomyopathy)• Drink your milk (MCM6 Lactose intolerance)• Eat your green beans (glucose-6-phosphate dehydrogenase Deficiency)• & your grains (HLA-DQ2 – Celiac disease)• & your iron (HFE - Hemochromatosis)• Get more rest (HLA-DR2 - Narcolepsy)
  14. 14. Generic Health advice (UNLESS)• Exercise (Hypertrophic Cardiomyopathy)• Drink your milk (MCM6 Lactose intolerance)• Eat your green beans (glucose-6-phosphate dehydrogenase Deficiency)• & your grains (HLA-DQ2 – Celiac disease)• & your iron (HFE - Hemochromatosis)• Get more rest (HLA-DR2 - Narcolepsy)
  15. 15. EGFR based therapy in mCRC
  16. 16. Overview Personalized Medicine, Biomarkers … … Molecular Profiling First Generation Molecular Profiling Next Generation Molecular Profiling Next Generation Epigenetic Profiling Concluding Remarks
  17. 17. Before molecular profiling …
  18. 18. Before molecular profiling …
  19. 19. Before molecular profiling …
  20. 20. First Generation Molecular Profiling• Flow cytometry correlates surface markers, cell size and other parameters• Circulating tumor cell assays (CTC’s) quantitate the number of tumor cells in the peripheral blood.• Exosomes are 30-90 nm vesicles secreted by a wide range of mammalian cell types.• Immunohistochemistry (IHC) measures protein expression, usually on the cell surface.
  21. 21. First Generation Molecular Profiling• Gene sequencing for mutation detection• Microarray for m-RNA message detection• RT-PCR for gene expression• FISH analysis for gene copy number• Comparative Genome Hybridization (CGH) for gene copy number
  22. 22. Basics of the ―old‖ technology• Clone the DNA.• Generate a ladder of labeled (colored) molecules that are different by 1 nucleotide.• Separate mixture on some matrix.• Detect fluorochrome by laser.• Interpret peaks as string of DNA.• Strings are 500 to 1,000 letters long• 1 machine generates 57,000 nucleotides/run• Assemble all strings into a genome.
  23. 23. Genetic Variation Among PeopleSingle nucleotide polymorphisms (SNPs) GATTTAGATCGCGATAGAG GATTTAGATCTCGATAGAG 0.1% difference among people
  24. 24. The genome fits as an e-mail attachment
  25. 25. First Generation Molecular Profiling• Gene sequencing for mutation detection• Microarray for m-RNA message detection• RT-PCR for gene expression• FISH analysis for gene copy number• Comparative Genome Hybridization (CGH) for gene copy number
  26. 26. mRNA Expression Microarray
  27. 27. First Generation Molecular Profiling• Gene sequencing for mutation detection• Microarray for m-RNA message detection• RT-PCR for gene expression• FISH analysis for gene copy number• Comparative Genome Hybridization (CGH) for gene copy number
  28. 28. Overview Personalized Medicine, Biomarkers … … Molecular Profiling First Generation Molecular Profiling Next Generation Molecular Profiling Next Generation Epigenetic Profiling Concluding Remarks
  29. 29. Basics of the ―new‖ technology• Get DNA.• Attach it to something.• Extend and amplify signal with some color scheme.• Detect fluorochrome by microscopy.• Interpret series of spots as short strings of DNA.• Strings are 30-300 letters long• Multiple images are interpreted as 0.4 to 1.2 GB/run (1,200,000,000 letters/day).• Map or align strings to one or many genome.
  30. 30. Next Generation Technologies• Roche (454) –Emulsion PCR –Polymerase –Natural Nucleotides• 100-500 Mb for 5-15k –1% error rate –Homopolymers
  31. 31. One additional insight ...
  32. 32. Read Length is Not As Important For Resequencing 100% % of Paired K-mers with Uniquely 90% 80% Assignable Location 70% 60% E.COLI 50% HUMAN 40% 30% 20% 10% 0% 8 10 12 14 16 18 20 Length of K-mer Reads (bp)Jay Shendure
  33. 33. Short Read Techologies• Illumina GA (HiSeq, MySeq)• ABI SOLID
  34. 34. Other second generation technology: (ABI) SOLID
  35. 35. So what ?
  36. 36. Second generation DNA/RNA profiling
  37. 37. Second Generation DNA profiling• Enrichment Sequencing • ChIP-Seq (Chromosome Immunoprecipitation) • A substitute for ChIP-chip • Eg. to find the binding sequence of proteins (TFBS)
  38. 38. Paired End Reads are Important! Known Distance Repetitive DNA Read 1Unique DNA 2 Read Single read maps to multiple positions
  39. 39. Paired End Reads are Important! Known Distance Repetitive DNA Read 1Unique DNA 2 Read Single read maps to multiple positions
  40. 40. Second Generation DNA profiling• Exome Sequencing (aka known as targeted exome capture) is an efficient strategy to selectively sequence the coding regions of the genome to identify novel genes associated with rare and common disorders.• 160K exons
  41. 41. Second Generation DNA profiling
  42. 42. Second Generation DNA profiling
  43. 43. Bioinformatics tools
  44. 44. Bioinformatics tools
  45. 45. Second Generation RNA profiling Besides the 6000 protein coding-genes … 140 ribosomal RNA genes 275 transfer RNA gnes 40 small nuclear RNA genes >100 small nucleolar genes Function of RNA genes pRNA in 29 rotary packaging motor (Simpson et el. Nature 408:745-750,2000) Cartilage-hair hypoplasmia mapped to an RNA Contents-Schedule (Ridanpoa et al. Cell 104:195-203,2001) The human Prader-Willi ciritical region (Cavaille et al. PNAS 97:14035-7, 2000)
  46. 46. Second Generation RNA profiling RNA genes can be hard to detects UGAGGUAGUAGGUUGUAUAGU C.elegans let-27; 21 nt (Pasquinelli et al. Nature 408:86-89,2000) Often small Sometimes multicopy and redundant Often not polyadenylated (not represented in ESTs) Immune to frameshift and nonsense mutations No open reading frame, no codon bias Often evolving rapidly in primary sequence
  47. 47. Second Generation RNA profiling Although details of the methods vary, the concept behind RNA-seq is simple: • isolate all mRNA • convert to cDNA using reverse transcriptase • sequence the cDNA • map sequences to the genome The more times a given sequence is detected, the more abundantly transcribed it is. If enough sequences are generated, a comprehensive and quantitative view of the entire transcriptome of an organism or tissue can be obtained.
  48. 48. Second Generation RNA profiling• Comparing to microarray – Microarray • Closed technology: Prior knowledge required • Affected by pseudo-genes (homologous of real genes) • Low sensitivity – RNA-Seq • Open technology: No prior knowledge required • Not affected by pseudo-genes because exact sequence is measured • Other information could be yielded (SNP, Alternative splicing)
  49. 49. ncRNAs in human genome tRNA 600 SRP RNA 1 18S rRNA 200 RNase P RNA 1 5.8S rRNA 200 Telomerase RNA 1 28S rRNA 200 RNase MRP 1 5S rRNA 200 Y RNA 5 snoRNA 300 miRNA 250 Vault 4 U1 40 7SK RNA 1 U2 30 Xist 1 U4 30 H19 1 U5 30 BIC 1 U6 20 U4atac 5 Antisense RNAs 1000s? U6atac 5 Cis reg regions 100s? U11 5 U12 5 Others ?
  50. 50. Mapping Structural Variation in Humans >1 kb segments - Thought to be Common 12% of the genome (Redon et al. 2006) - Likely involved in phenotype variation and disease CNVs - Until recently most methods for detection were low resolution (>50 kb)
  51. 51. Size Distribution of CNV in a Human Genome
  52. 52. Next next generation sequencing Third generation sequencing Now sequencing
  53. 53. Ultra-low-cost SINGLE molecule sequencing
  54. 54. Pacific Biosciences: A Third Generation Sequencing Technology Eid et al 2008
  55. 55. Complete genomics
  56. 56. Nanopore Sequencing
  57. 57. Second Generation Protein profiling• Proteomics MS-MS-based exclusively in discovery mode• Automate diagnostics assay generation (next generation proteomics) • Aptamers as alternative to antibodies • ImmunoPCR
  58. 58. MS/MS identificationpipeline overview pipeline Goal filter dataset Goal prior to multi-tiered database Goal search database Bonanza define PTMs search profile prior to database search Bonanza + IggyPep
  59. 59. Second Generation Protein profiling• Proteomics MS-MS-based exclusively in discovery mode• Automate diagnostics assay generation (next generation proteomics) • Aptamers as alternative to antibodies • ImmunoPCR
  60. 60. Overview Personalized Medicine, Biomarkers … … Molecular Profiling First Generation Molecular Profiling Next Generation Molecular Profiling Next Generation Epigenetic Profiling Concluding Remarks
  61. 61. Defining Epigenetics Genome DNA  Reversible changes in gene expression/function  Without changes in DNA Chromatin sequence Epigenome  Can be inherited from precursor cells Gene Expression  Allows to integrate intrinsic with environmental signals Phenotype (including diet) CONFIDENTIAL Methylation I Epigenetics | Oncology | Biomarker I NEXT-GEN | PharmacoDX | CRC
  62. 62. CONFIDENTIALMethylation I Epigenetics | Oncology | Biomarker I NEXT-GEN | PharmacoDX | CRC
  63. 63. Epigenetic Regulation:Post Translational Modifications to Histones and Base Changes in DNA  Epigenetic modifications of histones and DNA include: – Histone acetylation and methylation, and DNA methylation Histone Methylation Me Me Histone Me Acetylation Ac DNA Methylation CONFIDENTIAL Methylation I Epigenetics | Oncology | Biomarker I NEXT-GEN | PharmacoDX | CRC
  64. 64. MGMT BiologyO6 Methyl-GuanineMethyl TransferaseEssential DNA Repair EnzymeRemoves alkyl groups from damaged guaninebasesHealthy individual: - MGMT is an essential DNA repair enzyme Loss of MGMT activity makes individuals susceptible to DNA damage and prone to tumor developmentGlioblastoma patient on alkylator chemotherapy: - Patients with MGMT promoter methylation show have longer PFS and OS with the use of alkylating agents as chemotherapy CONFIDENTIAL Methylation I Epigenetics | Oncology | Biomarker I NEXT-GEN | PharmacoDX | CRC
  65. 65. MGMT PromoterMethylation PredictsBenefit form DNA-Alkylating Chemotherapy Post-hoc subgroup analysis of Temozolomide Clinical trial with primary glioblastoma patients show benefit for patients with MGMT promoter methylation Median Overall Survival 25 21.7 months 20 plus temozolomide 15 12.7 months 10 radiotherapy radiotherapy 5 Adapted from Hegi et al. NEJM 2005 0 352(10):1036-8. Non-Methylated Methylated Study with 207 patients MGMT Gene MGMT Gene CONFIDENTIAL Methylation I Epigenetics | Oncology | Biomarker I NEXT-GEN | PharmacoDX | CRC
  66. 66. Genome-wide methylationby methylation sensitive restriction enzymes CONFIDENTIAL Methylation I Epigenetics | Oncology | Biomarker I NEXT-GEN | PharmacoDX | CRC
  67. 67. Genome-wide methylationby probes CONFIDENTIAL Methylation I Epigenetics | Oncology | Biomarker I NEXT-GEN | PharmacoDX | CRC
  68. 68. Genome-wide methylation…. by next generation sequencing # markers Discovery Verification Validation # samples CONFIDENTIAL Methylation I Epigenetics | Oncology | Biomarker I NEXT-GEN | PharmacoDX | CRC
  69. 69. MBD_SeqCondensed Chromatin DNA Sheared Immobilized Methyl Binding Domain DNA Sheared CONFIDENTIAL Methylation I Epigenetics | Oncology | Biomarker I NEXT-GEN | PharmacoDX | CRC
  70. 70. MBD_Seq Immobilized Methyl binding domain MgCl2 Next Gen Sequencing GA Illumina: 100 million reads CONFIDENTIAL Methylation I Epigenetics | Oncology | Biomarker I NEXT-GEN | PharmacoDX | CRC
  71. 71. MBD_SeqMGMT = dual core CONFIDENTIAL Methylation I Epigenetics | Oncology | Biomarker I NEXT-GEN | PharmacoDX | CRC
  72. 72. Genome-wide methylation…. by next generation sequencing # markers 1-2 million MBD_Seq methylation cores Discovery # samples CONFIDENTIAL Methylation I Epigenetics | Oncology | Biomarker I NEXT-GEN | PharmacoDX | CRC
  73. 73. Data integrationCorrelation tracksexpression expression Corr =-1 Corr = 1 methylation methylation CONFIDENTIAL 99
  74. 74. Correlation trackin GBM @ MGMT +1 -1 CONFIDENTIAL Methylation I Epigenetics | Oncology | Biomarker 100 I NEXT-GEN | PharmacoDX |
  75. 75. Genome-wide methylation…. by next generation sequencing # markers MBD_Seq Discovery 454_BT_Seq Verification MSP Validation # samples CONFIDENTIAL Methylation I Epigenetics | Oncology | Biomarker I NEXT-GEN | PharmacoDX |
  76. 76. Deep Sequencing unmethylated alleles methylated alleles less methylation more methylation CONFIDENTIALGCATCGTGACTTACGACTGATCGATGGATGCTA
  77. 77. Deep MGMTHeterogenic complexity CONFIDENTIAL Methylation I Epigenetics | Oncology | Biomarker I NEXT-GEN | PharmacoDX | CRC
  78. 78. 104
  79. 79. CONFIDENTIALMethylation I Epigenetics | Oncology | Biomarker 105 I NEXT-GEN | PharmacoDX | CRC
  80. 80. Overview Personalized Medicine, Biomarkers … … Molecular Profiling First Generation Molecular Profiling Next Generation Molecular Profiling Next Generation Epigenetic Profiling Concluding Remarks
  81. 81. Bioinformatics, a life science discipline … Math (Molecular) Informatics Biology
  82. 82. Bioinformatics, a life science discipline … Math Computer Science Theoretical Biology (Molecular) Informatics Biology Computational Biology
  83. 83. Bioinformatics, a life science discipline … Math Computer Science Theoretical Biology Bioinformatics (Molecular) Informatics Biology Computational Biology
  84. 84. Bioinformatics, a life science discipline … management of expectations Math Computer Science Theoretical Biology NP AI, Image Analysis Datamining structure prediction (HTX) Bioinformatics Interface Design Expert Annotation Sequence Analysis (Molecular)Informatics Biology Computational Biology
  85. 85. Bioinformatics, a life science discipline … management of expectations Math Computer Science Theoretical Biology NP AI, Image Analysis Datamining structure prediction (HTX) Bioinformatics Discovery Informatics – Computational Genomics Interface Design Expert Annotation Sequence Analysis (Molecular)Informatics Biology Computational Biology
  86. 86. Translational Medicine: An inconvenient truth • 1% of genome codes for proteins, however more than 90% is transcribed • Less than 10% of protein experimentally measured can be ―explained‖ from the genome • 1 genome ? Structural variation • > 200 Epigenomes ?? • Space/time continuum …
  87. 87. Translational Medicine: An inconvenient truth • 1% of genome codes for proteins, however more than 90% is transcribed • Less than 10% of protein experimentally measured can be ―explained‖ from the genome • 1 genome ? Structural variation • > 200 Epigenomes … • ―space/time‖ continuum
  88. 88. Cellular programming Epigenetic (meta)information = stem cells
  89. 89. Cellular reprogrammingTumor Tumor Development and GrowthEpigeneticallyaltered, self-renewing cancerstem cells
  90. 90. Cellular reprogramming Gene-specific Epigenetic reprogramming
  91. 91. 119
