2014 03 28_next_generation_epigenetic_profling_v_les_epigenetica_vweb

1,484 views

Published on

Epigenetics

Published in: Education, Technology
0 Comments
1 Like
Statistics
Notes
  • Be the first to comment

No Downloads
Views
Total views
1,484
On SlideShare
0
From Embeds
0
Number of Embeds
1,161
Actions
Shares
0
Downloads
13
Comments
0
Likes
1
Embeds 0
No embeds

No notes for slide

2014 03 28_next_generation_epigenetic_profling_v_les_epigenetica_vweb

  1. 1. Next Generation Epigenetic Profiling Wim Van Criekinge 28th March 2014, UGent (BE)
  2. 2. Overview   Epigene,cs   –   Introduc*on   –   Methyla*on  &  Oncology   –   Biomarkers     MDxHealth   – NEXT-­‐GENera*on  Epigene*c  Biomarkers   – Methyla*on  Based  CDx  
  3. 3. Confidential Information | ©2013 MDxHealth Inc. All rights reserved.
  4. 4. Actionable Epigenome
  5. 5. Outside Oncology ?
  6. 6. Historically,     Cancer  Was  Considered     to  be  Driven  Mostly  by  Gene,c  Changes     Example:   Replica,on  errors   GENETIC   Altered     DNA/mRNA/proteins   Altered     DNA  sequence       X   X   Oncogenesis   Tumor   §  Muta*ons  in  p53     §  Ac*va*ng  muta*ons  in  RAS   §  Muta*ons  or  amplifica*ons  of  the   HER-­‐2  gene   §  Chromosomal  transloca*ons  in   myeloid  cells  and  the  genera*on  of   the  BCR-­‐ABL  fusion  protein    
  7. 7. Epigene,c  Changes  are     Important  in  Causing  Cancer   Example:   Replica,on  errors   GENETIC   EPIGENETIC   Example:     Chroma,n  modifica,on  errors   Altered     DNA/mRNA/proteins   Altered     DNA  sequence       Altered  levels  of   mRNA/proteins   Altered   chroma,n  structure   X   X   Oncogenesis   Tumor  
  8. 8. Source:  Schuebel  et  al    2007   0   20   40   60   80   100   120   Methylated Mutated 76-100 51-75 21-50 1-20 Dx CDx Example  of  Methyla,on     vs  Muta,on:  Colon  &  Breast  Cancer  
  9. 9. MGMT Biology O6 Methyl-Guanine Methyl Transferase                    Essential DNA Repair Enzyme Removes alkyl groups from damaged guanine bases Healthy  individual:     -­‐  MGMT  is  an  essen*al  DNA  repair  enzyme   Loss  of  MGMT  ac*vity  makes  individuals  suscep*ble   to  DNA  damage  and  prone  to  tumor  development     Glioblastoma  pa,ent  on  alkylator  chemotherapy:     -­‐  Pa*ents  with  MGMT  promoter  methyla*on  show   have  longer  PFS  and  OS  with  the  use  of  alkyla*ng   agents  as  chemotherapy  
  10. 10. MGMT Promoter Methylation Predicts Benefit form DNA-Alkylating Chemotherapy Post-hoc subgroup analysis of Temozolomide Clinical trial with primary glioblastoma patients show benefit for patients with MGMT promoter methylation 0 5 10 15 20 25 Median  Overall  Survival   21.7 months 12.7 months radiotherapy plus temozolomide Methylated MGMT Gene Non-Methylated MGMT Gene radiotherapy Adapted  from  Hegi  et  al.   NEJM  2005   352(10):1036-­‐8.   Study  with  207  pa*ents  
  11. 11. Overview   Epigene,cs   –   Introduc*on   –   Methyla*on  &  Oncology   –   Biomarkers     MDxHealth   – NEXT-­‐GENera*on  Epigene*c  Biomarkers   Can  we  rediscover  MGMT  ?     What  does  the  epigenome  look  like  ?  
  12. 12. MBD_Seq   DNA  Sheared   Immobilized     Methyl  Binding  Domain     Condensed  Chroma*n   DNA  Sheared  
  13. 13. Immobilized     Methyl  binding  domain     MgCl2   Next  Gen  Sequencing   GA  Illumina:  100  million  reads   MBD_Seq  
  14. 14. Confidential Information | ©2013 MDxHealth Inc. All rights reserved. Quality  evalua*on  of  Methyl  Binding  Domain  based   kits  for  enrichment  DNA-­‐methyla*on  sequencing   De  Meyer  et  al  (2013)     Plos  One    
  15. 15. MBD_Seq   MGMT  =  dual  core  
  16. 16. GCATCGTGACTAGCGACTGATCGATGGATGCTAGCAT Where  is  the  mC  ?  
  17. 17. GCATCGTGACTAGCGACTGATCGATGGATGCTAGCAT
  18. 18. GCATCGTGACTAGCGACTGATCGATGGATGCTAGCAT 25%   50%   25%   GCATCGTGACTAGCGACTGATCGATGGATGCTAGCAT
  19. 19. GCATCGTGACTAGCGACTGATCGATGGATGCTAGCAT 25%   50%   25%   GCATCGTGACTAGCGACTGATCGATGGATGCTAGCAT GCATCGTGACTAGCGACTGATCGATGGATGCTAGCAT Dense  methylated  needed  for  transcrip*onal  silencing   Are  there  alleles  with  all  three  posi4ons  methylated  ?  
  20. 20. GCATCGTGACTTACGACTGATCGATGGATGCTAGCAT! unmethylated  alleles   less  methyla*on  methylated  alleles   more  methyla*on   Deep  Sequencing  
  21. 21. Deep  Sequencing  MGMT  Heterogenic  complexity  
  22. 22. #  samples   #  markers   MBD_Seq   BT_Seq   Genome-­‐wide  methyla,on     ….  by  next  genera,on  sequencing   Discovery   Verifica*on   Valida*on  
  23. 23. Assay  Technology:    Methyla,on-­‐ Specific  PCR  (MSP)   DNA Modification 1 2 Methyl Cytosine Methyl Cytosine Uracil Primer Choice DNA modification chemical Cytosine To  design  PCR  primers  to  differen*ate  methylated  from   unmethylated  we  take  advantage  of  the  base  pair  binding   proper*es  of  Uracil  
  24. 24. 3 amplification occurs when methylation specific primers bind to the promoter DNA Amplification and Detection by quantitative PCR MSPrimer MSPrimer Methylated CPG Islands Ct  value   Signal  change  per  cycle   Assay  Technology:    Methyla,on-­‐ Specific  PCR  (MSP)  
  25. 25. Confidential Information | ©2013 MDxHealth Inc. All rights reserved. Gene,c  tes,ng   107 106 105 104 103 102 101 1108109 Full genome bp Whole-genome Bisulphite seq MSP Probes (450-27K) Enrichment Targeted Panels
  26. 26. Confidential Information | ©2013 MDxHealth Inc. All rights reserved. Gene,c  tes,ng   107 106 105 104 103 102 101 1108109 Full genome bp         G   E   N   E   T   I   C   Whole-genome sequencing Enrichment seq (Exome) PCR Enrichment Targeted Panels Instrument  and  Assay  providers   CLIA  Lab  service  providers  
  27. 27. Confidential Information | ©2013 MDxHealth Inc. All rights reserved. §  An  epigene*c  assay  to  help  dis*nguish  pa*ents  who  have  a  true-­‐nega*ve   biopsy  from  those  who  may  have  occult  cancer.   §  Provides  urologists  with  ac*onable  informa*on  to  help:   − RULE  OUT  prostate-­‐cancer-­‐free  men  from  undergoing  unnecessary  repeat  biopsies   − RULE  IN  those  who  require  repeat  biopsies  and  poten4al  treatment   Addressing  False-­‐Nega,ve   Biopsy  Concerns  

×