2012 12 02_epigenetic_profiling_environmental_health_sciences

1,888 views

Published on

Epigenetics in Evironmental Health Sciences

Published in: Education
0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total views
1,888
On SlideShare
0
From Embeds
0
Number of Embeds
1,428
Actions
Shares
0
Downloads
27
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide

2012 12 02_epigenetic_profiling_environmental_health_sciences

  1. 1. Slides availablewww.bioinformatics.be 4th December 2012 Johns Hopkins Bloomberg School of Public Health
  2. 2. Lab for Bioinformatics and computational genomics 10 “genome hackers” mostly engineers (statistics) 42 scientists technicians, geneticists, clinicians >100 people hardware engineers,mathematicians, molecular biologists
  3. 3. Can bioinformatics bridge the gap ?
  4. 4. The genome is just the start …
  5. 5. 250 different cell types Epigenetic (meta)information = stem cells
  6. 6. Cellular programming Epigenetic (meta)information = stem cells
  7. 7. Defining  Epigene*cs     Genome   DNA   §  Reversible  changes  in  gene   expression/func5on   §  Without  changes  in  DNA   Chroma*n   sequence   Epigenome   §  Can  be  inherited  from   precursor  cells   Gene  Expression   §  Allows  to  integrate  intrinsic   with  environmental  signals   Phenotype   (including  diet)  
  8. 8. DNA Methylation Differentiates Totipotent EmbryonicStem Cells from Unipotent Adult Stem Cells! Alex Meissner, Henry Stewart Talks
  9. 9. Reprogramming the DNA methylome Paula Vertino, Henry Stewart Talks
  10. 10. Transgenerational inheritence
  11. 11. The  epigenome    is  ac5onable  
  12. 12. The  epigenome    is  ac5onable  
  13. 13. Epigene*c  Changes  are    Important  in  Causing  Cancer   GENETIC   EPIGENETIC   Example:   Example:     Replica*on  errors   Chroma*n  modifica*on  errors   X   X   Altered     Altered   DNA  sequence     chroma*n  structure     Oncogenesis   Altered     Altered  levels  of   DNA/mRNA/proteins   mRNA/proteins   Tumor  
  14. 14. Example  of  Methyla*on    vs  Muta*on:  Colon  &  Breast  Cancer   120   100   80   60   Dx   40   20   CDx   0   Methylated   Mutated   Source:  Schuebel  et  al    2007   76-­‐100   51-­‐75   21-­‐50   1-­‐20  
  15. 15. MGMT  Biology  O6  Methyl-­‐Guanine  Methyl  Transferase    Essen5al  DNA  Repair  Enzyme    Removes  alkyl  groups  from  damaged  guanine  bases    Healthy  individual:     -­‐  MGMT  is  an  essen5al  DNA  repair  enzyme   Loss  of  MGMT  ac5vity  makes  individuals  suscep5ble   to  DNA  damage  and  prone  to  tumor  development    Glioblastoma  pa*ent  on  alkylator  chemotherapy:     -­‐  Pa5ents  with  MGMT  promoter  methyla5on  show   have  longer  PFS  and  OS  with  the  use  of  alkyla5ng   agents  as  chemotherapy  
  16. 16. MGMT  Promoter    Methyla*on  Predicts    Benefit  form  DNA-­‐Alkyla*ng  Chemotherapy   Post-­‐hoc  subgroup  analysis  of  Temozolomide  Clinical  trial  with  primary  glioblastoma   pa5ents  show  benefit  for  pa5ents  with  MGMT  promoter  methyla5on   Median  Overall  Survival   25 21.7 months 20 plus temozolomide 15 12.7 months radiotherapy 10 radiotherapy 5 Adapted  from  Hegi  et  al.   NEJM  2005   0 352(10):1036-­‐8.   Non-­‐Methylated     Methylated     Study  with  207  pa5ents   MGMT  Gene   MGMT  Gene  
  17. 17. Profiling  the  Epigenome   #  markers   Discovery   Verifica5on   Valida5on   #  samples  
  18. 18. Genome-­‐wide  methyla*on    by  methyla*on  sensi*ve  restric*on  enzymes  
  19. 19. Genome-­‐wide  methyla*on    by  probes  
  20. 20. Profiling  the  Epigenome  By  next  gen  sequencing   #  markers   Discovery   Verifica5on   Valida5on   #  samples  
  21. 21. MBD_Seq  Condensed  Chroma5n   DNA  Sheared   Immobilized     Methyl  Binding  Domain     DNA  Sheared  
  22. 22. MBD_Seq   Immobilized     Methyl  binding  domain     MgCl2   Next  Gen  Sequencing   GA  Illumina:  100  million  reads  
  23. 23. Kit  Comparison   0.25 ● ● 0.20 ● Fraction of reads 0.15 ● 0.10 ● 0.05 ● ● ● ● ● 0.00 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● 0 10 20 30 40 50 Number of CGs 25  
  24. 24. MBD_Seq  MGMT  =  dual  core  
  25. 25. Profiling  the  epigenome  ….  by  next  genera*on  sequencing   #  markers   1-­‐2  million   MBD_Seq   methyla5on   cores     Discovery   #  samples  
  26. 26. Bock et al, Nature, 2012Bock et al. Nature 201228
  27. 27. 29
  28. 28. Data  integra*on  Correla*on  tracks    expression expression Corr =-1 Corr = 1 methylation methylation 30  
  29. 29. Correla*on  track  in  GBM  @  MGMT   +1 -1 31  
  30. 30. Next_next  miRNA,  (l)ncRNA,  CIS/TRANS  splicing,  SV,  fusion  loci  ,  bidirec*onal  promoters  ?    RNA_seq:  sequence  RNA  molecules  Next  Gen  Pla`orm    Total  RNA_seq:  all  RNA  molecules  (normalisa*on  procedure)    Direc*onal  Total  RNA_seq:  before  amplifica*on  use  different  5’  and  3’  adaptors    Integrated  Direc*onal  Total  RNA_seq:  Combine  with  other  datasets  eg.  enrichment  sequencing  data,  visualise  and  query  in  genome  browser   32  
  31. 31. Direc*on  RNAseq    bidirec*onal  promoters   33  
  32. 32. Profiling  the  Epigenome  ….  by  next  genera*on  sequencing   #  markers   MBD_Seq   Discovery   454_BT_Seq   Verifica5on   Valida5on   #  samples  
  33. 33. Where  is  the  mC  ?  GCATCGTGACTAGCGACTGATCGATGGATGCTAGCAT
  34. 34. GCATCGTGACTAGCGACTGATCGATGGATGCTAGCAT
  35. 35. GCATCGTGACTAGCGACTGATCGATGGATGCTAGCAT 25%   50%   25%  GCATCGTGACTAGCGACTGATCGATGGATGCTAGCAT
  36. 36. GCATCGTGACTAGCGACTGATCGATGGATGCTAGCAT 25%   50%   25%  GCATCGTGACTAGCGACTGATCGATGGATGCTAGCATGCATCGTGACTAGCGACTGATCGATGGATGCTAGCAT Dense  methylated  needed  for  transcrip5onal  silencing   Are  there  alleles  with  all  three  posi.ons  methylated  ?  
  37. 37. Deep  Sequencing   unmethylated  alleles   methylated  alleles   less  methyla5on   more  methyla5on  GCATCGTGACTTACGACTGATCGATGGATGCTAGCAT!
  38. 38. Deep  MGMT  Heterogenic  complexity  
  39. 39. Conclusion  Combina5on  of  different  sequencing  techniques  is  emerging  as  best  prac5ce  Bioinforma5cs  is  challenging  §  Methods  for  normalisa5on  under   construc5on  §  Reference  databases  are  generated    Data  visualiza5on  and  integra5on  is  key     41  
  40. 40. Slides availablewww.bioinformatics.be 4th December 2012 Johns Hopkins Bloomberg School of Public Health
  41. 41. biobix wvcriekibiobix.bebioinformatics.be 43  

×