Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.
Wesley De Neve
wesley.deneve@ghent.ac.kr
Ghent University – iMinds & KAIST
Songdo, Incheon, Korea
September 23, 2016
Ghent...
2
• Academic credentials
- Master’s degree in computer science (2002)
• at Ghent University, Belgium
- Ph.D. degree in com...
3
Teaching
Informatics
(Fall and Spring term of BA1 – 10 credits)
Bioinformatics
(Fall term of BA3 – MBT – 5 credits)
4
• Main track
- deep machine learning for analysis of
• multimedia data (Belgium)
• biotech data (Korea)
• Side track
- c...
5
Deep Machine Learning
Google DeepMind +
Ghent University
6
Breast Cancer Diagnosis and Segmentation (Mijung Kim)
Mammogram image
Normal
Benign
Malignant
1) Classify an input image...
7
Prediction of Drug-Target Interaction (Mijung Kim)
PCBA-2326
Target enzyme CID 2827036
Target enzyme CID 1014390
Target ...
8
Sleep Apnea Detection (Mijung Kim)
Normal Apnea Normal
1) Feature extraction from
raw data – synchronized
polysomnograph...
9
Splice Site Detection (Jasper Zuallaert)
… ACCAGGTAAGCGCATCCGACATCTCTCAACGAGTCGAC …
In cooperation with VIB (www.vib.be)...
10
wesley.deneve@ghent.ac.kr Office room Gh1004
Upcoming SlideShare
Loading in …5
×

Ghent University Global Campus - Sungkyunkwan University: Workshop on Research and Academic Development

109 views

Published on

Ghent University Global Campus - Sungkyunkwan University: Workshop on Research and Academic Development

Published in: Education
  • Be the first to comment

  • Be the first to like this

Ghent University Global Campus - Sungkyunkwan University: Workshop on Research and Academic Development

  1. 1. Wesley De Neve wesley.deneve@ghent.ac.kr Ghent University – iMinds & KAIST Songdo, Incheon, Korea September 23, 2016 Ghent University Global Campus - Sungkyunkwan University Workshop on Research and Academic Development
  2. 2. 2 • Academic credentials - Master’s degree in computer science (2002) • at Ghent University, Belgium - Ph.D. degree in computer science engineering (2007) • at Ghent University, Belgium • Current employment - IDLab @ Ghent University – iMinds – imec, Belgium (since 2002) - Image and Video Systems Lab @ KAIST, Korea (since 2007) - Center for Biotech Data Science @ GUGC, Korea (since 2014) Professional Background
  3. 3. 3 Teaching Informatics (Fall and Spring term of BA1 – 10 credits) Bioinformatics (Fall term of BA3 – MBT – 5 credits)
  4. 4. 4 • Main track - deep machine learning for analysis of • multimedia data (Belgium) • biotech data (Korea) • Side track - compression of genomic data using tools for video coding (Belgium) Research
  5. 5. 5 Deep Machine Learning Google DeepMind + Ghent University
  6. 6. 6 Breast Cancer Diagnosis and Segmentation (Mijung Kim) Mammogram image Normal Benign Malignant 1) Classify an input image as either normal (no lesion), benign, or malignant 2) Upon classification as either benign or malignant, segment the lesion Upon classification as normal, no segmentation is used The red part of the heat map below shows where the lesion is located Targeted participation in the Digital Mammography DREAM challenge
  7. 7. 7 Prediction of Drug-Target Interaction (Mijung Kim) PCBA-2326 Target enzyme CID 2827036 Target enzyme CID 1014390 Target enzyme CID 332939... 1) Feed a new or an existing drug compound into a neural network 2) The output of the neural network shows which target interacts with the drug compound On hold, due to a lack of data and expert knowledge
  8. 8. 8 Sleep Apnea Detection (Mijung Kim) Normal Apnea Normal 1) Feature extraction from raw data – synchronized polysomnography (PSG) data: EEG, EOG, EMG, … 2) Feed features into a neural network for classification purposes 3) The result is one of three classes – normal, apnea, or hypopnea Under discussion with imec (www2.imec.be)
  9. 9. 9 Splice Site Detection (Jasper Zuallaert) … ACCAGGTAAGCGCATCCGACATCTCTCAACGAGTCGAC … In cooperation with VIB (www.vib.be) 1) Search for patterns using convolutional windows 2) Combine patterns found to classify a candidate splice site as a true splice site or as a pseudo splice site … ACCAGGTAAGCGCATCCGACATCTCTCAACGAGTCGAC … True splice site
  10. 10. 10 wesley.deneve@ghent.ac.kr Office room Gh1004

×