Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.


Related Books

Free with a 30 day trial from Scribd

See all
  • Be the first to comment

  • Be the first to like this


  1. 1. L’EVOLUTION DE LA LIGNEE HUMAINE: L’HOMME, LA PALEONTOLOGIE, LES GENES ET LES GENOMES Ludovic ORLANDO Décembre 2008 Paléogénétique et Evolution moléculaire (33)4 72 72 84 65 [email_address] [email_address] Décembre 2008
  4. 4. INTRODUCTION GRANDS SINGES & HOMMES: DIVERSITE GENETIQUE <ul><li>>7 GINDIVIDUS </li></ul><ul><li>FAIBLE DIVERSITE GENETIQUE </li></ul>Xq13.3 mtDNA HVR-1 HOMMES MODERNES [email_address] Décembre 2008 70 30 5 10 14
  5. 5. <ul><li>L’Homo sapiens EVENT </li></ul><ul><li>Out of Africa vs Multirégionalisme </li></ul><ul><li>2. La sortie d’Afrique </li></ul><ul><li>3. La rencontre avec les autres hommes fossiles </li></ul><ul><li>4. L’origine génomique de nos particularités </li></ul><ul><li>L’homme et le chimpanzé: si loins, si proches… </li></ul>L’EVOLUTION DE LA LIGNEE HUMAINE: L’HOMME, LA PALEONTOLOGIE, LES GENES ET LES GENOMES [email_address] Décembre 2008
  6. 6. L’HOMO SAPIENS EVENT LES ORIGINES FOSSILES 400 - 30 KYA OMO-1 OMO-2 Herto [email_address] Décembre 2008 196 ±2 104 ±1 154±7 >160 Homo neanderthalensis Homo «erectus» Homo sapiens
  7. 7. L’HOMO SAPIENS EVENT L’OUT OF AFRICA (REMPLACEMENT RAPIDE) [email_address] Décembre 2008
  8. 8. L’HOMO SAPIENS EVENT L’OUT OF AFRICA (REMPLACEMENT RAPIDE) [email_address] Décembre 2008
  9. 9. L’HOMO SAPIENS EVENT L’OUT OF AFRICA (REMPLACEMENT RAPIDE) [email_address] Décembre 2008
  10. 10. L’HOMO SAPIENS EVENT L’OUT OF AFRICA (REMPLACEMENT RAPIDE) [email_address] Décembre 2008
  14. 14. L’HOMO SAPIENS EVENT LE MULTIREGIONALISME [email_address] Décembre 2008
  15. 15. L’HOMO SAPIENS EVENT LE MULTIREGIONALISME HOMO « ERECTUS » [email_address] Décembre 2008
  18. 18. L’HOMO SAPIENS EVENT LES OBSERVATIONS: L’EVE AFRICAINE (PREDICTIONS #1 & #3) <ul><li>147 mtDNA </li></ul><ul><li>PROFILS DE RESTRICTION </li></ul><ul><li>DIVERSITE + DISTANCES ENTRE COUPLES </li></ul>[email_address] Décembre 2008
  19. 19. L’HOMO SAPIENS EVENT LES OBSERVATIONS (PREDICTIONS #1 & #3) [email_address] Décembre 2008
  20. 20. L’HOMO SAPIENS EVENT 1 LOCUS vs N LOCI GENEALOGIE DES GENES vs DES INDIVIDUS [email_address] Décembre 2008
  21. 21. L’HOMO SAPIENS EVENT 1 LOCUS vs N LOCI G 0 G 1 <ul><li>MODELISATION MULTIREGIONALE SIMPLE </li></ul><ul><li>APPROCHE PAR COALESCENCE </li></ul><ul><li>2 POPULATIONS </li></ul><ul><li>1 MIGRATION / 2 GENERATIONS </li></ul><ul><li>TAILLE CONSTANTE </li></ul>[email_address] Décembre 2008
  22. 22. L’HOMO SAPIENS EVENT 1 LOCUS vs N LOCI <ul><li>MODELISATION MULTIREGIONALE SIMPLE </li></ul><ul><li>APPROCHE PAR COALESCENCE </li></ul><ul><li>2 POPULATIONS </li></ul><ul><li>1 MIGRATION / 2 GENERATIONS </li></ul><ul><li>TAILLE CONSTANTE </li></ul>G 0 G 1 G 2 [email_address] Décembre 2008
  23. 23. L’HOMO SAPIENS EVENT 1 LOCUS vs N LOCI G 0 G 1 G 2 G 3 <ul><li>MODELISATION MULTIREGIONALE SIMPLE </li></ul><ul><li>APPROCHE PAR COALESCENCE </li></ul><ul><li>2 POPULATIONS </li></ul><ul><li>1 MIGRATION / 2 GENERATIONS </li></ul><ul><li>TAILLE CONSTANTE </li></ul>[email_address] Décembre 2008
  24. 24. <ul><li>MODELISATION MULTIREGIONALE SIMPLE </li></ul><ul><li>2 POPULATIONS </li></ul><ul><li>1 MIGRATION / 2 GENERATIONS </li></ul><ul><li>TAILLE CONSTANTE </li></ul>1 LOCUS: P(Racine Africaine) ~ ¼ x ½ ~ 0.125 2 LOCI: P(Racine Africaine) ~ (¼ x ½)² ~ 0.016 L’HOMO SAPIENS EVENT 1 LOCUS vs N LOCI [email_address] Décembre 2008
  26. 26. L’HOMO SAPIENS EVENT LES OBSERVATIONS: PREDICTION #2 <ul><li>51 POPULATIONS </li></ul><ul><li>377 MICROSATELLITES </li></ul>INTRAPOP. [email_address] Décembre 2008
  29. 29. L’HOMO SAPIENS EVENT LES OBSERVATIONS (PREDICTION #4) [email_address] Décembre 2008
  33. 33. <ul><li>L’Homo sapiens EVENT </li></ul><ul><li>Out of Africa vs Multirégionalisme </li></ul><ul><li>2. La sortie d’Afrique </li></ul><ul><li>3. La rencontre avec les autres hommes fossiles </li></ul><ul><li>4. L’origine génomique de nos particularités </li></ul><ul><li>L’homme et le chimpanzé: si loins, si proches… </li></ul>L’EVOLUTION DE LA LIGNEE HUMAINE: L’HOMME, LA PALEONTOLOGIE, LES GENES ET LES GENOMES [email_address] Décembre 2008
  42. 42. LA SORTIE D’AFRIQUE L’HISTOIRE DES MIGRATIONS [email_address] Décembre 2008
  45. 45. LA SORTIE D’AFRIQUE L’ORIGINE DE L’HABILLEMENT: LA SPECIATION POUX DE LA TÊTE / DU CORPS P. humanus capitis P. h. humanus P. h. corporis HABILLEMENT B H [email_address] Décembre 2008
  47. 47. <ul><li>L’Homo sapiens EVENT </li></ul><ul><li>Out of Africa vs Multirégionalisme </li></ul><ul><li>2. La sortie d’Afrique </li></ul><ul><li>3. La rencontre avec les autres hommes fossiles </li></ul><ul><li>4. L’origine génomique de nos particularités </li></ul><ul><li>L’homme et le chimpanzé: si loins, si proches… </li></ul>L’EVOLUTION DE LA LIGNEE HUMAINE: L’HOMME, LA PALEONTOLOGIE, LES GENES ET LES GENOMES [email_address] Décembre 2008
  57. 57. LES POPULATIONS D’HOMMES MODERNES DES HYBRIDATIONS AVEC D’AUTRES HOMMES DU PASSE ? Feldhofer I Vindija 75 Vindija 80 El Sidron 1252 Mt. Lessini Mezmaïskaya Feldhofer II Okladnikov Scladina Teshik Tash Homo sapiens 0.005 HVR-1 660 KYA [email_address] Décembre 2008
  63. 63. <ul><li>L’Homo sapiens EVENT </li></ul><ul><li>Out of Africa vs Multirégionalisme </li></ul><ul><li>2. La sortie d’Afrique </li></ul><ul><li>3. La rencontre avec les autres hommes fossiles </li></ul><ul><li>4. L’origine génomique de nos particularités </li></ul><ul><li>L’homme et le chimpanzé: si loins, si proches… </li></ul>L’EVOLUTION DE LA LIGNEE HUMAINE: L’HOMME, LA PALEONTOLOGIE, LES GENES ET LES GENOMES [email_address] Décembre 2008
  64. 64. LES SPECIFICITES DE L’HOMME MODERNE GENOMIQUE COMPAREE A T A ? A 0.5MY Homme moderne AGCTCTAACTGCTTATAGTCGTATACGCGCTA Néandertal .........A...................... Australopithèque ???????????????????????????????? Chimpanzé .........A...................... Gorille .........A...................... ? T A ? A 6-8MY A A A A A ? ? A SANS GENOME NEANDERTALIEN AVEC GENOME NEANDERTALIEN ? ALIGNEMENT D’UNE REGION HOMOLOGUE DU GENOME [email_address] Décembre 2008
  69. 69. BONE #1253 BONE #1351c mtDNA 98 99 80 20 40 60 100 % % Homo PRIMERS <ul><li>FOUILLES MINISANT LA CONTAMINATION </li></ul><ul><li>ESTIMATION EXPERIMENTALE DU NIVEAU DE CONTAMINATION </li></ul>LES SPECIFICITES DE L’HOMME MODERNE LE LANGAGE ARTICULE [email_address] Décembre 2008 0 20 40 60 80 100
  71. 71. LES SPECIFICITES DE L’HOMME MODERNE LE LANGAGE ARTICULE n=98 n=18 n=18 n=57 n=16 n=53 EXTRACT #1253 FOX-P2 AFRICA WORLWIDE ANCESTRAL DERIVE % PCRs INDEPENDENTES C 911 A 977 C 911 A 977 A 911 G 977 A 911 G 977 A 911 G 977 [email_address] Décembre 2008
  77. 77. PERSPECTIVES UN NOUVEAU VENU: HOMO FLORESIENSIS MICROCEPHALES <ul><li>ANALYSES MULTIVARIEES </li></ul><ul><li>7 MESURES CRÂNIENNES </li></ul><ul><li>(97.1%,1.7%) – (72.7%,12.4%) </li></ul>H. ergaster H. habilis H. ergaster H. ergaster H. habilis 8/6 2/1 9 MICROCEPHALES 11 NON-MICROCEPHALES * * TOMOGRAPHIE 3D [email_address] Décembre 2008
  78. 78. PERSPECTIVES DE L’ADN D’AUTRES HOMMES PREHISTORIQUES ? Homo heidelbergensis Atapuerca (350-500 KYA) Homo floresiensis Flores (12-95 KYA) Larson et al. Proc Natl Acad Sci U S A. 2007 Sep 25 Valdiosera et al. Biol Lett. 2006 Dec 22 [email_address] Décembre 2008

    Be the first to comment

    Login to see the comments


Total views


On Slideshare


From embeds


Number of embeds










