Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.

Origins Final Presentation Italian

481 views

Published on

Published in: Education
  • Be the first to comment

  • Be the first to like this

Origins Final Presentation Italian

  1. 1. Unearthing the Roots of Venice:From Relics to DNA(allascopertadelleoriginidiVenezia)<br />Debora Afezolli<br />Benjamin M. Allen<br />Jaclyn Hepworth<br />Andrew J. Kazanovicz<br />
  2. 2. Ancient Documents<br />Archaeology<br />Genetic Genealogy<br />
  3. 3.
  4. 4. <br /><br />Archaeologist 2<br />To be filled for every object/layer<br />~100 per intervento<br /> <br />Archaeological <br />potential map<br /><br />Cross-reference<br /><br />  <br />Searchable<br />Scheda statua <br />Scheda sito <br />Scheda tomba<br />Scheda inorganico <br /><br />Index forms<br />Scheda organico <br />Scheda unita stratigrafica (US) <br />Create manualmente<br />Schede<br /><br />Soprintendenza Archeologica<br />Foto<br /><br />Consegna a mano<br /> Archaeologist 1<br />Disegni<br /><br />
  5. 5. ArchEasy: UnaSoluzione<br />Sistemadigestione geo-spaziale per l’archiviazionedigitale e la correlazioneautomaticadeidatiarcheologicidiVenezia<br />Form management<br />Database search<br />Automatic indexing<br />Interpretative maps<br />Initial prototype system design<br />
  6. 6. Archaeologist 2<br />Automatic<br />Automatic<br />Archaeologist 1<br />Soprintendenza Archeologica<br /> <br />Archaeological <br />potential map<br /><br />Correlazioni<br />Electronically submitted<br />  <br />Searchable<br />Interpretazionedati<br /><br />Index forms<br />ArchEasy database<br />Schede<br /><br />Caricate digitalmente<br />Foto<br /><br />Disegni<br /><br />
  7. 7. Archaeologist 2<br />Automatic<br />Automatic<br />Archaeologist 1<br />Soprintendenza Archeologica<br /> <br />Archaeological <br />potential map<br /><br />Cross-reference<br />Electronically submitted<br />  <br />Searchable<br />Data Interpretation<br /><br />Index forms<br />ArchEasy database<br />Schede<br /><br /><br />Electronically uploaded<br />Foto<br /><br />Disegni<br /><br />
  8. 8. Modulistica<br />Paper US form<br />ArchEasy electronic US form<br />
  9. 9. Archaeologist 2<br />Automatic<br />Automatic<br />Archaeologist 1<br />Soprintendenza Archeologica<br /> <br />Archaeological <br />potential map<br /><br />Cross-reference<br />Electronically submitted<br />  <br />Searchable<br />Data Interpretation<br /><br /><br />Index forms<br />ArchEasy database<br />Schede<br /><br />Electronically uploaded<br />Foto<br /><br />Disegni<br /><br />
  10. 10. Old paper index US form<br />ArchEasy electronic index US form<br />Indexing<br />
  11. 11. Archaeologist 2<br />Automatic<br />Automatic<br />Archaeologist 1<br />Soprintendenza Archeologica<br /> <br />Archaeological <br />potential map<br /><br />Cross-reference<br />Electronically submitted<br /><br />  <br />Searchable<br />Data Interpretation<br /><br />Index forms<br />ArchEasy database<br />Schede<br /><br />Electronically uploaded<br />Foto<br /><br />Disegni<br /><br />
  12. 12. Ricercatradizionale<br />Manually searched<br />Old searching methods to find desired data<br /><ul><li>Time consuming
  13. 13. Ineffective
  14. 14. Difficult to cross-reference</li></li></ul><li>Romano<br /><br />ArchEasy electronic search and results<br />RicercasuArchEasy<br />
  15. 15. Geo-referenziazioneDati<br />View the Map<br />
  16. 16. Archaeologist 2<br />Automatic<br />Automatic<br />Archaeologist 1<br /><br />Soprintendenza Archeologica<br /> <br />Archaeological <br />potential map<br /><br />Cross-reference<br />Electronically submitted<br />  <br />Searchable<br />Data Interpretation<br /><br />Index forms<br />ArchEasy database<br />Schede<br /><br />Electronically uploaded<br />Foto<br /><br />Disegni<br /><br />
  17. 17. Potenzialearcheologico<br />Basso potenziale<br />Maggiorpotenziale<br />Broad representation of archaeological potential<br />
  18. 18. Public works official<br />PotenzialeArcheologico<br />View all objects on map<br />Consults map<br />Relics near Via Barovier are found every 15m<br />High likelihood of more of these objects, so budget accordingly<br />Application to public works<br />
  19. 19. Archaeologist 2<br />Automatic<br />Automatic<br />Archaeologist 1<br /><br />Soprintendenza Archeologica<br /> <br />Archaeological <br />potential map<br /><br />Cross-reference<br />Electronically submitted<br />  <br />Searchable<br />Data Interpretation<br /><br />Index forms<br />ArchEasy database<br />Schede<br /><br />Electronically uploaded<br />Foto<br /><br />Disegni<br /><br />
  20. 20. Correlazionetrareperti<br />ArchEasy<br />Correlates data<br />Similar elevation, also 13th Century<br />Brick floor<br />Found: 1.5m beneath<br />Origins: 13th Century <br />Brick floor<br />Found: 1.5m beneath<br />Origins: ?? <br />Correlational ability of ArchEasy<br />
  21. 21. In Futuro: Approccio ad AgentiAutonomi<br />I have a similar floor pattern, therefore I could also be a 15th century church<br />My brick size is 14x12x7 cm<br />I’m a 15th century church with herringbone floors<br />My brick size is 22x15x9 cm, and I am 100 years old<br />I could also be 100 years old<br />I have the same type of floor, oriented in the same direction<br />My brick size is 22x15x9 cm<br />Self-correlating autonomous agent approach<br />
  22. 22. Risultati ad oggi<br /><ul><li>Promotional Website: Purpose, vision, and features of ArchEasy</li></ul>Introducing ArchEasy…<br /><ul><li>Archaeological data storage, analysis, and manipulation
  23. 23. Easy completion of administrative form requirements
  24. 24. Archaeological potential maps
  25. 25. Complete customization and control of workspace
  26. 26. Effective search function to enable cross-referencing</li></li></ul><li>
  27. 27. ArchiviodiStato<br />Unbroken documentary history<br />90km of shelves<br />Painstaking to access and utilize the documents<br />
  28. 28. L’attualesistemadiconsultazionedell’ArchiviodiStato<br />Publications<br />Archive<br />Scholar 1<br />Pages<br />Transcriptions<br />Santa Maria della Salute<br />Manuscripts<br />Retrieves<br />Searches<br />Deliver to <br />90km of Shelves<br />Request Information<br />Choose<br />
  29. 29. Publications<br />Archive<br />Scholar 2<br />Duplicate Transcriptions<br />Pages<br />L’attualesistemadiconsultazionedell’ArchiviodiStato<br />SAME Manuscripts<br />Santa Maria della Salute<br />Retrieves<br />Searches<br />Deliver to<br />90km of Shelves<br />Request SAME Information<br />Choose<br />
  30. 30. Publications<br />Archive<br />Scholar 3<br />TriplicateTranscriptions<br />Pages<br />L’attualesistemadiconsultazionedell’ArchiviodiStato<br />SAME Manuscripts<br />Santa Maria della Salute<br />Retrieves<br />Searches<br />Deliver to<br />90km of Shelves<br />Request SAME Information<br />Choose<br />
  31. 31. Le trascrizioni non sonocondivise!<br />Scholar 1<br />Scholar 3<br />Scholar 2<br />Transcriptions<br />Transcriptions<br />Transcriptions<br /><br /><br /><br /><br />SHARING<br />
  32. 32. uScript: UnaSoluzione<br />Scholar 1<br />Scholar 3<br />Scholar 2<br />Transcriptions<br />Transcriptions<br />Transcriptions<br />SHARING<br />
  33. 33. Contribution Accountant<br />ComponentidiuScript<br />3 Components<br />Archive Assistant<br />Transcription Assistant<br />Archive Assistant<br />Transcription Assistant<br />
  34. 34. uScript<br />Scholar 1<br />Scholar 3<br />Scholar 2<br />uScript: concettigenerali<br />Archive Assistant<br />Santa Maria della Salute<br />Search <br />
  35. 35. uScript<br />Scholar 1<br />Scholar 3<br />Scholar 2<br />Manuscripts<br />Archive Assistant<br />
  36. 36. I<br />In<br />In<br />n<br />no<br />nom<br />nomi<br />nomin<br />nomine<br />nomine<br />d<br />do<br />dom<br />domi<br />domin<br />domini<br />domini<br />Marie<br />Transcription Assistant<br />
  37. 37. uScript<br />Scholar 1<br />Scholar 3<br />Scholar 2<br />Transcriptions<br />Transcriptions<br />Manuscripts<br />Manuscripts<br />Archive Assistant<br />Contribution Accountant<br />Search<br />d<br />do<br />dom<br />domi<br />domin<br />domini<br />
  38. 38. I<br />In<br />In<br />n<br />no<br />nom<br />nomi<br />nomin<br />nomine<br />nomine<br />d<br />do<br />dom<br />domi<br />domin<br />domini<br />domini<br />n<br />no<br />nos<br />nost<br />nostr<br />nostri<br />nostri<br />Marie<br />Transcription Assistant<br />
  39. 39. M<br />Ma<br />Mar<br />Mary<br />Mary<br />Transcription Assistant<br />
  40. 40. uScript<br />Scholar 1<br />Scholar 3<br />Scholar 2<br />Transcriptions<br />Transcriptions<br />Manuscripts<br />Manuscripts<br />Archive Assistant<br />Contribution Accountant<br />Search<br />d<br />do<br />dom<br />domi<br />domin<br />domini<br />
  41. 41. Marie<br />Transcription Assistant<br />
  42. 42. uScript<br />Scholar 1<br />Scholar 3<br />Scholar 2<br />Transcriptions<br />Manuscripts<br />Archive Assistant<br />Contribution Accountant<br />
  43. 43. I Componenti<br />Contribution Accountant<br />Archive Assistant<br />Transcription Assistant<br />Archive Assistant<br />Contribution Accountant<br />Search Manuscripts and Transcriptions<br /><br />Rate Contributors and Transcriptions<br />Transcription Database<br />Promotes Accuracy<br /><br />Learn Handwriting<br /><br />Automatic Transcriptions<br />Automatic Boxing<br />
  44. 44. Transcriptions<br />Transcriptions<br />Transcriptions<br />Transcriptions<br />Nientevienescartato!<br />uScript<br />
  45. 45. Risultati ad oggi<br />Promotional Website: show and explain everything that is uScript<br />
  46. 46.
  47. 47. Contribution to Origins Theory<br />OriginideiVeneti<br />Scavialimentanoteorie<br />DNAConfermateorie<br />Documentirafforzanoteorie<br />
  48. 48. TeoriesulleOriginideiVeneti<br />Lusatia<br />?<br />Brittany<br />?<br />Paphlagonia<br />?<br />
  49. 49. OriginidallaPaflagonia?<br />
  50. 50. Paphlagonian Theory<br />
  51. 51. Paphlagonian Theory<br />Livy – Aburbe condita<br />1st Century B.C.E.<br />“Antenor sailed into the furthest part of the Adriatic, accompanied by a number of Enetians…and the name was extended to the surrounding district; the whole nation were called Veneti”<br />
  52. 52. Paphlagonian Theory<br />Homer – The Illiad<br />8th Century B.C.E.<br />“The Paphlagonianswere commanded by a stout-hearted Pylaemenes from Enetae…”<br />
  53. 53. MenzionideiVeneti in Britannia<br />
  54. 54. Brittany Theory<br />
  55. 55. Brittany Theory<br />Strabo – Ancient Greek Historian <br />1st Century A.C.E.<br />Claim that ancestors of Veneto are not the Enetae of Paphlagoniabut the Veneti of Gaul<br />
  56. 56. OriginidallaLusazia?<br />
  57. 57. Lusatia Theory<br />
  58. 58. Lusatia Theory<br />Salvi – Veneti: First Builders of European Community<br />1984 A.C.E.<br />Developed VeneticTheory claiming most current day European populations are descendants of the Veneti of Lusatia<br />
  59. 59. ?<br />?<br />?<br />
  60. 60. ?<br />?<br />?<br />
  61. 61. VerificageneticadelleTeorie<br />?<br />?<br />?<br />
  62. 62. Collaborazione al progettoGenographics<br />
  63. 63. Genographic Project Collaboration<br />
  64. 64. Genographic Project Collaboration<br />
  65. 65. Genographic Project Collaboration<br />300<br />
  66. 66. Requisiti del progetto<br />Maschi<br />Soprai18 anni<br />DalTriveneto<br />
  67. 67. Veneto<br />Barcelona<br />
  68. 68. 163<br />
  69. 69. Estrazione del DNA<br />
  70. 70. Y-Chromosomal DNA<br />Y-chromosome<br />
  71. 71. Y-Chromosomal DNA<br />Coding DNA (genes)<br />Y-chromosome<br />
  72. 72. Y-Chromosomal DNA<br />Coding DNA (genes)<br />Non-coding DNA<br />Y-chromosome<br />
  73. 73. Y-Chromosomal DNA<br />Coding DNA (genes)<br />Non-coding DNA<br />Loci <br />- 12 locations of interest<br />Y-chromosome<br />
  74. 74. Y-Chromosomal DNA<br />ATCTCATACATACATACATAGCTA<br />Y-chromosome<br />
  75. 75. Y-Chromosomal DNA<br />4 complementary nucleotides<br />A,T,C, and G<br />ATCTCATACATACATACATAGCTA<br />Y-chromosome<br />
  76. 76. Y-Chromosomal DNA<br />Scientists examine <br />short tandem repeats (STRs)<br />ATCTCATACATACATACATAGCTA<br />Y-chromosome<br />
  77. 77. Y-Chromosomal DNA<br />Scientists examine <br />short tandem repeats (STRs)<br />ATCTCATACATACATACATAGCTA<br />Y-chromosome<br />
  78. 78. Y-Chromosomal DNA<br />Scientists examine <br />short tandem repeats (STRs)<br />ATCTCATACATACATACATAGCTA<br />Y-chromosome<br />
  79. 79. Y-Chromosomal DNA<br />Scientists examine <br />short tandem repeats (STRs)<br />ATCTCATACATACATACATAGCTA<br />4 CATA repetitions<br />=<br />4 STRs<br />Y-chromosome<br />
  80. 80. Esempio del metododiconfrontogenetico<br />Venice ATCTCATACATACATACATAGCTA<br />
  81. 81. Hypothetical DNA Comparison<br />Venice ATCTCATACATACATACATAGCTA<br />PaphlagoniaATCACATACATACATACATAGCA<br />Lusatia GCTGACCATACTGAACGATATC<br />Brittany GCTAACGAATGTCAAGCTAATA<br />
  82. 82. Hypothetical DNA Comparison<br />Venice ATCTCATACATACATACATAGCTA<br />Paphlagonia ATCACATACATACATACATAGCA<br />Lusatia GCTGACCATACTGAACGATATC<br />Brittany GCTAACGAATGTCAAGCTAATA<br />
  83. 83. Hypothetical DNA Comparison<br />Venice ATCTCATACATACATACATAGCTA<br />Paphlagonia ATCACATACATACATACATAGCA<br />Lusatia GCTGACCATACTGAACGATATC<br />Brittany GCTAACGAATGTCAAGCTAATA<br />
  84. 84. Hypothetical DNA Comparison<br />Venice ATCTCATACATACATACATAGCTA<br /> (4 STRs)<br />Paphlagonia ATCACATACATACATACATAGCA<br />Lusatia GCTGACCATACTGAACGATATC<br />Brittany GCTAACGAATGTCAAGCTAATA<br />
  85. 85. Hypothetical DNA Comparison<br />Venice ATCTCATACATACATACATAGCTA<br /> (4 STRs)<br />PaphlagoniaATCACATACATACATACATAGCA<br />Lusatia GCTGACCATACTGAACGATATC<br />Brittany GCTAACGAATGTCAAGCTAATA<br />
  86. 86. Hypothetical DNA Comparison<br />Venice ATCTCATACATACATACATAGCTA<br /> (4 STRs)<br />PaphlagoniaATCACATACATACATACATAGCA<br /> (4 STRs)<br />Lusatia GCTGACCATACTGAACGATATC<br /> (1 STRs)<br />Brittany GCTAACGAATGTCAAGCTAATA<br />(0 STRs)<br />
  87. 87. Hypothetical DNA Comparison<br />Venice ATCTCATACATACATACATAGCTA<br /> (4 STRs)<br />PaphlagoniaATCACATACATACATACATAGCA<br /> (4 STRs)<br />Lusatia GCTGACCATACTGAACGATATC<br /> (1 STRs)<br />Brittany GCTAACGAATGTCAAGCTAATA<br />(0 STRs)<br /><br /><br /><br />
  88. 88. Y-DNA Haplogroups<br />https://genographic.nationalgeographic.com/genographic/lan/en/atlas.html<br />
  89. 89. Ancient Documents<br />Archaeology<br />Genetic Genealogy<br />
  90. 90. Ringraziamenti<br />Professor Fabio Carrera<br />Professor Daniel Gibson<br />Dr. Marco Bortoletto and Dr. Alberto Zandinella, <br />Dr. Giovanni Caniato<br />Dr. David Comas<br />Alberto Gallo<br />MatteoSecchi, PierluigiTamburrini, and Venessia.com<br />The Settimari<br />Caffé Brasilia<br />John Brunelli<br />And a special thanks to all of the Genographic participants!<br />
  91. 91. Commenti o Domande?<br />

×