1Proprietary & Confidential
Trich Laboratory Testing Standardization
Trichomonas foetus DNA testing
Proper & Confidential
2Proprietary & Confidential
Objectives
To build confidence in Trich testing
To increase consistency in test results
To ...
3Proprietary & Confidential
Opportunities
 Veterinarian sample collection
 Veterinarian sample handling & shipment recom...
4Proprietary & ConfidentialThe world leader in serving scienceProprietary & Confidential
Pooling of cultured samples and c...
5Proprietary & Confidential
Study Background
2010 AAVLD parasitology committee
• Proposed a study to determine whether T. ...
6Proprietary & Confidential
Study Objectives
1. Determine the effect of pooling a single positive sample having various
CT...
7Proprietary & Confidential
Materials and Methods
• Sample collection (Cultured Smegma Samples)
• 5 Feeder labs provided 8...
8Proprietary & Confidential
Cultured smegma samples provided by feeder labs
Sample
Matrix
Source
# of positive
samples *
#...
9Proprietary & Confidential
Real Time PCR Parameters for Feeder Laboratories
Lab A Lab B Lab C Herds 1-2
Lab C Herds 3-
6
...
10Proprietary & Confidential
Results: Individual Sample Testing
Study Lab Result / Feeder Lab Result
Sample
Matrix
Lab
Sou...
11Proprietary & Confidential
Conclusions Individual Testing
• 803 smegma samples were provided by feeder labs (FL)
• All t...
12Proprietary & Confidential
Pooling Study
Laboratory ID
Positive Samples
Available
Negative Samples
Available
Negatives N...
13Proprietary & Confidential
Pooling results
Sample ID* Individual test CT
Pooled1:5 Test
CT
Pooled1:3 Test
CT
Study lab f...
14Proprietary & Confidential
Pooling results
1:5 Pools
• 1:5 pooling of positive samples with a CT of 35 and below were al...
15Proprietary & Confidential
Sequencing primer design for nested PCR
(R-TFSM-primer)
(O-F-TFSM-Primer) (M13-I-F-TFSM-Prime...
16Proprietary & Confidential
Sequencing results for 175 T. foetus positives
175/176 T. foetus positive samples, including ...
17Proprietary & Confidential
Sensitivity, specificity, & predictive values of positive & negative
results for all cultured...
18Proprietary & Confidential
Sequencing Results
• 175/176 positive samples by qPCR were able to be
sequenced
• 1 sample (A...
19Proprietary & Confidential
Overall Study Results
• 95.6 % agreement was reached between Study Lab
(KSVDL) using Life tec...
20Proprietary & Confidential
Acknowledgements
Lalitha Peddireddi, KSVDL – performed the study at KSVDL
Lee Effinger, ODA-A...
21Proprietary & Confidential
Objectives
To build confidence in Trich testing
To increase consistency in test results
To...
22Proprietary & Confidential
Trich Laboratory Testing Standardization
Trichomonas foetus DNA testing
Proper & Confidential
Upcoming SlideShare
Loading in …5
×

Dr. Jeff Baxter - Lab Testing Standardization

418 views

Published on

Lab Testing Standardization - Mr. Jeff Baxter, Dr. Ivan Leyva-Baca, Life Technologies, from the 2014 NIAA Annual Conference titled 'The Precautionary Principle: How Agriculture Will Thrive', March 31 - April 2, 2014, Omaha, NE, USA.

More presentations at http://www.trufflemedia.com/agmedia/conference/2014_niaa_how_animal_agriculture_will_thrive

Published in: Science, Technology, Business
0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total views
418
On SlideShare
0
From Embeds
0
Number of Embeds
10
Actions
Shares
0
Downloads
4
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide

Dr. Jeff Baxter - Lab Testing Standardization

  1. 1. 1Proprietary & Confidential Trich Laboratory Testing Standardization Trichomonas foetus DNA testing Proper & Confidential
  2. 2. 2Proprietary & Confidential Objectives To build confidence in Trich testing To increase consistency in test results To minimize sample quality influence variables To minimize laboratory testing variables To reduce the burden and cost to man and beast Trich Laboratory Testing Standardization Proper & Confidential
  3. 3. 3Proprietary & Confidential Opportunities  Veterinarian sample collection  Veterinarian sample handling & shipment recommended by Laboratory  Laboratory sample preparation method  Laboratory extract volume used  Laboratory Taq enzyme type used  Laboratory analysis threshold level  Laboratory use of IPC (Internal Positive Control)  Laboratory use of USDA licensed kits  Laboratory pooling of samples Trich Laboratory Testing Standardization Proper & Confidential
  4. 4. 4Proprietary & ConfidentialThe world leader in serving scienceProprietary & Confidential Pooling of cultured samples and comparison of multistate laboratory workflows with the MagMAX sample preparation system and VetMAX quantitative polymerase chain reaction reagents for detection of Tritrichomonas foetus–colonized bulls Lee Effinger Lalitha Peddireddi Marilyn Simunich Richard Oberst Catherine O’Connell Ivan Leyva-Baca Oregon Department of Agriculture, Animal Health and Identification Division, Animal Health Laboratory, Salem, OR (Effinger) Department of Diagnostic Medicine/Pathobiology (Peddireddi), Kansas State University, Manhattan, KS Kansas State Veterinary Diagnostic Laboratory (Oberst), Kansas State University, Manhattan, KS Animal Health Laboratory, Idaho State Department of Agriculture, Boise, ID (Simunich) Animal Health and Food Safety Group at Life Technologies, Austin, TX (Leyva-Baca, O’Connell) JVDI, 2014, Vol. 26(1) 72-87 Proper & Confidential
  5. 5. 5Proprietary & Confidential Study Background 2010 AAVLD parasitology committee • Proposed a study to determine whether T. foetus samples can be pooled in order to reduce the costs for testing • Lee Effinger from Oregon State Department of Agriculture led Experimental Design for the project • Marilyn Simunich Idaho State Department of Agriculture served as Study Coordinator & Data Keeper • The Life Technologies Animal Health & Food Safety Group agreed to support the study Proper & Confidential
  6. 6. 6Proprietary & Confidential Study Objectives 1. Determine the effect of pooling a single positive sample having various CT ranges with four negative samples (1:5). If a negative effect was seen, a 1:3 pooling study would then be conducted 2. Compare different sample preparation systems and various real-time PCR (feeder lab workflows) with the 5X MagMAXTM-pathogen RNA/DNA purification kit and amplification with VetMAXTM T. foetus reagents (Life Technologies workflow) 3. Assess the specificity of the VetMAXTM T. foetus reagents by sequencing all positive samples with CT values less than 38 and suspect sample CT values between 38 and less than 40 cycles Proper & Confidential
  7. 7. 7Proprietary & Confidential Materials and Methods • Sample collection (Cultured Smegma Samples) • 5 Feeder labs provided 803 samples • 1 on the West Coast • 1 in the Southwest • 1 in the Central States • 2 in the South • Each feeder lab ran their own protocol including sample preparation system and real-time PCR  1 Central Study lab (KSVDL)  Sample preparation with MagMAXTM  Real-time PCR with VetMAXTM T. foetus reagents Proper & Confidential
  8. 8. 8Proprietary & Confidential Cultured smegma samples provided by feeder labs Sample Matrix Source # of positive samples * # of negative samples* # of inconclusive samples * Total samples submitted Cultured smegma samples (A) 73 301 0 374 (B) 28 72 0 100 (C) 9 52 2 63 (D) 17 33 0 50 (F) 34 182 0 216 Total 161 640 2 803 * As reported by the feeder labs Proper & Confidential
  9. 9. 9Proprietary & Confidential Real Time PCR Parameters for Feeder Laboratories Lab A Lab B Lab C Herds 1-2 Lab C Herds 3- 6 Lab D Lab F Study Lab Final reaction volume(µL) 20 20 25 25 25 25 25 Vol. of T. foetus primer/probe per reaction (µL) 1 1 1 1 1 0.88/1.13-F&R 1 Volume of extract per reaction(µL) 4 4 8 8 5 5 8 Volume Master Mix (µL) 15 15 12.5 12.5 19 18.75 12.5 Primer/probe design McMillen McMillen Vet-Max Vet-Max Vet-Max Modified McMillen Vet-Max Taq used Universal qPCR Universal qPCR qPCR MM qPCR MM TaqMan Univ.MM Absolute qPCR low rox mix qPCR MM Thermocycler AB 7500 AB 7500 Cepheid SC AB7500 AB7500 AB7500 AB7500 Thermocycler mode Standard Standard Fast Standard Standard Stage 1 temperature(°C) 95 95 95 95 50/95 95 95 Stage 1 time (sec) 10 10 600 10 120/120 15 600 Stage2 denaturation (°C) 95 95 95 97 95 95 95 Stage 2 denaturation time (sec) 15 15 15 2 20 15 15 Stage 2 annealing temp (°C) 55 55 55 55 60 60 55 Stage 2 annealing time (sec) 45 45 45 40 45 60 45 # cycles 40 40 40 40 40 45 40 Analysis threshold Fixed 2.0 Fixed 2.0 Control based threshold-10% max TF/5% max Xeno Control based threshold-10% max TF/5% max Xeno Fixed 0.2 Control based threshold- 10% max TF/Xeno Analysis baseline setting 3-15 3-15 auto Positive (Ct) <35 <35 <36 <36 <38 <37 <38 Suspect/Inconclusive(CT) 35-40 35-40 36-40 36-40 38-39 >37 38-40/Xeno 28.5-31.5 Negative(CT) >40 >40 >40 >40 >40 undetected Undetected/Xeno 28.5-31.5 Internal extraction control No No Yes <36 CT Yes <36 CT No Yes Yes CT = 28.5-31.5 Proper & Confidential
  10. 10. 10Proprietary & Confidential Results: Individual Sample Testing Study Lab Result / Feeder Lab Result Sample Matrix Lab Source Sample preparation system Pos/Pos Pos/Neg Pos/Inc PresPos /Neg Neg/Pos Neg/Inc Neg/Neg Total Percent agreement Cultured smegma samples A Boiling 71 5 0 1 2 0 295 374 97.9 B Boiling 21 10 0 0 7 0 62 100 83.0 C MagMax 9 2 2 0 0 0 50 63 96.7 D Boiling 17 4 0 1 0 0 28 50 90.0 F Qiagen 34 0 0 1 0 0 181 21 6 99.5 Results All labs Multiple 152 21 2 3 9 0 616 803 95.6 Order of the call = KSVDL Study Lab / Feeder Laboratory Pos = positive, Neg = negative, Inc = inconclusive, PresPos= presumptive positive Study Lab Results vs. Feeder Lab Results Proper & Confidential
  11. 11. 11Proprietary & Confidential Conclusions Individual Testing • 803 smegma samples were provided by feeder labs (FL) • All the samples were tested by study laboratory with Life Technologies workflow systems: • MagMAXTM • VetMAXTM T. foetus reagents • Agreement of 95.6% was reached with 768/803 samples between feeder labs and study lab • Interestingly, Lab F reached almost 100% agreement using a different sample prep system and a modified McMillen’s assay • Study laboratory (KSVDL) with LT protocol identified 24 more positives than the feeder laboratories. On retesting, one of the feeder labs missed 9 samples reported as positives. Proper & Confidential
  12. 12. 12Proprietary & Confidential Pooling Study Laboratory ID Positive Samples Available Negative Samples Available Negatives Needed Deficit /Surplus of Negative Samples A 77 297 308 -11 B 31 69 124 -55 C 13 50 52 -2 D 21 28 84 -56 F 34 181 136 +45 Total 176 625 704 Positives, presumptive positive and negative samples used from each lab for pooling Proper & Confidential
  13. 13. 13Proprietary & Confidential Pooling results Sample ID* Individual test CT Pooled1:5 Test CT Pooled1:3 Test CT Study lab final call Pooled 1:5 call Pooled 1:3 call 1 C-6-11 35.05 Undetected Undetected Positive Negative Negative 2 A-40-5 35.20 37.83 37.86 Positive Positive Positive 3 A-39-2 35.41 35.93 34.82 Positive Positive Positive 4 F-1-7 35.43 35.43 35.53 Positive Positive Positive 5 F-18-1 35.52 36.16 34.75 Positive Positive Positive 6 C-1-23 35.93 35.75 35.82 Positive Positive Positive 7 B-8-4 36.02 34.91 35.59 Positive Positive Positive 8 F-19-10 36.30 33.48 32.82 Positive Positive Positive 10 A-27-9 36.36 Undetected Undetected Positive Negative Negative 9 B-4-1 36.45 Undetected Undetected Positive Negative Negative 11 C-6-10 37.20 Undetected 37.69 Positive Negative Positive 12 A-41-2 37.89 36.92 Not tested Positive Positive Not tested 13 C-4-5** 38.77 (ave of 4) Undetected Undetected Positive WFA* Negative Negative 14 C-6-15** 39.09 (ave of 3) Undetected Undetected Positive WFA Negative Negative 15 A-24-10** 39.12 (ave of 2) Undetected Undetected Suspect Positive WFA Negative Negative Effect of pooling for T. foetus samples with CT>35 after individual testing *WFA: Suspect workflow A; ** samples confirmed T. foetus by sequencing Proper & Confidential
  14. 14. 14Proprietary & Confidential Pooling results 1:5 Pools • 1:5 pooling of positive samples with a CT of 35 and below were all detected • Only 3 of 9 positive samples with CTs between 36-39.9 were detected in 1:5 pools • Pooling at 1:5 missed 4% (7/176) of T. foetus positive samples 1:3 Pools • Only 8 of 15 positive samples with CTs between 36-39.9 were detected in the 1:3 pools • 1:3 pooling missed 3.5% (6/176) of T. foetus positive samples Proper & Confidential
  15. 15. 15Proprietary & Confidential Sequencing primer design for nested PCR (R-TFSM-primer) (O-F-TFSM-Primer) (M13-I-F-TFSM-Primer) (M-13-R-TFSM-primer) TTAGCTTTCTTT GCGA T. foetus TTAGCTAACAAT GCGA S. moskowitzi Primers for Nested PCR Abbreviation Primer Sequence Forward outer forward primer (O-F-TFSM-Primer) CCTTAGGCAATGGATGTCTTGGC Reverse primer (R-TFSM-primer) GCGCAATGTGCATTCAAAG M13 Forward Inner primer (M13-I-F-TFSM-Primer) TGTAAAACGACGGCCAGTCTTACACGATGAAGAA CGTTGC M13 Reverse primer (M-13-R-TFSM-primer) CAGGAAACAGCTATGACCGCGCAATGTGCATTCA AAG GenBank: GQ254636.1 Simplicimonas moskowitzi GenBank: AY349189.1 Tritrichomonas foetus Proper & Confidential
  16. 16. 16Proprietary & Confidential Sequencing results for 175 T. foetus positives 175/176 T. foetus positive samples, including three late risers, were confirmed T. foetus by DNA sequencing Proper & Confidential
  17. 17. 17Proprietary & Confidential Sensitivity, specificity, & predictive values of positive & negative results for all cultured smegma samples Calculation Formula Result Result % Sensitivity True Positives True Positives + False Negatives X 100 175 _ 175 + 0 x100 100% % Specificity True Negatives True Negatives + False Positives X 100 625___ 625 + 3 x100 99.52% Predictive value of a positive test True Positives True Positives + False Positives X 100 175 __ 175 + 3 x100 98.31% Predictive value of a negative test True Negatives True Negatives + False Negatives X 100 625 __ 625 + 0 x100 100% * Calculations made after qPCR and sequence confirmation Proper & Confidential
  18. 18. 18Proprietary & Confidential Sequencing Results • 175/176 positive samples by qPCR were able to be sequenced • 1 sample (A-7-25) with a CT 33.95 was not able to be sequenced. • It is possible that there are point mutations in this positive sample in the sequencing primer regions, which were designed based on a few T. foetus and a single S. moskowitzi sequences from GenBank • Most importantly, none of the samples reported S. moskowitzi DNA sequences Proper & Confidential
  19. 19. 19Proprietary & Confidential Overall Study Results • 95.6 % agreement was reached between Study Lab (KSVDL) using Life technologies MagMAXTM and VetMAXTM T. foetus reagents and the feeder laboratories • 1:5 Pooling it is likely to miss 4% of the positives • 1:3 Pooling it is likely to miss 3.5% of the positives • DNA sequencing • 175/176 positive samples were confirmed to be T. foetus, the 176th sample could not be sequenced with the primers designed for this study Proper & Confidential
  20. 20. 20Proprietary & Confidential Acknowledgements Lalitha Peddireddi, KSVDL – performed the study at KSVDL Lee Effinger, ODA-Animal Health Laboratory Marilyn Simunich, Idaho State Dept. of Agriculture Cate O’Connell, Life Technologies Mangkey Bounpheng, Texas Veterinary Medical Diagnostic Laboratory Dawn Bueschel, NMDA Veterinary Diagnostic Services Muthu Chengappa, Kansas State Veterinary Diagnostic Laboratory Alfonso Clavijo, Texas Veterinary Medical Diagnostic Laboratory Kris A. Clothier, California Animal Health & Food Safety Lab System Hemant K. Naikare, Texas Veterinary Medical Diagnostics Laboratory Jeff Zinza, Life Technologies Mary Anne Williams, Life Technologies Proper & Confidential
  21. 21. 21Proprietary & Confidential Objectives To build confidence in Trich testing To increase consistency in test results To minimize sample quality influence variables To minimize laboratory testing variables To reduce the burden and cost to man and beast Trich Laboratory Testing Standardization Proper & Confidential
  22. 22. 22Proprietary & Confidential Trich Laboratory Testing Standardization Trichomonas foetus DNA testing Proper & Confidential

×