Biotechnology applications

3,197 views

Published on

Published in: Education, Technology
1 Comment
2 Likes
Statistics
Notes
No Downloads
Views
Total views
3,197
On SlideShare
0
From Embeds
0
Number of Embeds
8
Actions
Shares
0
Downloads
174
Comments
1
Likes
2
Embeds 0
No embeds

No notes for slide
  • Recombinant DNA = DNA in which genes from two different sources (often different species) are combined in vitro into the same molecule Central to genetic engineering Does not occur in nature (not related to bacterial plasmids entering chromosomes)
  • Biotechnology applications

    1. 1. BiotechnologyApplication of Techniques
    2. 2. Applications of molecular genetictechniques Recombinant DNA – Fig 20.1, 20.2 Gene Cloning – Fig 20.3, 20.4 cDNA library (MaCS only) – Fig 20.5 DNA Fingerprinting using:  RFLP (restriction enzyme)  PCR (OSC lab)
    3. 3. Recombinant DNA DNA in which genes from two different sources (often different species) are combined in vitro into the same molecule Method: Restriction enzymes  Sticky ends on restriction fragment can form complementary basepairs with single-stranded stretches on other DNA molecules that have been cut with the same enzyme
    4. 4. http://campus.queens.edu/faculty/jannr/Genetics/images/dnatech/bx15_01.jpg
    5. 5. Gene Cloning Making multiple copies of a single gene Step 1: Ligation Step 2: Transformation & Amplification Step 3: Selection http://tainano.com/Molecular%20Biology%20Glossary.files/image053.gif
    6. 6. Fig. 20.1
    7. 7. Gene cloning step 1 LigationForming Recombinant DNA Ligation: gene of interest inserted into a vector Cloning vector: a plasmid into which the gene of interest is introduced Plasmid: small circular DNA found in bacterial cells that is not the chromosomal DNA
    8. 8. Gene cloning step 1 LigationForming Recombinant DNASteps: Restriction enzyme digestion:  of cloning vector at cloning site  to remove gene of interest Insert gene of interest into vector  add DNA ligase to bond gene with vector Fig. 20.3
    9. 9. Cloning vector components Cloning site:  Where gene of interest will be inserted  Where transcription can occur because contains an upstream promoter  Usually found in the middle of the lacZ gene which is responsible for making the enzyme β-galactosidase Antibiotic resistance gene:  Selection for host cells that have resistance Replication origin:  allows plasmid to replicate in the host cell
    10. 10. Example of a Cloning Vector Ligate the gene of interest into the vector such that it interrupts the genes responsible for making the enzyme β–galactosidase.
    11. 11. Gene Cloning Step 2 TransformationAmplify the recombinant DNA in vivoSteps: Transform recombinant DNA into bacterial cell Grow bacteria in a large batches (flasks) As bacterial cells multiply, the gene of interest will be replicated with each cell
    12. 12. Gene Cloning Step 3Selection Selection: Identify colonies of bacteria containing the recombinant DNA with gene of interest Possible bacterial clone products:  A. bacteria without vector  B. bacteria with vector without the gene  C. bacteria with vector with the wrong gene  D. bacteria with vector with the correct gene
    13. 13. Plating and selecting colonies Plating: taking a sample of the bacteria and growing them on plates Plates have a medium containing:  Antibiotics  X-gal
    14. 14. Gene Cloning Step 3 Selection MechanismsA. Select for bacterial clones that contain a vector (select for proper transformation) Vector confers antibiotic resistant to bacterial because the vector contains an antibiotic resistant gene Cells that transformed the vector will live
    15. 15. Antibiotic Resistance Bacteria are grown on Petri plate containing a specific antibiotic (e.g. amplicillin). Only bacteria which properly transformed (accepted the vector) will grow.
    16. 16. Selection for properly transformedcells containing vector http://www.biotechlearn.org.nz/var/biotechlearn/storage/images/themes/from_genes_to_genomes/images/bacterial_transformation/4063-1-eng-AU/bacterial_transformation_large.jpg
    17. 17. Gene cloning step 3Selection Mechanisms B.Select for bacterial clones that contain a vector and an inserted gene (proper ligation)  plasmids contain lac Z gene that codes for the β- galactosidase (β-gal)  β-gal acts on X-Gal (a clear soluble substrate) to produce a blue precipitate
    18. 18. β-galactosidase Reaction Spontaneous hydrolysis dimerization & oxidation 5-bromo-4- 5,5-dibromo-4,4-dichloro- X-gal galactose chloro-3- indigo, an intensely blue(colourless) hydroxyindole product which is insoluble
    19. 19. β-galactosidase Screening  Bacteria are grown on Petri plates containing X-Gal.  Plasmids that have a gene inserted into the right place won’t have a functional β-gal enzyme.  These bacteria, when grown in X- gal, cannot process it and stays white.
    20. 20. β-galactosidase Screening  Bacteria which did not accept the new plasmid will have a working β-gal that will process X-gal into a blue product.
    21. 21. Gene cloning step 3Selection Mechanisms C.Select for bacterial clones that contain the vector with the gene of interest  Perform DNA hybridization  Make a paper blot of the clones  add probes complementary to the gene of interest  Visualize blot to see which clones “light up”  Match blot with cells on Petri dish to choose the appropriate clones
    22. 22. Cloning ApplicationsTransgenic plants Plants cells can also take in bacterial plasmids. Flavr Savr Tomatoes Bt toxin – natural herbicide
    23. 23. Animation: Gene cloning http://www.sumanasinc.com/webcontent /animations/content/plasmidcloning.html http://highered.mcgraw-hill.com/olc /dl/120078/micro10.swf
    24. 24. Genomic Library A collection of genes A complete set of recombinant plasmids clones each carrying copies of particular segment of the genome (comprehensive) However process of generating library can cut up genes because restriction enzymes do not respect gene boundaries (shotgun approach) Animation: http://www.sumanasinc.com/ webcontent/animations/content/dnalibrary.html
    25. 25. cDNA Library cDNA = complementary DNA Reverse transcribed from mRNA Animation: Making a cDNA http://highered.mcgraw-hill.com/olc /dl/120078/bio_h.swf
    26. 26. Refer to Fig 20.5http://campus.queens.edu/faculty/jannr/Genetics/images/dnatech/cdna.gif
    27. 27. Animation: Application of cDNA Chip technology http://www.sumanasinc.com/webcontent /animations/content/dnachips.html Microarray http://highered.mcgraw-hill.com/olc /dl/120078/micro50.swf
    28. 28. Restriction Fragment LengthPolymorphism (RFLP) An historic method for DNA fingerprinting Polymorphism:  Root word from Greek for “many forms”  Differences in DNA sequences found among the individuals in a population (e.g. alleles) Restriction fragment length polymorphism:  differences in DNA sequence on homologous chromosomes that result in different DNA fragments when cut by a restriction enzyme  Most frequently found on noncoding regions
    29. 29. Polymorphism example Cut with EcoRI at restriction site: GAATTC Target sequence (probe): GCATGCATGCATGCATGCATGJack’s DNA sequence at a specific locus:First copy: Total length of fragment = ??? kb-GAATTC(8.2kb)GCATGCATGCATGCATGCATG(4.2kb)GAATTC-Second copy: Total length of fragment = ??? kb-GAATTC(3kb)GCATGCATGCATGCATGCATG(1.3kb)GAATTC-Jill’s DNA sequence at the same specific locus:First copy: Total length of fragment = ??? kb-GAATTC(8.2kb)GCATGCATGCATGCATGCATG(4.2kb)GAATTC-Second copy: Total length of fragment = ??? kb-GAATTC(1.2kb)GCATGCATGCATGCATGCATG(1.3kb)GAATTC-
    30. 30. Polymorphism example Cut with EcoRI at restriction site: GAATTC Target sequence (probe): GCATGCATGCATGCATGCATGJack’s DNA sequence at a specific locus:First copy: Total length of fragment = 12.4kb-GAATTC(8.2kb)GCATGCATGCATGCATGCATG(4.2kb)GAATTC-Second copy: Total length of fragment = 4.3kb-GAATTC(3kb)GCATGCATGCATGCATGCATG(1.3kb)GAATTC-Jill’s DNA sequence at the same specific locus:First copy: Total length of fragment = 12.4kb-GAATTC(8.2kb)GCATGCATGCATGCATGCATG(4.2kb)GAATTC-Second copy: Total length of fragment = 2.5kb-GAATTC(1.2kb)GCATGCATGCATGCATGCATG(1.3kb)GAATTC-
    31. 31. Identify fragment lengths on gelelectrophoresis
    32. 32. Examples of DNA Fingerprints
    33. 33. RFLP Analysis Individuals can be identified by looking at the polymorphisms method only works when the sequence you are looking for contains the restriction site
    34. 34. RFLP overview 1. Restriction enzyme digestion: cut DNA in small fragments 2. Gel electrophoresis: separate fragments by size 3. Southern blotting: immobilize fragments 4. Hybridization: radioactive probe binding to fragments of interest 5. Autoradiography: visualizing the fragments of interest http://static.ddmcdn.com/gif/dna-profiling.jpg
    35. 35. Animation: RFLP DNAFingerprinting http://highered.mcgraw-hill.com/olc /dl/120078/bio20.swf
    36. 36. Modern DNA Fingerprinting RFLP has disadvantages because you can end up with too many fragments after cutting with the restriction enzyme Modern approach is to use PCR to amplify the specific locus of interest  E.g. OSC DNA Fingerprinting lab Both require visualizing differences in fragment size by using gel electrophoresis
    37. 37. Using PCR to generate DNAFingerprint 1. PCR: primers amplify the fragment of interest X 2. Gel electrophoresis: fewer separate fragments bands 3. by size No need to transfer to paperPCR 4. Since PCR primers only amplifies X fragment of interest, no need to hybridize a probe to No x-ray film, locate fragment 5. Take a picture of just a picture the gel
    38. 38. DNA Fingerprinting Application Paternity testing: identifying the father  Animation: http://www.sumanasinc.com/ webcontent/animations/content/paternitytesting .html Criminal cases: eliminating suspects Identifying a corpse
    39. 39. Ontario Science CentreDNA Fingerprinting Lab General Procedures Lab Report Things you should know by the end of the lab
    40. 40. General Procedures Isolate DNA from hair cells Use primers and PCR to amplify a specific noncoding region on your chromosome Use gel electrophoresis to separate the PCR fragment(s) by size Visualize the gel Determine whether you are homozygous or heterozygous and the allele frequency (how “common or unique” you are relative to the general population)
    41. 41. DNA Isolation Why take the hair sheath? What is the component of the shaft? What is the function of Chelex? proteinase K? Why incubate at 65oC? 100oC? What is vortexing? What was the purpose for each time the sample was vortexed? Why centrifuge? What is in the supernatant? pellet?
    42. 42. PCR Why are certain items kept on ice? Which items are kept on ice? What is the content of the master mix? What is the function of MgCl2? buffer? What is the name of the PCR machine?
    43. 43. Gel electrophoresis What is the purpose of the buffer? Why is a polyacrylamide gel used instead of agarose? What is resolving power? What are the components of the loading dye? What are each of their functions? What is a DNA ladder? Why is it necessary? Why is it necessary to stain the gel? What was used as the stain?
    44. 44. Analysis What does D1S80 mean? How many repeats exist at this locus (it’s a range)? How many bp make up the repeat? Given a sequencing gel, determine the length and sequence of repeats. Given a gel and a DNA ladder, determine the size of the DNA fragment. Given a gel, determine if an individual is homozygous or heterozygous and their allele frequency. Given allele frequencies, calculate genotypic frequencies. Express answers in fractions and in numbers of individuals.
    45. 45. General Why use disposable tips? When should a tip be replaced with a new one? How do you read a micropipette? How do you set the correct volume? What does the number at the top of the micropipette indicate? How do you use a micropipette? What are the functions of the two stops? What does aliquot mean? What is a VNTR? Describe at least 4 applications of DNA fingerprinting.

    ×