Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.

Genetics Basics

557 views

Published on

Published in: Technology, Lifestyle
  • Be the first to comment

  • Be the first to like this

Genetics Basics

  1. 1. Genetics <ul><li>Open another window and go to taylorchinesescience.com </li></ul><ul><ul><li>Find biology </li></ul></ul><ul><ul><ul><li>Click “quizlet genetics vocabulary.” </li></ul></ul></ul><ul><ul><ul><li>Do - familiarize – learn 100% – space race (10,000pts) - test 100% </li></ul></ul></ul>
  2. 2. Genetics Write black
  3. 3. Gregor Mendel <ul><li>Father of Genetics </li></ul><ul><li>Worked with peas </li></ul><ul><li>Studied heredity – offspring inherit traits from parents </li></ul>Write black
  4. 4. Genes and terminology <ul><li>Gene – sequence of DNA that codes for a protein and thus determines a trait </li></ul><ul><ul><li>A – adenine </li></ul></ul><ul><ul><li>G – guanine </li></ul></ul><ul><ul><li>T – thymine </li></ul></ul><ul><ul><li>C – cytosine </li></ul></ul><ul><li>ACACGCGCGCGCGAACTACAGATAA </li></ul><ul><ul><li>This animal is hairy </li></ul></ul>Write black
  5. 5. Con. <ul><li>Alleles – one of a number of different forms of a gene </li></ul><ul><ul><li>Dominant (T) and recessive (t) </li></ul></ul><ul><ul><li>T and t represent two different alleles </li></ul></ul><ul><ul><li>If a trait is expressed and the alleles are the same it is homozygous </li></ul></ul><ul><ul><ul><li>TT = homozygous dominant </li></ul></ul></ul><ul><ul><ul><li>tt = homozygous recessive </li></ul></ul></ul><ul><ul><ul><li>Tt = heterozygous dominant </li></ul></ul></ul>Write black
  6. 6. Con. <ul><li>Phenotype is the outward expression of the genes. Physical characteristics </li></ul><ul><li>Genotype is the genes themselves </li></ul><ul><li>T = tall over 5’2” t = short under 5’2” </li></ul><ul><li>Example – Cross Tt and Tt in a Punnett square </li></ul>Write black
  7. 7. Review <ul><li>Mendel </li></ul><ul><li>Gene </li></ul><ul><li>Allele </li></ul><ul><li>Phenotype </li></ul>

×