Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.
MOLECULAR TOOLS IN DIAGNOSIS 
AND CHARACTERIZATION OF 
INFECTIOUS DISEASES 
Tawheed Ahmad Shafi
Introduction 
• Since the advent of the PCR, numerous applications 
in infectious diseases diagnostics have been 
develope...
• Nucleic acid testing can be separated into amplified and 
nonamplified methods. 
• Nonamplified methods consist of DNA-l...
History OF PCR 
 Great mind behind this PCR :Kary Banks Mullis 
 Developed PCR in 1985 and was awarded nobel prize in 
1...
PCR a Revolution in Science 
amplify a single or few copies of a piece of DNA, 
generating millions or more copies of a 
p...
PCR Reagents 
• 1X Buffer 
– 10mM Tris-HCl, 50mM KCl 
• MgCl2 
– 1mM - 4mM (1.5mM) 
• dNTPs 
– 200μM 
• Primers 
– 100nM-1...
Typical PCR Temps/Times 
STEPS TEMPERATURE TIME 
Initial denaturation 90o – 95o C 1 – 3 min 
Denature 90o – 95o C 0.5 – 1 ...
Variations of the PCR 
• Colony PCR 
• Nested PCR 
• Multiplex PCR 
• Hot Start PCR 
• Inverse PCR 
• Asymmetric PCR 
• Lo...
Colony PCR: the screening of bacterial (E.Coli) or yeast 
clones for correct ligation or plasmid products. 
Nested PCR: ...
Long PCR: Used to amplify DNA over the entire length up to 25kb of 
genomic DNA segments cloned. 
Inverse PCR: Used to a...
Touchdown PCR (Step-down PCR): 
a variant of PCR that aims to reduce nonspecific background by 
gradually lowering the an...
Applications of PCR Methods 
• Medical Diagnostics 
1) Diagnosis and characterisation of Infectious 
diseases: 
- Detect p...
Advances on PCR Methods 
Real Time Assays 
called “real-time PCR” because it allows to view the 
increase in the amount of...
Real Time Reporters 
• All real time PCR systems rely upon the 
detection and quantization of fluorescent 
reporter, the s...
How SYBR Green works 
• SYBR green binds 
to double 
stranded DNA and 
upon excitation 
emits light 
• Thus as PCR 
produc...
Advantages 
• Inexpensive 
• Easy to Use 
• Sensitive 
Disadvantages 
• SYBR green will bind to any double stranded 
DNA i...
Other Emerging Alternatives 
• Two most popular alternatives to SYBR green are 
TaqMan and Molecular Beacons 
• Both techn...
Molecular Beacons 
• Molecular Beacons 
• Uses FRET-Fluorescence Resonance 
Energy Transfer 
• Uses two sequence specific ...
Documentation of Amplification 
• The light emitted from 
the dye in the excited 
state is received by a 
computer and sho...
Applications 
• Some of the common real-time PCR assays that are 
available include the tests for group A/B streptococcus,...
Loop Mediated Isothermal Amplification 
(LAMP) 
• Loop mediated isothermal amplification is a 
simple, rapid, specific and...
LAMP in Clinical Diagnosis 
• LAMP technology proving to be ideal in detection of DNA or 
RNA of the pathogenic organisms ...
Advantages of LAMP 
• LAMP does not require an expensive 
thermocycler 
• Amplification specificity is extremely high as 
...
PCR is susceptible to hemoglobin, Ig and 
Heparin 
LAMP resists contamination of above 
mentioned materials 
LAMP can ampl...
Hybridisation 
• Nucleic acid hybridization as a technique involves using a 
labeled nucleic acid probe, to bind with the ...
DNA from source “X” 
CTGATGGTCATGAGCTGTCCGATCGATCAT 
• The probe will bind to the 
segment of nucleic acid with 
complemen...
Preparation And Labeling Of Nucleic Acid 
Probes may be 
• single-stranded or 
• double-stranded molecules 
 working prob...
Preparation And Labeling Of Nucleic Acid 
• Probe is usually labeled with a detectable tracer, which is 
either isotopic o...
Hybridization Of Nucleic Acids 
(Southern blot hybridization) 
• In Southern blot hybridization, the target DNA is digeste...
Southern blot hybridization detects target DNA fragments that 
have been size-fractionated by gel electrophoresis
Widely applied in researches since its invention. 
• Identification DNA from pathogenic 
microorganism 
• For analysis of ...
Typing 
The process of differentiating strains based on their 
phenotypic and genotypic differences is known as 'typing'. ...
Criteria for evaluating typing systems 
Typeability Capacity to produce clearly interpretable results 
with most strains o...
Molecular Typing Techniques 
Restriction analysis 
Plasmid profiling 
Restriction fragment length polymorphism (RFLP) 
Rib...
Random Amplified Polymorphic DNA 
(RAPD) PCR 
• Shortly after Kary Mullis invented the Polymerase Chain Reaction 
(PCR) it...
• The primers can be designed without the experimenter having any 
genetic information for the organism being tested. 
• M...
Template 
DNA 
RAPD 
 Primer binds to many locations on the template DNA 
 Only when primer binding sites are close and ...
Primers at the right 
distance so amplification 
will happen 
100- 1500 bases
Primers point in the 
same direction, so 
amplification won’t 
happen 
Template 
DNA
Primers too far apart so 
amplification will not 
happen 
> 2,000- 3000 bases
RAPD 
Silver-stained polyacrylamide gel showing three distinct 
RAPD profiles generated by primer OPE15 for Haemophilus 
d...
Applications 
• Has been largely carried out for variability analysis and 
individual-specific genotyping, but is less pop...
Limitations 
• PCR based technique, therefore quality and concentration of 
template DNA, concentrations of PCR components...
Restriction Fragment Length 
Polymorphism (RFLP) 
• RFLP is a technique in which organisms may be 
differentiated by analy...
• The similarity of the patterns generated can be used to 
differentiate species (and even strains) from one another. 
• T...
A restriction fragment length polymorphism (RFLP) 
The DNA molecule on the left has a polymorphic restriction 
site (marke...
Two methods for scoring an RFLP : 
(A)RFLPs can be scored by Southern hybridization. 
The DNA is digested with the appropr...
(B) The RFLP can also be typed by PCR, using primers that anneal 
either side of the polymorphic restriction site. After t...
Applications: 
• RFLPs can be applied in diversity and phylogenetic 
studies ranging from individuals within populations o...
Pulsed field gel electrophoresis (PFGE) 
Conventional gel electrophoresis techniques: 
separates DNA fragments from 100 to...
Pulsed-field gel electrophoresis is based on the digestion of 
bacterial DNA with restriction endonucleases that recognize...
Example of PFGE typing results (Staphylococcus aureus). Numbers and letters indicate 
sample and strain assignment, respec...
Advantages of PFGE 
 PFGE has proved to be an efficient method for 
genome size estimation 
 In PFGE DNA fragments obtai...
Applications of PFGE 
• PFGE is used for epidemiological studies of pathogenic organisms. 
• PFGE is often employed to tra...
LIMITATIONS OF PFGE 
• Time consuming (2-4 days) 
• Requires a trained and skilled technician. 
• Pattern results vary sli...
Conclusion 
• The future of the molecular diagnostics of infectious 
diseases will undoubtedly be focused on a marked 
inc...
THANK YOU
MOLECULAR TOOLS IN  DIAGNOSIS AND CHARACTERIZATION OF INFECTIOUS DISEASES
MOLECULAR TOOLS IN  DIAGNOSIS AND CHARACTERIZATION OF INFECTIOUS DISEASES
MOLECULAR TOOLS IN  DIAGNOSIS AND CHARACTERIZATION OF INFECTIOUS DISEASES
MOLECULAR TOOLS IN  DIAGNOSIS AND CHARACTERIZATION OF INFECTIOUS DISEASES
MOLECULAR TOOLS IN  DIAGNOSIS AND CHARACTERIZATION OF INFECTIOUS DISEASES
MOLECULAR TOOLS IN  DIAGNOSIS AND CHARACTERIZATION OF INFECTIOUS DISEASES
MOLECULAR TOOLS IN  DIAGNOSIS AND CHARACTERIZATION OF INFECTIOUS DISEASES
Upcoming SlideShare
Loading in …5
×

MOLECULAR TOOLS IN DIAGNOSIS AND CHARACTERIZATION OF INFECTIOUS DISEASES

5,545 views

Published on

The future of the molecular diagnostics of infectious diseases will undoubtedly be focused on a marked increase in the amount of information detected with remarkably simplified, rapid platforms that will need complex software analysis to resolve the data for use in clinical decision-making.

Published in: Health & Medicine

MOLECULAR TOOLS IN DIAGNOSIS AND CHARACTERIZATION OF INFECTIOUS DISEASES

  1. 1. MOLECULAR TOOLS IN DIAGNOSIS AND CHARACTERIZATION OF INFECTIOUS DISEASES Tawheed Ahmad Shafi
  2. 2. Introduction • Since the advent of the PCR, numerous applications in infectious diseases diagnostics have been developed • Several applications have been incorporated in the routine diagonostic labs with a more user-friendly, cost-effective, and accurate profile. • Realtime PCR allowed this transition of the scientific technology from basic research and reference center testing into the mainstream clinical laboratories with the ability to rapidly detect organisms such as group B Streptococcus (GBS) and influenza virus
  3. 3. • Nucleic acid testing can be separated into amplified and nonamplified methods. • Nonamplified methods consist of DNA-labeled or RNA-labeled probes that bind to the target nucleic acid and generate a signal from the attached reporter molecule. • Target amplification allows the use of multiple different types of postamplification technologies to further characterize the amplified targets of organism nucleic acids. • A variety of nucleic acid methods are currently utilized for detection/identification of organisms and their virulence factors/resistance determinants.
  4. 4. History OF PCR  Great mind behind this PCR :Kary Banks Mullis  Developed PCR in 1985 and was awarded nobel prize in 1993.  PCR machine otherwise called Thermocycler. • 1983—Kary Mullis, a scientist working for the Cetus Corporation was driving along US Route 101 in northern California when he came up with the idea for the polymerase chain reaction. • 1985—the polymerase chain reaction was introduced to the scientific community at a conference in October. Cetus rewarded Kary Mullis with a $10,000 bonus for his invention • Later, during a corporate reorganization, Cetus sold the patent for the PCR process to a pharmaceutical company Hoffmann-LaRoche for $300 million.
  5. 5. PCR a Revolution in Science amplify a single or few copies of a piece of DNA, generating millions or more copies of a particular DNA sequence. The method relies on, cycles of repeated heating and cooling of the reaction for DNA melting and enzymatic replication of the DNA. Almost all PCR applications employ a heat-stable DNA polymerase, such as Taq polymerase, an enzyme originally isolated from the bacterium Thermus aquaticus.
  6. 6. PCR Reagents • 1X Buffer – 10mM Tris-HCl, 50mM KCl • MgCl2 – 1mM - 4mM (1.5mM) • dNTPs – 200μM • Primers – 100nM-1μM, 200nm (or less) for real time analysis • DNA polymerase – Taq DNA polymerase is thermostable – 1-4 Units (1 unit) • DNA – 10pg-1μg (20ng)
  7. 7. Typical PCR Temps/Times STEPS TEMPERATURE TIME Initial denaturation 90o – 95o C 1 – 3 min Denature 90o – 95o C 0.5 – 1 min Primer annealing 45o – 65o C 0.5 – 1 min Primer extension 70o – 75o C 0.5 – 2 min Final extension 70o – 75o C 0.5 – 10 min Stop reaction 4o C or 10 mM EDTA hold
  8. 8. Variations of the PCR • Colony PCR • Nested PCR • Multiplex PCR • Hot Start PCR • Inverse PCR • Asymmetric PCR • Long PCR • Reverse Transcriptase PCR • Real time PCR • Touchdown PCR
  9. 9. Colony PCR: the screening of bacterial (E.Coli) or yeast clones for correct ligation or plasmid products. Nested PCR: Involves two consecutive PCR reactions of 25 cycles. The first PCR uses primers external to the sequence of interest. The second PCR uses the product of the first PCR in conjunction with one or more nested primers to amplify the sequence within the region flanked by the initial set of primers. Multiplex PCR: is a variant of PCR which enabls simultaneous amplification of many targets of interest in one reaction by using more than one pair of primers. Hot start PCR: This is a technique that reduces non-specific amplification during the initial set up stages of the PCR. The technique may be performed manually by heating the reaction components to the melting temperature (e.g., 95°C) before adding the polymerase
  10. 10. Long PCR: Used to amplify DNA over the entire length up to 25kb of genomic DNA segments cloned. Inverse PCR: Used to amplify DNA of unknown sequence that is adjacent to known DNA sequence. Quantitative PCR: Product amplification w r t time, which is compared with a standard DNA. Asymmetric PCR: preferentially amplifies one DNA strand in a double-stranded DNA template. It is used in sequencing and hybridization probing where amplification of only one of the two complementary strands is required. Reverse Transcriptase PCR- First step of RT-PCR - "first strand reaction“-Synthesis of cDNA using oligo dT primers (37°C) 1 hr.“Second strand reaction“-Digestion of cDNA:RNA hybrid. Allows the detection of even rare or low copy mRNA sequences by amplifying its complementary DNA.
  11. 11. Touchdown PCR (Step-down PCR): a variant of PCR that aims to reduce nonspecific background by gradually lowering the annealing temperature as PCR cycling progresses. The annealing temperature at the initial cycles is usually a few degrees (3-5 °C) above the Tm of the primers used, while at the later cycles, it is a few degrees (3-5 °C) below the primer Tm. The higher temperatures give greater specificity for primer binding, and the lower temperatures permit more efficient amplification from the specific products formed during the initial cycles
  12. 12. Applications of PCR Methods • Medical Diagnostics 1) Diagnosis and characterisation of Infectious diseases: - Detect presence of viral pathogens - Detect presence of pathogenic bacteria 2) Diagnosis and characterisation of genetic diseases 3) Diagnosis and characterisation of Neoplasia • Forensics 1) Identify criminal suspects 2) Paternity cases
  13. 13. Advances on PCR Methods Real Time Assays called “real-time PCR” because it allows to view the increase in the amount of DNA as it is amplified. The Real Time assays are proving to better technologies  Rapid  Quantitative measurement  Lower contamination rate  Higher sensitivity  Higher specificity  Easy standardization
  14. 14. Real Time Reporters • All real time PCR systems rely upon the detection and quantization of fluorescent reporter, the signal of which increases in direct proportion of the amount of PCR product in a reaction. REAL TIME PCR Cyber Green • The simplest and economical reporter is the double strand DNA specific dye SYBR Green • Called as Molecular Probe.
  15. 15. How SYBR Green works • SYBR green binds to double stranded DNA and upon excitation emits light • Thus as PCR product accumulates the fluoresce increases
  16. 16. Advantages • Inexpensive • Easy to Use • Sensitive Disadvantages • SYBR green will bind to any double stranded DNA in a reaction, may result in an overestimation of the target concentration
  17. 17. Other Emerging Alternatives • Two most popular alternatives to SYBR green are TaqMan and Molecular Beacons • Both technologies depend on hybridization probes relying on fluorescence resonance energy transfer (FRET) and quantization
  18. 18. Molecular Beacons • Molecular Beacons • Uses FRET-Fluorescence Resonance Energy Transfer • Uses two sequence specific Oligonucleotide labelled with fluorescent dyes • Molecular beacons are designed to adopt a hairpin structure while free in solution, brining the fluorescent dye and quencher in close proximity. When a molecular beacon hybridizes to a target the fluorescent dye emits light upon irradiation, and rebind to target in every cycle for signal measurement.
  19. 19. Documentation of Amplification • The light emitted from the dye in the excited state is received by a computer and shown on a graph display, such as this, showing PCR cycles on the X-axis and a logarithmic indication of intensity on the Y-axis.
  20. 20. Applications • Some of the common real-time PCR assays that are available include the tests for group A/B streptococcus, methicillin-resistant Staphylococcus aureus (MRSA) and influenza virus. • There are numerous laboratory-developed realtime PCR tests, including assays for poorly cultivatable or atypical organisms (Bordetella pertussis, Legionella pneumophila, Mycoplasma pneumoniae, Chlamydia pneumophila), and the herpes viruses • Recent development of assays for Zygomycetes, Aspergillus, Candida sp., Pneumocystis jiroveci, and Coccidiodes show promise for addressing some of the common problems of analysis for these pathogens
  21. 21. Loop Mediated Isothermal Amplification (LAMP) • Loop mediated isothermal amplification is a simple, rapid, specific and cost effective nucleic acid amplification method. • The amplification proceeds at a constant temperature using strand displacement reaction. • Amplification and detection of gene can be completed in a single step, by incubating the mixture of samples, primers DNA polymerase and substrates at a constant temperature of 630c.
  22. 22. LAMP in Clinical Diagnosis • LAMP technology proving to be ideal in detection of DNA or RNA of the pathogenic organisms • Proving to be highly efficient in diagnosis of Viral and Bacterial infections • LAMP is capable of detecting the presence of pathogenic agents earlier than PCR • A one step single tube real time accelerated reverse transcription loop mediated isothermal amplification (RT-LAMP) assays for rapid detection of some recently emerged viral pathogen eg West Nile, Dengue, Japanese encephalitis H5N1- highly pathogenic avian influenza.
  23. 23. Advantages of LAMP • LAMP does not require an expensive thermocycler • Amplification specificity is extremely high as LAMP requires 4/6 oligonucleotide primers • Detection limit : LAMP ≥ PCR • Detection time : LAMP < PCR • Visualization of DNA products by LAMP: (a) Eye – turbidity, colour change (b) Real Time Turbidimeter (C) Electrophoresis
  24. 24. PCR is susceptible to hemoglobin, Ig and Heparin LAMP resists contamination of above mentioned materials LAMP can amplify parasite DNA from fresh infected blood LAMP can be done by using rather crude DNA extracted by simple methods
  25. 25. Hybridisation • Nucleic acid hybridization as a technique involves using a labeled nucleic acid probe, to bind with the target nucleic acids • A probe labeled with detectable tracer is the prerequisite for determining a specific DNA sequence or gene in a sample or genomic DNA by nucleic acid hybridization. • The target nucleic acids to be analyzed are usually denatured, and then mixed with the labeled probe in the hybridization system.
  26. 26. DNA from source “X” CTGATGGTCATGAGCTGTCCGATCGATCAT • The probe will bind to the segment of nucleic acid with complementary sequence under proper conditions. • The hybridization can be identified by the detection of the tracer labeling the probe. • Thus the existence or the expression of specific gene can be determined. ACAGGCTAGCTAGTA ACAGGCTAGCTAGTA Hybridization ACAGGCTAGCTAGTA nucleic acid probe
  27. 27. Preparation And Labeling Of Nucleic Acid Probes may be • single-stranded or • double-stranded molecules  working probe must be single-stranded molecules. The probes used in hybridization include • oligonucleotide(15-50 nucleotides) • genomic DNA fragment • cDNA fragment and • RNA.
  28. 28. Preparation And Labeling Of Nucleic Acid • Probe is usually labeled with a detectable tracer, which is either isotopic or non-isotopic. The purified oligonucleotide is labeled in vitro by using a suitable enzyme to add the labeled nucleotide to the end of the oligonucleotide. • The labels in common use include radioactive (32P and 35S) and nonradioactive (digoxigenin, biotin, fluorescein) substances which are used to label dNTP. • After hybridization, the location and the quantity of the hybrid molecules can be determined.
  29. 29. Hybridization Of Nucleic Acids (Southern blot hybridization) • In Southern blot hybridization, the target DNA is digested with restriction endonucleases • Following electrophoresis, the sample DNA fragments are denatured in strong alkali, such as NaOH. • The denatured DNA fragments are transferred to a nitrocellulose or nylon membrane and become immobilized on the membrane. • The immobilized single-stranded target DNA sequences are allowed to interact with labeled single-stranded probe DNA. • The probe will bind only to complementary DNA sequences in the target DNA to form a target-probe heteroduplex.
  30. 30. Southern blot hybridization detects target DNA fragments that have been size-fractionated by gel electrophoresis
  31. 31. Widely applied in researches since its invention. • Identification DNA from pathogenic microorganism • For analysis of gene expression • Screening of recombinant plasmids • Analysis of gene mutation
  32. 32. Typing The process of differentiating strains based on their phenotypic and genotypic differences is known as 'typing'. These typing methods are useful in:  hospital infection control  epidemiological studies, and  understanding the pathogenesis of infection. In hospital settings they may be used to: determine whether a set of isolates obtained from one patient represents a single infecting strain or multiple contaminants. determine whether a series of isolates obtained over time represents relapse of an infection due to single strain or separate episodes of disease due to different strains.
  33. 33. Criteria for evaluating typing systems Typeability Capacity to produce clearly interpretable results with most strains of the bacterial species Reproducibility Capacity to repeatedly obtain the same typing profile result with the same bacterial strain Discriminatory power Ability to produce results that clearly allow differentiation between unrelated strains of the same bacterial species Practicality (ease of performance & interpretation) Method should be versatile, relatively rapid, inexpensive, technically simple and provide readily interpretable results
  34. 34. Molecular Typing Techniques Restriction analysis Plasmid profiling Restriction fragment length polymorphism (RFLP) Ribotyping Pulse Field Gel Electrophoresis (PFGE) PCR amplification of particular genetic targets Amplified fragment length polymorphism (AFLP) RandomAmplified Polymorphic DNA (RAPD) Repetitive element PCR (Rep-PCR) Variable number of tandem repeat (VNTR) analysis and Multiple locus VNTR analysis (MLVA) Sequencing-based methods Multilocus sequence typing (MLST) Single nucleotide polymorphism (SNPs)
  35. 35. Random Amplified Polymorphic DNA (RAPD) PCR • Shortly after Kary Mullis invented the Polymerase Chain Reaction (PCR) it was realized that short primers would bind to several locations in a genome and thus could produce multiple fragments • Williams et al. (1990) developed Random Amplified Polymorphic DNA (RAPD) a technique using very short 10 base primers to generate random fragments from template DNAs • RAPD fragments can be separated and used as genetic markers or a kind of DNA fingerprint
  36. 36. • The primers can be designed without the experimenter having any genetic information for the organism being tested. • More than 2000 different RAPD primers can be available commercially. • Genomic DNA normally has complimentary sequences to RAPD primers at many locations. • If two of these locations are close to each other (<2000-3000bp), and the sequences are in opposite orientation, the amplification will be established. This amplified region is said as a RAPD locus • Normally, a few (3-20) loci can be amplified by one single RAPD primer.
  37. 37. Template DNA RAPD  Primer binds to many locations on the template DNA  Only when primer binding sites are close and oriented in opposite direction so the primers point toward each other will amplification take place
  38. 38. Primers at the right distance so amplification will happen 100- 1500 bases
  39. 39. Primers point in the same direction, so amplification won’t happen Template DNA
  40. 40. Primers too far apart so amplification will not happen > 2,000- 3000 bases
  41. 41. RAPD Silver-stained polyacrylamide gel showing three distinct RAPD profiles generated by primer OPE15 for Haemophilus ducreyi isolates
  42. 42. Applications • Has been largely carried out for variability analysis and individual-specific genotyping, but is less popular due to problems such as poor reproducibility, faint or fuzzy products, and difficulty in scoring bands, which lead to inappropriate inferences. • RAPDs have been used for many purposes, ranging from studies at the individual level (e.g. genetic identity) to studies involving closely related species. • RAPDs have also been applied in gene mapping studies to fill gaps not covered by other markers
  43. 43. Limitations • PCR based technique, therefore quality and concentration of template DNA, concentrations of PCR components, and the PCR cycling conditions may greatly influence the outcome. • Thus, the RAPD technique is notoriously laboratory dependent and needs carefully developed laboratory protocols to be reproducible. • Mismatches between the primer and the template may result in the total absence of PCR product as well as in a merely decreased amount of the product. Thus, the RAPD results can be difficult to interpret.
  44. 44. Restriction Fragment Length Polymorphism (RFLP) • RFLP is a technique in which organisms may be differentiated by analysis of patterns derived from cleavage of their DNA. • If two organisms differ in the distance between sites of cleavage of particular Restriction Endonucleases, the length of the fragments produced will differ when the DNA is digested.
  45. 45. • The similarity of the patterns generated can be used to differentiate species (and even strains) from one another. • This technique is mainly based on the special class of enzyme i.e. Restriction Endonucleases. • The variability of restriction sites have their origin in the DNA rearrangements, point mutations within the restriction enzyme recognition site sequences, insertions or deletions within the fragments, and unequal crossing over
  46. 46. A restriction fragment length polymorphism (RFLP) The DNA molecule on the left has a polymorphic restriction site (marked with the asterisk) that is not present in the molecule on the right. The RFLP is revealed after treatment with the restriction enzyme because one of the molecules is cut into four fragments whereas the other is cut into three fragments.
  47. 47. Two methods for scoring an RFLP : (A)RFLPs can be scored by Southern hybridization. The DNA is digested with the appropriate restriction enzyme and separated in an agarose gel. The smear of restriction fragments is transferred to a nylon membrane and probed with a piece of DNA that spans the polymorphic restriction site. If the site is absent then a single restriction fragment is detected (lane 2); if the site is present then two fragments are detected (lane 3).
  48. 48. (B) The RFLP can also be typed by PCR, using primers that anneal either side of the polymorphic restriction site. After the PCR, the products are treated with the appropriate restriction enzyme and then analyzed by agarose gel electrophoresis. If the site is absent then one band is seen on the agarose gel; if the site is present then two bands are seen.
  49. 49. Applications: • RFLPs can be applied in diversity and phylogenetic studies ranging from individuals within populations or species, to closely related species. • RFLPs have been widely used in gene mapping studies because of their high genomic abundance due to the ample availability of different restriction enzymes and random distribution throughout the genome • RFLP markers were used for the first time in the construction of genetic maps
  50. 50. Pulsed field gel electrophoresis (PFGE) Conventional gel electrophoresis techniques: separates DNA fragments from 100 to 200 bp to 50 kilobase pairs (kb) only DNA(>50kb) cant be separated by this method. In 1982, Schwartz introduced the concept that DNA molecules larger than 50 kb can be separated by using two alternating electric fields. In conventional gels, the current is applied in a single direction (from top to bottom). But in PFGE, the direction of the current is altered at a regular interval.
  51. 51. Pulsed-field gel electrophoresis is based on the digestion of bacterial DNA with restriction endonucleases that recognize few sites along the chromosome, generating large DNA fragments (30-800 Kb) The basis for PFGE separation is the size-dependent time-associated reorientation of DNA migration achieved by periodic switching of the electric field in different directions. The DNA fragments will form a distinctive pattern of bands in the gel, which can be analyzed visually and electronically. Bacterial isolates with identical or very similar band patterns are more likely to be related genetically than bacterial isolates with more divergent band patterns.
  52. 52. Example of PFGE typing results (Staphylococcus aureus). Numbers and letters indicate sample and strain assignment, respectively. Samples 1 through 8 originate from herd I, samples 9 through 20 from herd II, and samples 21, 22, and 23 from herds III, IV, and V, respectively.
  53. 53. Advantages of PFGE  PFGE has proved to be an efficient method for genome size estimation  In PFGE DNA fragments obtained by using endonucleases produce a discrete pattern of bands useful for the fingerprinting and physical mapping of the chromosome.  The PFGE technique is useful to establish the degree of relatedness among different strains of the same species.
  54. 54. Applications of PFGE • PFGE is used for epidemiological studies of pathogenic organisms. • PFGE is often employed to track pathogens, such as Salmonella, Shigella, Escherichia coli (including O157), Campylobacter, and Listeria species • PFGE has remarkable discriminatory power and reproducibility. It is currently considered the strain typing method of choice for many commonly encountered pathogens. • PFGE has proven extremely powerful in the analysis of large DNA molecules from a variety of sources including intact chromosomal DNAs from fungi, parasitic protozoa and specifically fragmented genomes of bacteria and mammal.
  55. 55. LIMITATIONS OF PFGE • Time consuming (2-4 days) • Requires a trained and skilled technician. • Pattern results vary slightly between technicians. • Don’t really know if bands of same size are same pieces of DNA. • Not applicable for all organisms. • The choice of restriction enzyme may be important to optimize the results
  56. 56. Conclusion • The future of the molecular diagnostics of infectious diseases will undoubtedly be focused on a marked increase in the amount of information detected with remarkably simplified, rapid platforms that will need complex software analysis to resolve the data for use in clinical decision-making.
  57. 57. THANK YOU

×