Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.

Seminar 14-10-09 - de wisselwerking tussen genen en voeding bij metabole ziekten en veroudering

555 views

Published on

Published in: Health & Medicine
  • Be the first to comment

  • Be the first to like this

Seminar 14-10-09 - de wisselwerking tussen genen en voeding bij metabole ziekten en veroudering

  1. 1. ThThee Interplay of Genes and DietInterplay of Genes and Diet in Metabolic Diseasesin Metabolic Diseases and Agingand Aging Carola ZillikensCarola Zillikens De Wisselwerking tussen Genen en VoedingDe Wisselwerking tussen Genen en Voeding bij Metabole ziekten en Verouderingbij Metabole ziekten en Veroudering
  2. 2. 2,5 miljoen jaar 50 jaar De evolutie van de mens
  3. 3. AchtergrondAchtergrond • Wereldwijde toename van overgewicht en obesitas • De helft van de Nederlanders is te zwaar • Wereldwijd: 1 miljard mensen overgewicht 300 miljoen mensen obesitas
  4. 4. Gevolgen van obesitasGevolgen van obesitas • Suikerziekte • Hart- en vaatziekten • Slijtage van gewrichten • Bepaalde vormen van kanker • En nog veel meer...
  5. 5. OsteoporoseOsteoporose normaal osteoporose • Bij osteoporose (botontkalking) is er sprake van een verlies van botmassa en is de structuur van het bot veranderd
  6. 6. Botbreuken door osteoporoseBotbreuken door osteoporose Ruggewervels Pols Heup
  7. 7. Aantal Osteoporose in Nederland (RIVM)Osteoporose in Nederland (RIVM)
  8. 8. Oorzaken van de metabole ziektenOorzaken van de metabole ziekten obesitas en osteoporoseobesitas en osteoporose • Erfelijke factoren: niet goed bekend welke genen een rol spelen • Omgevingsfactoren (leefstijl) zoals: – Lichaamsbeweging – Dieet: - Veel eten leidt tot obesitas maar lijkt te beschermen tegen osteoporose
  9. 9. Oorzaken van de metabole ziektenOorzaken van de metabole ziekten obesitas en osteoporoseobesitas en osteoporose J. Kanis et al. Osteoporosis International 200819;385-397 hip fracture
  10. 10. Possible mechanisms explainingPossible mechanisms explaining relation body composition and BMDrelation body composition and BMD Gewicht: Loading Spier via activiteit Vet: productie adopokines en hormonen
  11. 11. Vetverdeling bij overgewichtVetverdeling bij overgewicht Voor het hart beter een peervorm dan een appel Geldt dat ook voor het skelet?
  12. 12. Doel van het onderzoekDoel van het onderzoek • Het beter in kaart brengen van de oorzaken van obesitas en osteoporose met nadruk op de erfelijke factoren in relatie tot dieet • Het bestuderen van de relatie tussen de twee aandoeningen
  13. 13. DXA-techniek vet, spier en bot Buik Heupen Heup Dij Middel Omtrek MethodenMethoden
  14. 14. GGAGTCTGACTGACCATTGGACTAGGGGATTGACCAGTAGGCTGCGATTCGGATGCGGATTGACGATTAAAAAGGATTACGATTAGCGGAGTCTGACTGACCATTGGACTAGGGGATTGACCAGTAGGCTGCGATTCGGATGCGGATTGACGATTAAAAAGGATTACGATTAGC GTGACGTGCAGGATGCTGCGATGCTGGACTGAACGCCCCCCGGGCTTCTTTATTAGCTGCTGACGTGCCAGATGCTGACGTGCAGTGGTGACGTGCAGGATGCTGCGATGCTGGACTGAACGCCCCCCGGGCTTCTTTATTAGCTGCTGACGTGCCAGATGCTGACGTGCAGTG GGCTGACGGTGCTTACCTGGATCGGATGCTACCAGTCGATCGATCGATCGTAGCGTAGCGTATGCTAGCTAGTGATCGATGCTAGTAGGCTGACGGTGCTTACCTGGATCGGATGCTACCAGTCGATCGATCGATCGTAGCGTAGCGTATGCTAGCTAGTGATCGATGCTAGTA CTAGCTAGCTGATCGATCATCGATCGTAGCTAGCTAGCTAGCTAGCTGATCGATCGATGCTAGCTAGCTAGCTAGTCATCTGTGGTGCTAGCTAGCTGATCGATCATCGATCGTAGCTAGCTAGCTAGCTAGCTGATCGATCGATGCTAGCTAGCTAGCTAGTCATCTGTGGTGG GGGTTAAATGCGATTGCCGCTAGCTAGAACAAAATAGCGGTATTTTGGGGAGTCTGACTGACCATTGGACTAGGGGATTGACCAGTAGGGTTAAATGCGATTGCCGCTAGCTAGAACAAAATAGCGGTATTTTGGGGAGTCTGACTGACCATTGGACTAGGGGATTGACCAGTA GCTGCGATTCGGATGCGGATTGACGATTAAAAAGGATTACGATTAGCTGTGACGTGCAGGATGCTGCGATGCTGGACTGAACGCCCGCTGCGATTCGGATGCGGATTGACGATTAAAAAGGATTACGATTAGCTGTGACGTGCAGGATGCTGCGATGCTGGACTGAACGCCC CGGGCTTCTTTATTAGCTGCTGACGTGCCAGATGCTGACGTGCAGTGCGGCTGACGGAGTCTGACTGACCATTGGACTAGGGGATTGCGGGCTTCTTTATTAGCTGCTGACGTGCCAGATGCTGACGTGCAGTGCGGCTGACGGAGTCTGACTGACCATTGGACTAGGGGATTG CCAGTAGGCTGCGATTCGGATGCGGATTGACGATTAAAAAGGATTACGATTAGCTGTGACGTGCAGGATGCTGCGATGCTGGACTGACCAGTAGGCTGCGATTCGGATGCGGATTGACGATTAAAAAGGATTACGATTAGCTGTGACGTGCAGGATGCTGCGATGCTGGACTGA CGCCCCCCGGGCTTCTTTATTAGCTGCTGACGTGCCAGATGCTGACGTGCAGTGCGGCTGACGGTGCTTACCTGGATCGGATGCTACCGCCCCCCGGGCTTCTTTATTAGCTGCTGACGTGCCAGATGCTGACGTGCAGTGCGGCTGACGGTGCTTACCTGGATCGGATGCTAC AGTCGATCGATCGATCGTAGCGTAGCGTATGCTAGCTAGTGATCGATGCTAGTAGCTAGCTAGCTGATCGATCATCGATCGTAGCTAAGTCGATCGATCGATCGTAGCGTAGCGTATGCTAGCTAGTGATCGATGCTAGTAGCTAGCTAGCTGATCGATCATCGATCGTAGCTA CTAGCTAGCTAGCTGATCGATCGATGCTAGCTAGCTAGCTAGTCATCTGTGGTGGGGGGTTAAATGCGATTGCCGCTAGCTAGAACACTAGCTAGCTAGCTGATCGATCGATGCTAGCTAGCTAGCTAGTCATCTGTGGTGGGGGGTTAAATGCGATTGCCGCTAGCTAGAACA AATAGCGGTATTTTGGGGAGTCTGACTGACCATTGGACTAGGGGATTGACCAGTAGGCTGCGATTCGGATGCGGATTGACGATTAAAAATAGCGGTATTTTGGGGAGTCTGACTGACCATTGGACTAGGGGATTGACCAGTAGGCTGCGATTCGGATGCGGATTGACGATTAAA AGGATTACGATTAGCTGTGACGTGCAGGATGCTGCGATGCTGGACTGAACGCCCCCCGGGCTTCTTTATTAGCTGCTGACGTGCCAGAGGATTACGATTAGCTGTGACGTGCAGGATGCTGCGATGCTGGACTGAACGCCCCCCGGGCTTCTTTATTAGCTGCTGACGTGCCAG TGCTGACGTGCAGTGAGGAGTCTGACTGACCATTGGACTAGGGGATTGACCAGTAGGCTGCGATTCGGATGCGGATTGACGATTAATGCTGACGTGCAGTGAGGAGTCTGACTGACCATTGGACTAGGGGATTGACCAGTAGGCTGCGATTCGGATGCGGATTGACGATTAA AGGATTACGATTAGCTGTGACGTGCAGGATGCTGCGATGCTGGACTGAACGCCCCCCGGGCTTCTTTATTAGCTGCTGACGTGCCAGAGGATTACGATTAGCTGTGACGTGCAGGATGCTGCGATGCTGGACTGAACGCCCCCCGGGCTTCTTTATTAGCTGCTGACGTGCCAG TGCTGACGTGCAGTGCGGCTGACGGTGCTTACCTGGATCGGATGCTACTGCTGACGTGCAGTGCGGCTGACGGTGCTTACCTGGATCGGATGCTACCAGTCGATCGATCGATCGTAGCGTAGCGTATGCTAGCTAAGTCGATCGATCGATCGTAGCGTAGCGTATGCTAGCTA TGATCGATGCTAGTAGCTAGCTAGCTGATCGATCATCGATAACCGCATAAGGGCTAGCTAGCTGATCGATCGATGCTAGCTAGCTAGTGATCGATGCTAGTAGCTAGCTAGCTGATCGATCATCGATAACCGCATAAGGGCTAGCTAGCTGATCGATCGATGCTAGCTAGCTAG TAGTCATCTGTGGTGGGGGGTTAAATGCGATTGCCGCTAGCTAGAACAAAATAGCGGTATTTTGGCGGCTGACGGTGCTTACCTGGATAGTCATCTGTGGTGGGGGGTTAAATGCGATTGCCGCTAGCTAGAACAAAATAGCGGTATTTTGGCGGCTGACGGTGCTTACCTGGA CGGATGCTACCAGTCGATCGATCGATCGTAGCGTAGCGTATGCTAGCTAGTGATCGATGCTAGTAAGGAGTCTGACTGACCATTGGACGGATGCTACCAGTCGATCGATCGATCGTAGCGTAGCGTATGCTAGCTAGTGATCGATGCTAGTAAGGAGTCTGACTGACCATTGGA TAGGGGATTGACCAGTAGGCTGCGATTCGGATGCGGATTGACGATTAAAAAGGATTACGATTAGCTGTGACGTGCAGGATGCTGCGTAGGGGATTGACCAGTAGGCTGCGATTCGGATGCGGATTGACGATTAAAAAGGATTACGATTAGCTGTGACGTGCAGGATGCTGCG GCTGGACTGAACGCCCCCCGGGCTTCTTTATTAGCTGCTGACGTGCCAGATGCTGACGTGCAGTGCGGCTGACGGTGCTTACCTGGGCTGGACTGAACGCCCCCCGGGCTTCTTTATTAGCTGCTGACGTGCCAGATGCTGACGTGCAGTGCGGCTGACGGTGCTTACCTGGA CGGATGCTACCAGTCGATCGATCGATCGTAGCGTAGCGTATGCTAGCTAGTGATCGATGCTAGTAGCTAGCTAGCTGATCGATCATCCGGATGCTACCAGTCGATCGATCGATCGTAGCGTAGCGTATGCTAGCTAGTGATCGATGCTAGTAGCTAGCTAGCTGATCGATCATC ATCGTAGCTAGCTAGCTAGCTAGCTGATCGATCGATGCTAGCTAGCTAGCTAGTCATCTGTGGTGGGGGGTTAAATGCGATTGCCGCATCGTAGCTAGCTAGCTAGCTAGCTGATCGATCGATGCTAGCTAGCTAGCTAGTCATCTGTGGTGGGGGGTTAAATGCGATTGCCGC AGCTAGAACAAAATAGCGGTATTTTGGAGGAGTCTGACTGACCATTGGACTAGGGGATTGACCAGTAGGCTGCGATTCGGATGCGGAAGCTAGAACAAAATAGCGGTATTTTGGAGGAGTCTGACTGACCATTGGACTAGGGGATTGACCAGTAGGCTGCGATTCGGATGCGGA TGACGATTAAAAAGGATTACGATTAGCTGTGACGTGCAGGATGCTGCGATGCTGGACTGAACGCCCCCCGGGCTTCTTTATTAGCTGTGACGATTAAAAAGGATTACGATTAGCTGTGACGTGCAGGATGCTGCGATGCTGGACTGAACGCCCCCCGGGCTTCTTTATTAGCTG TGACGTGCCAGATGCTGACGTGCAGTGCGGCTGACGGTGCTTACCTGGATCGGATGCTACCAGTCGATCGATCGATCGTAGCGTAGTGACGTGCCAGATGCTGACGTGCAGTGCGGCTGACGGTGCTTACCTGGATCGGATGCTACCAGTCGATCGATCGATCGTAGCGTAG GTATGCTAGCTAGTGATCGATGCTAGTAGCTAGCTAGCTGATCGATCATCGATCGTAGCTAGCTAGCTAGCTAGCTGATCGATCGATGGTATGCTAGCTAGTGATCGATGCTAGTAGCTAGCTAGCTGATCGATCATCGATCGTAGCTAGCTAGCTAGCTAGCTGATCGATCGATG TAGCTAGCTAGCTAGTCATCTGTGGTGGGGGGTTAAATGCGATTGCCGCTAGCTAGAACAAAATAGCGGTATTTTGGGCTAGCTAGCTAGCTAGCTAGCTAGTCATCTGTGGTGGGGGGTTAAATGCGATTGCCGCTAGCTAGAACAAAATAGCGGTATTTTGGGCTAGCTAGC GATCGATCATCGATCGTAGCTAGCTAGCTAGCTAGCTGATCGATCGATGCTAGCTAGCTAGCTAGTCATCTGTGGTGGGGGGTTAAAGATCGATCATCGATCGTAGCTAGCTAGCTAGCTAGCTGATCGATCGATGCTAGCTAGCTAGCTAGTCATCTGTGGTGGGGGGTTAAA CGATTGCCGCTAGCTAGAACAAAATAGCGGTATTTTGGGGTGCTTACCTGGATCGGATGCTACCAGTCGATCGATCGATCGTAGCGTCGATTGCCGCTAGCTAGAACAAAATAGCGGTATTTTGGGGTGCTTACCTGGATCGGATGCTACCAGTCGATCGATCGATCGTAGCGT GCGTATGCTAGCTAGTGATCGATGCTAGTAGCTAGCTAGCTGATCGATCATCGATCGTAGCTAGCTAGCTAGCTAGCTGATCGATCGGCGTATGCTAGCTAGTGATCGATGCTAGTAGCTAGCTAGCTGATCGATCATCGATCGTAGCTAGCTAGCTAGCTAGCTGATCGATCG GCTAGCTAGCTAGCTAGTCATCTGTGGTGGGGGGTTAAATGCGATTGCCGCTAGCTAGAACAAAATAGCGGTATTTTGGAGGAGTCTGCTAGCTAGCTAGCTAGTCATCTGTGGTGGGGGGTTAAATGCGATTGCCGCTAGCTAGAACAAAATAGCGGTATTTTGGAGGAGTCT ACTGACCATTGGACTAGGGGATTGACCAGTAGGCTGCGATTCGGATGCGGATTGACGATTAAAAAGGATTACGATTAGCTGTGACGTACTGACCATTGGACTAGGGGATTGACCAGTAGGCTGCGATTCGGATGCGGATTGACGATTAAAAAGGATTACGATTAGCTGTGACGT CAGGATGCTGCGATGCTGGACTGAACGCCCCCCGGGCTTCTTTATTAGCTGCTGACGTGCCAGATGCTGACGTGCAGTGCGGCTGACAGGATGCTGCGATGCTGGACTGAACGCCCCCCGGGCTTCTTTATTAGCTGCTGACGTGCCAGATGCTGACGTGCAGTGCGGCTGA GGTGCTTACCTGGATCGGATGCTACCAGTCGATCGATCGATCGTAGCGTAGCGTATGCTAGCTAGTGATCGATGCTAGTAGCTAGCTGGTGCTTACCTGGATCGGATGCTACCAGTCGATCGATCGATCGTAGCGTAGCGTATGCTAGCTAGTGATCGATGCTAGTAGCTAGCT GCTGATCGATAGCTAGCTGATCGATCATCGATCGTAGCTAGCTAGCTAGCTAGCTGATCGATCGATGCTAGCTAGCTAGCTAGTTAGCGCTGATCGATAGCTAGCTGATCGATCATCGATCGTAGCTAGCTAGCTAGCTAGCTGATCGATCGATGCTAGCTAGCTAGCTAGTTAGC AGCTAGCTAGCTGATCGATCGATGCTAGCTAGCTAGCTAGTCATCTGTGGTGGGGGGTTAAATGCGATTGCCGCTAGCTAGAACAAAAGCTAGCTAGCTGATCGATCGATGCTAGCTAGCTAGCTAGTCATCTGTGGTGGGGGGTTAAATGCGATTGCCGCTAGCTAGAACAAA TAGCGGTATTTTGGGCTAGCTAGCTGATCGATCATCGATCGTAGCTAGCTAGCTAGCTAGCTGATCGATCGATGCTAGCTAGCTAGCT Variaties in het DNAVariaties in het DNA
  15. 15. GGAGTCTGACTGACCATTGGACTAGGGGATTGACCAGTAGGCTGCGATTCGGATGCGGATTGACGATTAAAAAGGATTACGATTAGCGGAGTCTGACTGACCATTGGACTAGGGGATTGACCAGTAGGCTGCGATTCGGATGCGGATTGACGATTAAAAAGGATTACGATTAGC GTGACGTGCAGGATGCTGCGATGCTGGACTGAACGCCCCCCGGGCTTCTTTATTAGCTGCTGACGTGCCAGATGCTGACGTGCAGTGGTGACGTGCAGGATGCTGCGATGCTGGACTGAACGCCCCCCGGGCTTCTTTATTAGCTGCTGACGTGCCAGATGCTGACGTGCAGTG GGCTGACGGTGCTTACCTGGATCGGATGCTACCAGTCGATCGATCGATCGTAGCGTAGCGTATGCTAGCTAGTGATCGATGCTAGTAGGCTGACGGTGCTTACCTGGATCGGATGCTACCAGTCGATCGATCGATCGTAGCGTAGCGTATGCTAGCTAGTGATCGATGCTAGTA CTAGCTAGCTGATCGATCATCGATCGTAGCTAGCTAGCTAGCTAGCTGATCGATCGATGCTAGCTAGCTAGCTAGTCATCTGTGGTGCTAGCTAGCTGATCGATCATCGATCGTAGCTAGCTAGCTAGCTAGCTGATCGATCGATGCTAGCTAGCTAGCTAGTCATCTGTGGTGG GGGTTAAATGCGATTGCCGCTAGCTAGAACAAAATAGCGGTATTTTGGGGAGTCTGACTGACCATTGGACTAGGGGATTGACCAGTAGGGTTAAATGCGATTGCCGCTAGCTAGAACAAAATAGCGGTATTTTGGGGAGTCTGACTGACCATTGGACTAGGGGATTGACCAGTA GCTGCGATTCGGATGCGGATTGACGATTAAAAAGGATTACGATTAGCTGTGACGTGCAGGATGCTGCGATGCTGGACTGAACGCCCGCTGCGATTCGGATGCGGATTGACGATTAAAAAGGATTACGATTAGCTGTGACGTGCAGGATGCTGCGATGCTGGACTGAACGCCC CGGGCTTCTTTATTAGCTGCTGACGTGCCAGATGCTGACGTGCAGTGCGGCTGACGGAGTCTGACTGACCATTGGACTAGGGGATTGCGGGCTTCTTTATTAGCTGCTGACGTGCCAGATGCTGACGTGCAGTGCGGCTGACGGAGTCTGACTGACCATTGGACTAGGGGATTG CCAGTAGGCTGCGATTCGGATGCGGATTGACGATTAAAAAGGATTACGATTAGCTGTGACGTGCAGGATGCTGCGATGCTGGACTGACCAGTAGGCTGCGATTCGGATGCGGATTGACGATTAAAAAGGATTACGATTAGCTGTGACGTGCAGGATGCTGCGATGCTGGACTGA CGCCCCCCGGGCTTCTTTATTAGCTGCTGACGTGCCAGATGCTGACGTGCAGTGCGGCTGACGGTGCTTACCTGGATCGGATGCTACCGCCCCCCGGGCTTCTTTATTAGCTGCTGACGTGCCAGATGCTGACGTGCAGTGCGGCTGACGGTGCTTACCTGGATCGGATGCTAC AGTCGATCGATCGATCGTAGCGTAGCGTATGCTAGCTAGTGATCGATGCTAGTAGCTAGCTAGCTGATCGATCATCGATCGTAGCTAAGTCGATCGATCGATCGTAGCGTAGCGTATGCTAGCTAGTGATCGATGCTAGTAGCTAGCTAGCTGATCGATCATCGATCGTAGCTA CTAGCTAGCTAGCTGATCGATCGATGCTAGCTAGCTAGCTAGTCATCTGTGGTGGGGGGTTAAATGCGATTGCCGCTAGCTAGAACACTAGCTAGCTAGCTGATCGATCGATGCTAGCTAGCTAGCTAGTCATCTGTGGTGGGGGGTTAAATGCGATTGCCGCTAGCTAGAACA AATAGCGGTATTTTGGGGAGTCTGACTGACCATTGGACTAGGGGATTGACCAGTAGGCTGCGATTCGGATGCGGATTGACGATTAAAAATAGCGGTATTTTGGGGAGTCTGACTGACCATTGGACTAGGGGATTGACCAGTAGGCTGCGATTCGGATGCGGATTGACGATTAAA AGGATTACGATTAGCTGTGACGTGCAGGATGCTGCGATGCTGGACTGAACGCCCCCCGGGCTTCTTTATTAGCTGCTGACGTGCCAGAGGATTACGATTAGCTGTGACGTGCAGGATGCTGCGATGCTGGACTGAACGCCCCCCGGGCTTCTTTATTAGCTGCTGACGTGCCAG TGCTGACGTGCAGTGAGGAGTCTGACTGACCATTGGACTAGGGGATTGACCAGTAGGCTGCGATTCGGATGCGGATTGACGATTAATGCTGACGTGCAGTGAGGAGTCTGACTGACCATTGGACTAGGGGATTGACCAGTAGGCTGCGATTCGGATGCGGATTGACGATTAA AGGATTACGATTAGCTGTGACGTGCAGGATGCTGCGATGCTGGACTGAACGCCCCCCGGGCTTCTTTATTAGCTGCTGACGTGCCAGAGGATTACGATTAGCTGTGACGTGCAGGATGCTGCGATGCTGGACTGAACGCCCCCCGGGCTTCTTTATTAGCTGCTGACGTGCCAG TGCTGACGTGCAGTGCGGCTGACGGTGCTTACCTGGATCGGATGCTACTGCTGACGTGCAGTGCGGCTGACGGTGCTTACCTGGATCGGATGCTACCAGTCGATCGATCGATCGTAGCGTAGCGTATGCTAGCTAAGTCGATCGATCGATCGTAGCGTAGCGTATGCTAGCTA TGATCGATGCTAGTAGCTAGCTAGCTGATCGATCATCGATAACCGCATAAGGGCTAGCTAGCTGATCGATCGATGCTAGCTAGCTAGTGATCGATGCTAGTAGCTAGCTAGCTGATCGATCATCGATAACCGCATAAGGGCTAGCTAGCTGATCGATCGATGCTAGCTAGCTAG TAGTCATCTGTGGTGGGGGGTTAAATGCGATTGCCGCTAGCTAGAACAAAATAGCGGTATTTTGGCGGCTGACGGTGCTTACCTGGATAGTCATCTGTGGTGGGGGGTTAAATGCGATTGCCGCTAGCTAGAACAAAATAGCGGTATTTTGGCGGCTGACGGTGCTTACCTGGA CGGATGCTACCAGTCGATCGATCGATCGTAGCGTAGCGTATGCTAGCTAGTGATCGATGCTAGTAAGGAGTCTGACTGACCATTGGACGGATGCTACCAGTCGATCGATCGATCGTAGCGTAGCGTATGCTAGCTAGTGATCGATGCTAGTAAGGAGTCTGACTGACCATTGGA TAGGGGATTGACCAGTAGGCTGCGATTCGGATGCGGATTGACGATTAAAAAGGATTACGATTAGCTGTGACGTGCAGGATGCTGCGTAGGGGATTGACCAGTAGGCTGCGATTCGGATGCGGATTGACGATTAAAAAGGATTACGATTAGCTGTGACGTGCAGGATGCTGCG GCTGGACTGAACGCCCCCCGGGCTTCTTTATTAGCTGCTGACGTGCCAGATGCTGACGTGCAGTGCGGCTGACGGTGCTTACCTGGGCTGGACTGAACGCCCCCCGGGCTTCTTTATTAGCTGCTGACGTGCCAGATGCTGACGTGCAGTGCGGCTGACGGTGCTTACCTGGA CGGATGCTACCAGTCGATCGATCGATCGTAGCGTAGCGTATGCTAGCTAGTGATCGATGCTAGTAGCTAGCTAGCTGATCGATCATCCGGATGCTACCAGTCGATCGATCGATCGTAGCGTAGCGTATGCTAGCTAGTGATCGATGCTAGTAGCTAGCTAGCTGATCGATCATC ATCGTAGCTAGCTAGCTAGCTAGCTGATCGATCGATGCTAGCTAGCTAGCTAGTCATCTGTGGTGGGGGGTTAAATGCGATTGCCGCATCGTAGCTAGCTAGCTAGCTAGCTGATCGATCGATGCTAGCTAGCTAGCTAGTCATCTGTGGTGGGGGGTTAAATGCGATTGCCGC AGCTAGAACAAAATAGCGGTATTTTGGAGGAGTCTGACTGACCATTGGACTAGGGGATTGACCAGTAGGCTGCGATTCGGATGCGGAAGCTAGAACAAAATAGCGGTATTTTGGAGGAGTCTGACTGACCATTGGACTAGGGGATTGACCAGTAGGCTGCGATTCGGATGCGGA TGACGATTAAAAAGGATTACGATTAGCTGTGACGTGCAGGATGCTGCGATGCTGGACTGAACGCCCCCCGGGCTTCTTTATTAGCTGTGACGATTAAAAAGGATTACGATTAGCTGTGACGTGCAGGATGCTGCGATGCTGGACTGAACGCCCCCCGGGCTTCTTTATTAGCTG TGACGTGCCAGATGCTGACGTGCAGTGCGGCTGACGGTGCTTACCTGGATCGGATGCTACCAGTCGATCGATCGATCGTAGCGTAGTGACGTGCCAGATGCTGACGTGCAGTGCGGCTGACGGTGCTTACCTGGATCGGATGCTACCAGTCGATCGATCGATCGTAGCGTAG GTATGCTAGCTAGTGATCGATGCTAGTAGCTAGCTAGCTGATCGATCATCGATCGTAGCTAGCTAGCTAGCTAGCTGATCGATCGATGGTATGCTAGCTAGTGATCGATGCTAGTAGCTAGCTAGCTGATCGATCATCGATCGTAGCTAGCTAGCTAGCTAGCTGATCGATCGATG TAGCTAGCTAGCTAGTCATCTGTGGTGGGGGGTTAAATGCGATTGCCGCTAGCTAGAACAAAATAGCGGTATTTTGGGCTAGCTAGCTAGCTAGCTAGCTAGTCATCTGTGGTGGGGGGTTAAATGCGATTGCCGCTAGCTAGAACAAAATAGCGGTATTTTGGGCTAGCTAGC GATCGATCATCGATCGTAGCTAGCTAGCTAGCTAGCTGATCGATCGATGCTAGCTAGCTAGCTAGTCATCTGTGGTGGGGGGTTAAAGATCGATCATCGATCGTAGCTAGCTAGCTAGCTAGCTGATCGATCGATGCTAGCTAGCTAGCTAGTCATCTGTGGTGGGGGGTTAAA CGATTGCCGCTAGCTAGAACAAAATAGCGGTATTTTGGGGTGCTTACCTGGATCGGATGCTACCAGTCGATCGATCGATCGTAGCGTCGATTGCCGCTAGCTAGAACAAAATAGCGGTATTTTGGGGTGCTTACCTGGATCGGATGCTACCAGTCGATCGATCGATCGTAGCGT GCGTATGCTAGCTAGTGATCGATGCTAGTAGCTAGCTAGCTGATCGATCATCGATCGTAGCTAGCTAGCTAGCTAGCTGATCGATCGGCGTATGCTAGCTAGTGATCGATGCTAGTAGCTAGCTAGCTGATCGATCATCGATCGTAGCTAGCTAGCTAGCTAGCTGATCGATCG GCTAGCTAGCTAGCTAGTCATCTGTGGTGGGGGGTTAAATGCGATTGCCGCTAGCTAGAACAAAATAGCGGTATTTTGGAGGAGTCTGCTAGCTAGCTAGCTAGTCATCTGTGGTGGGGGGTTAAATGCGATTGCCGCTAGCTAGAACAAAATAGCGGTATTTTGGAGGAGTCT ACTGACCATTGGACTAGGGGATTGACCAGTAGGCTGCGATTCGGATGCGGATTGACGATTAAAAAGGATTACGATTAGCTGTGACGTACTGACCATTGGACTAGGGGATTGACCAGTAGGCTGCGATTCGGATGCGGATTGACGATTAAAAAGGATTACGATTAGCTGTGACGT CAGGATGCTGCGATGCTGGACTGAACGCCCCCCGGGCTTCTTTATTAGCTGCTGACGTGCCAGATGCTGACGTGCAGTGCGGCTGACAGGATGCTGCGATGCTGGACTGAACGCCCCCCGGGCTTCTTTATTAGCTGCTGACGTGCCAGATGCTGACGTGCAGTGCGGCTGA GGTGCTTACCTGGATCGGATGCTACCAGTCGATCGATCGATCGTAGCGTAGCGTATGCTAGCTAGTGATCGATGCTAGTAGCTAGCTGGTGCTTACCTGGATCGGATGCTACCAGTCGATCGATCGATCGTAGCGTAGCGTATGCTAGCTAGTGATCGATGCTAGTAGCTAGCT GCTGATCGATAGCTAGCTGATCGATCATCGATCGTAGCTAGCTAGCTAGCTAGCTGATCGATCGATGCTAGCTAGCTAGCTAGTTAGCGCTGATCGATAGCTAGCTGATCGATCATCGATCGTAGCTAGCTAGCTAGCTAGCTGATCGATCGATGCTAGCTAGCTAGCTAGTTAGC AGCTAGCTAGCTGATCGATCGATGCTAGCTAGCTAGCTAGTCATCTGTGGTGGGGGGTTAAATGCGATTGCCGCTAGCTAGAACAAAAGCTAGCTAGCTGATCGATCGATGCTAGCTAGCTAGCTAGTCATCTGTGGTGGGGGGTTAAATGCGATTGCCGCTAGCTAGAACAAA TAGCGGTATTTTGGGCTAGCTAGCTGATCGATCATCGATCGTAGCTAGCTAGCTAGCTAGCTGATCGATCGATGCTAGCTAGCTAGCT Variaties in het DNAVariaties in het DNA BOERBOER BIERBIER
  16. 16. ERGO: de Rotterdam StudieERGO: de Rotterdam Studie • Bevolkingsonderzoek in regio Ommoord • Naar chronische ziekten bij ouderen • Gestart in 1990 bij 7.983 personen > 55 jaar • 4 vervolgbezoeken
  17. 17. • Familieonderzoek in genetische geïsoleerde bevolkingsgroep in Brabant • ~ 3.000 personen van 20 – 80 jaar onderzocht van 2002-2005 ERF: ErasmusERF: Erasmus Rucphen Familie StudieRucphen Familie Studie
  18. 18. Bevindingen: bot en gewichtBevindingen: bot en gewicht • Een hoger gewicht gaat gepaard met een hogere botmineraaldichtheid (BMD)
  19. 19. Bevindingen: bot en gewichtBevindingen: bot en gewicht • Een hoger gewicht gaat gepaard met een hogere botmineraaldichtheid (BMD) • Bij een zelfde gewicht: BMD BMD
  20. 20. • Spier- en vetmassa en vetverdeling voor ~ 45% door erfelijke factoren bepaald • Bij mannen en vrouwen deels door andere genen gereguleerd Bevindingen:Bevindingen: erfelijkheidsonderzoekerfelijkheidsonderzoek
  21. 21. Clinical Expression: Risk Factors: Fracture Risk Bone Strength Impact Force Fall Risk DNADNA ppoollyymmoorrpphhiissmmss BMD Quality Geometry Osteoporosis is a “complex” genetic disease: Environmental factors: diet, exercise, sun exposure, ...
  22. 22. How do we find disease genes ? Soon..... “Top-down”/hypothesis free * Genome-Wide Linkage Analysis - Genotype 400 DNA markers genome-wide - Pedigrees * Genome-Wide-Association Analysis - Genotype >500.000 SNPs genome-wide - population-based: case/control or cohort “Bottom-up”/up-front hypothesis * Association Analyses of Candidate Gene Polymorphisms (based on biology) EffectivenessApproaches - + ? Resolution 5-20 million bp 5-50 thousand bp 1 bp +/-
  23. 23. Genetic architecture of complex traits: an emerging picture for BMD Population Frequency of Trait Value Mutations with severe effects Common polymorphisms with moderate effects Rare RareCommon Mutations with severe effects BMD LRP5 SOST ClCN7 Etc. LRP5 COLIA1 Etc. LRP5 VDR COLIA1 Etc. Low High
  24. 24. AGGAGTCTGACTGACCATTGGACTAGGGGATTGACCAGTAGGCTGCGATTCGGATGCGGATTGACGATTAGGAGTCTGACTGACCATTGGACTAGGGGATTGACCAGTAGGCTGCGATTCGGATGCGGATTGACGATTAAAAAAAAAGGATTACGAAGGATTACGA TTAGCTGTGACGTGCAGGATGCTGCGATGCTGGACTGAACGCCCCCCGGGCTTCTTTATTAGCTGCTGACGTGCCAGATGCTGTTAGCTGTGACGTGCAGGATGCTGCGATGCTGGACTGAACGCCCCCCGGGCTTCTTTATTAGCTGCTGACGTGCCAGATGCTG ACGTGCAGTGCGGCTGACGGTGCTTACCTGGATCGGATGCTACCAGTCGATCGATCGATCGTAGCGTAGCGTATGCTAGCTAGACGTGCAGTGCGGCTGACGGTGCTTACCTGGATCGGATGCTACCAGTCGATCGATCGATCGTAGCGTAGCGTATGCTAGCTAG TGATCGATGCTAGTAGTGATCGATGCTAGTAGCCTAGCTAGCTGATCGATCATCGATCGTAGCTAGCTAGCTAGCTAGCTGATCGATCGATGCTAGCTAGCTAGCTAGCTGATCGATCATCGATCGTAGCTAGCTAGCTAGCTAGCTGATCGATCGATGCTAGCTAGC TAGCTAGTCATCTGTGGTGGGGGGTTAAATGCGATTGCCGCTAGCTAGAACAAAATAGCGGTATTTTGGGGAGTCTGACTGACTAGCTAGTCATCTGTGGTGGGGGGTTAAATGCGATTGCCGCTAGCTAGAACAAAATAGCGGTATTTTGGGGAGTCTGACTGAC CATTGGACTAGGGGATTGACCAGTAGGCTGCGATTCGGATGCGGATTGACGATTAAAAAGGATTACGATTAGCTGTGACGTGCCATTGGACTAGGGGATTGACCAGTAGGCTGCGATTCGGATGCGGATTGACGATTAAAAAGGATTACGATTAGCTGTGACGTGC AGGATGCTGCGATGCTGGACTGAACGCCCCCCGGGCTTCTTTATTAGCTGCTGACGTGCCAGATGCTGACGTGCAGTGCGGCTAGGATGCTGCGATGCTGGACTGAACGCCCCCCGGGCTTCTTTATTAGCTGCTGACGTGCCAGATGCTGACGTGCAGTGCGGCT GACGGAGTCTGACTGACCATTGGACTAGGGGATTGACCAGTAGGCTGCGATTCGGATGCGGATTGACGACGGAGTCTGACTGACCATTGGACTAGGGGATTGACCAGTAGGCTGCGATTCGGATGCGGATTGACGGATTAAAAAGGATTACATTAAAAAGGATTAC GATTAGCTGTGACGTGCAGGATGCTGCGATGCTGGACTGAACGCCCCCCGGGCTTCTTTATTAGCTGCTGACGTGCCAGATGCGATTAGCTGTGACGTGCAGGATGCTGCGATGCTGGACTGAACGCCCCCCGGGCTTCTTTATTAGCTGCTGACGTGCCAGATGC TGACGTGCAGTGCGGCTGACGGTGCTTACCTGGATCGGATGCTACCAGTCGATCGATCGATCGTAGCGTAGCGTATGCTAGCTTGACGTGCAGTGCGGCTGACGGTGCTTACCTGGATCGGATGCTACCAGTCGATCGATCGATCGTAGCGTAGCGTATGCTAGCT AGTGATCGATGCTAGTAGCTAGCTAGCTGATCGATCATCGATCGTAGCTAGCTAGCTAGCTAGCTGATCGATCGATGCTAGCTAAGTGATCGATGCTAGTAGCTAGCTAGCTGATCGATCATCGATCGTAGCTAGCTAGCTAGCTAGCTGATCGATCGATGCTAGCTA GCTAGCTAGTCATCTGTGGTGGGGGGTTAAATGCGATTGCCGCTAGCTAGAACAAAATAGCGGTATTTTGGGGAGTCTGACTGGCTAGCTAGTCATCTGTGGTGGGGGGTTAAATGCGATTGCCGCTAGCTAGAACAAAATAGCGGTATTTTGGGGAGTCTGACTG ACCATTGGACTAGGGGATTGACCAGTACCATTGGACTAGGGGATTGACCAGTAAGGCTGCGATTCGGATGCGGATTGACGATTAAAAAGGATTACGATTAGCTGTGACGTGGCTGCGATTCGGATGCGGATTGACGATTAAAAAGGATTACGATTAGCTGTGACGT GCAGGATGCTGCGATGCTGGACTGAACGCCCCCCGGGCTTCTTTATTAGCAGGATGCTGCGATGCTGGACTGAACGCCCCCCGGGCTTCTTTATTAGGCTCTGGCTGACGTGCCAGATGCTGACGTGCAGTGAGCTGACGTGCCAGATGCTGACGTGCAGTGAG GAGTCTGACTGACCATTGGACTAGGGGATTGACCAGTAGGCTGCGATTCGGATGCGGATTGACGATTAAAAAGGATTACGATTAGAGTCTGACTGACCATTGGACTAGGGGATTGACCAGTAGGCTGCGATTCGGATGCGGATTGACGATTAAAAAGGATTACGATTA GCTGTGACGTGCAGGATGCTGCGATGCTGGACTGAACGCCCCCCGGGCTTCTTTATTAGCTGCTGACGTGCCAGATGCTGACGGCTGTGACGTGCAGGATGCTGCGATGCTGGACTGAACGCCCCCCGGGCTTCTTTATTAGCTGCTGACGTGCCAGATGCTGACG TGCAGTGCGGCTGACGGTGCTTACCTGGATCGGATGCTACCAGTCGATCGATCGATCGTAGCGTAGCGTATGCTAGCTAGTGATGCAGTGCGGCTGACGGTGCTTACCTGGATCGGATGCTACCAGTCGATCGATCGATCGTAGCGTAGCGTATGCTAGCTAGTGA TCGATGCTAGTAGCTAGCTAGCTGATCGATCATCGATAACCGTCGATGCTAGTAGCTAGCTAGCTGATCGATCATCGATAACCGTTATAAGGGCTAGCTAGCTGATCGATCGATGCTAGCTAGCTAGATAAGGGCTAGCTAGCTGATCGATCGATGCTAGCTAGCTAG CTAGTCATCTGTGGTGGGGGGTTAAATGCGATTGCCGCTAGCTAGAACAAAATAGCGGTATTTTGGCGGCTGACGGTGCTTACCTAGTCATCTGTGGTGGGGGGTTAAATGCGATTGCCGCTAGCTAGAACAAAATAGCGGTATTTTGGCGGCTGACGGTGCTTAC CTGGATCGGATGCTACCAGTCGATCGATCGATCGTAGCGTAGCGTATGCTAGCTAGTGATCGATGCTAGTAAGGAGTCTGACTCTGGATCGGATGCTACCAGTCGATCGATCGATCGTAGCGTAGCGTATGCTAGCTAGTGATCGATGCTAGTAAGGAGTCTGACT GACCATTGGACTAGGGGATTGACCAGTAGGCTGCGATTCGGATGCGGATTGACGATTAAAAAGGATTACGATTAGCTGTGACGACCATTGGACTAGGGGATTGACCAGTAGGCTGCGATTCGGATGCGGATTGACGATTAAAAAGGATTACGATTAGCTGTGACGG TGCAGGATGCTGCGATGCTGGACTGAACGCCCCCCGGGCTTCTTTATTAGCTGCTGACGTGCCAGATGCTGACGTGCAGTGCGTGCAGGATGCTGCGATGCTGGACTGAACGCCCCCCGGGCTTCTTTATTAGCTGCTGACGTGCCAGATGCTGACGTGCAGTGCG GCTGACGGTGCTTACCTGGATCGGATGCTACCAGTCGATGCTGACGGTGCTTACCTGGATCGGATGCTACCAGTCGATCCGATCGATCGTAGCGTAGCGTATGCTAGCTAGTGATCGATGCTAGATCGATCGTAGCGTAGCGTATGCTAGCTAGTGATCGATGCTA GTAGCTAGCTAGCTGATCGATCATCGATCGTAGCTAGCTAGCTAGCTAGCTGATCGATCGATGCTAGCTAGCTAGCTAGTCATCGTAGCTAGCTAGCTGATCGATCATCGATCGTAGCTAGCTAGCTAGCTAGCTGATCGATCGATGCTAGCTAGCTAGCTAGTCATC TGTGGTGGGGGGTTAAATGCGATTGCCGCTAGCTAGAACAAAATAGCGGTATTTTGGAGGAGTCTGACTGACCATTGGACTAGTGTGGTGGGGGGTTAAATGCGATTGCCGCTAGCTAGAACAAAATAGCGGTATTTTGGAGGAGTCTGACTGACCATTGGACTAG GGGATTGACCAGTAGGCTGCGATTCGGATGCGGATTGACGATTAAAAAGGATTACGATTAGCTGTGACGTGCAGGATGCTGCGGGGATTGACCAGTAGGCTGCGATTCGGATGCGGATTGACGATTAAAAAGGATTACGATTAGCTGTGACGTGCAGGATGCTGCG ATGCTGGACTGAACGCCCCCCGGGCTTCTTTATTAATGCTGGACTGAACGCCCCCCGGGCTTCTTTATTAGGCTGCTGACGTGCCAGATGCTGACGTGCAGTGCGGCTGACGGTGCTTACTGCTGACGTGCCAGATGCTGACGTGCAGTGCGGCTGACGGTGCTTA CCTGGATCGGATGCTACCAGTCGATCGATCGATCGTAGCGTAGCGTATGCTAGCTAGTGATCGATGCTAGTAGCTAGCTAGCTCCTGGATCGGATGCTACCAGTCGATCGATCGATCGTAGCGTAGCGTATGCTAGCTAGTGATCGATGCTAGTAGCTAGCTAGCT GATCGATCATCGATCGTAGCTAGCTAGCTAGCTAGCTGATCGATCGATGCTAGCTAGCTAGCTAGTCATCTGTGGTGGGGGGTTGATCGATCATCGATCGTAGCTAGCTAGCTAGCTAGCTGATCGATCGATGCTAGCTAGCTAGCTAGTCATCTGTGGTGGGGGGTT AAATGCGATTGCCGCTAGCTAGAACAAAATAGCGGTATTTTGGGCTAGCTAGCTGAAAATGCGATTGCCGCTAGCTAGAACAAAATAGCGGTATTTTGGGCTAGCTAGCTGATCGTCGATCATCGATCGTAGCTAGCTAGCTAATCATCGATCGTAGCTAGCTAGCTA GCTAGCTGATCGATCGATGCTAGCTAGCTAGCTAGTCATCTGTGGTGGGGGGTTAAATGCGATTGCCGCTAGCTAGAACAAAATGCTAGCTGATCGATCGATGCTAGCTAGCTAGCTAGTCATCTGTGGTGGGGGGTTAAATGCGATTGCCGCTAGCTAGAACAAAAT AGCGGTATTTTGGGGTGCTTACCTGGATCGGATGCTACCAGTCGATCGATCGATCGTAGCGTAGCGTATGCTAGCTAGTGATCAGCGGTATTTTGGGGTGCTTACCTGGATCGGATGCTACCAGTCGATCGATCGATCGTAGCGTAGCGTATGCTAGCTAGTGATC GATGCTAGTAGCTAGCTAGCTGATCGATCATCGATCGTGATGCTAGTAGCTAGCTAGCTGATCGATCATCGATCGTAAGCTAGCTAGCTAGCTAGCTGATCGATCGATGCTAGCTAGCTAGCTGCTAGCTAGCTAGCTAGCTGATCGATCGATGCTAGCTAGCTAGCT AGTCATCTGTGGTGGGGGGTTAAATGCGATTGCCGCTAGCTAGAACAAAATAGCGGTATTTTGGAGGAGTCTGACTGACCATTGAGTCATCTGTGGTGGGGGGTTAAATGCGATTGCCGCTAGCTAGAACAAAATAGCGGTATTTTGGAGGAGTCTGACTGACCATTG GACTAGGGGATTGACCAGTAGGCTGCGATTCGGATGCGGATTGACGATTAAAAAGGATTACGATTAGCTGTGACGTGCAGGATGACTAGGGGATTGACCAGTAGGCTGCGATTCGGATGCGGATTGACGATTAAAAAGGATTACGATTAGCTGTGACGTGCAGGAT GCTGCGATGCTGGACTGAACGCCCCCCGGGCTTCTTTATTAGCTGCTGACGTGCCAGATGCTGCTGCGATGCTGGACTGAACGCCCCCCGGGCTTCTTTATTAGCTGCTGACGTGCCAGATGCTGGACGTGCAGTGCGGCTGACGACGTGCAGTGCGGCTGACG GTGCTTACCTGGATCGGATGCTACCAGTCGATCGATCGATCGTAGCGTAGCGTATGCTAGCTAGTGATCGATGCTAGTAGCTAGGTGCTTACCTGGATCGGATGCTACCAGTCGATCGATCGATCGTAGCGTAGCGTATGCTAGCTAGTGATCGATGCTAGTAGCTAG Human Genome Project Re-sequencing (dbSNP) HapMap Project ~ 12 million common DNA polymorphisms in human genome Hypothesis: Common Variant – Common Disease
  25. 25. Why is the study of DNA variation important ? - Mechanism: understand how disease occurs - Treatment: identify new drug targets - Diagnostics: to understand the contribution of DNA variations to inter-individual variability in: -Disease-risk (susceptibility): personalized medicine ? -Response-to-”treatment” (medication, diet, drug- target design): pharmacogenetics
  26. 26. Molecular Genetic Epidemiology (1) case-control design Test for “association” by counting variants of a (candidate) gene. Compare allele frequencies: A = wild-type allele; B = risk-allele CONTROL-group DISEASE-group AAAAA AA 70% BBB 30% BBBBB 50% AAAAA 50%
  27. 27. Humans are diploid: compare characteristics by their genotype Population (-based sample) Genotype mean Femoral Neck BMD AA 0.82±0.12 0.82±0.12 0.82±0.12 AB 0.80±0.13 0.82±0.13 0.79±0.13 BB 0.78±0.13 0.78±0.13 0.79±0.13 dose-effect recessive dominant Molecular Genetic Epidemiology (2) Quantitative Trait analyses
  28. 28. 9 = Participant + Epidemiological Cohort Boston Quebec GENOMOS 2006 a large-scale, multi-centre study for prospective meta-analyses of osteoporosis candidate gene variants ( www.GENOMOS.eu ) 7 = Participant *coordinating centre Total number of subjects (2007): 37,760 24,177 women 15,585 men 8,933 fractures 2,146 vertebral fx “Genetic Markers for Osteoporosis” EU FP5 sponsored: 3 mio euro Jan 2003 – Jan 2007
  29. 29. Figure 1 A C E GENOMOS results LRP5 and LRP6: BMD LS FN 20 mg/cm2 per allele; p = 3.3*10-8 14 mg/cm2 per allele; p = 2.6*10-9 (van Meurs et al., JAMA 2007)
  30. 30. GENOMOS RESULTS: November 2007GENOMOS RESULTS: November 2007 ----37,7601LRP6 6-14%12-26%0.15 SD0.15 SD37,7602LRP5 ----28,9245TGFb -10% (Cdx)--26,2425VDR -10% (Sp1)0.15 SD0.15 SD20,7861COLI 10-20%20-30%--18,9173ESR1 Non- Vert VertLSFN(17)(6) FXBMDSample nSNPs nGENE Ioannidis et al., JAMA 2004 Uitterlinden et al., Ann Int Med 2006 Langdahl et al. (Bone; in press) van Meurs et al. (JAMA; in press) Ralston et al., PLoS Med 2006 New Project GEFOS EU FP7: - GWA - Larger consortium, global - Different ethnicities - Additional phenotypes Effect-sizes are expressed per allele PUBLICATIONS :
  31. 31. Kandidaatgen: SIRT1Kandidaatgen: SIRT1 • Bij gisten en fruitvliegen leidt actiever SIRT1 tot minder snelle veroudering en langer leven • SIRT1 wordt actiever bij weinig voeding • Calorie beperking bij dieren levensverlengend • SIRT1 is hierbij mogelijk betrokken
  32. 32. Colman et al., Science 09 Normaal dieet Caloriebeperkt dieet
  33. 33. Resveratrol stimuleert SIRT1Resveratrol stimuleert SIRT1
  34. 34. Muizen op een calorierijk dieet worden dik Resveratrol ++ Resveratrol --
  35. 35. Is SIRT1 ook bij de mensIs SIRT1 ook bij de mens belangrijk?belangrijk? • Onderzoek naar variaties in het SIRT1 gen en gewicht en het risico op obesitas
  36. 36. Bevindingen: SIRT1Bevindingen: SIRT1 • Variaties in het SIRT1 gen geassocieerd met: - Lager gewicht en body mass index - 13-18% minder kans op obesitas - Minder aankomen in de loop der tijd
  37. 37. Bevindingen: SIRT1Bevindingen: SIRT1 • Het effect van variaties in het SIRT1 gen op BMI wordt beïnvloed door samenstelling van het dieet
  38. 38. Is SIRT1 ook bij de mensIs SIRT1 ook bij de mens belangrijk ?belangrijk ? • Onderzoek naar variaties in het SIRT1 gen en overleving
  39. 39. Bevindingen: SIRT1 gen variatiesBevindingen: SIRT1 gen variaties • Geen effect op overleving bij de gehele bevolking van de ERGO studie • Bij mensen met ouderdomsdiabetes 50% minder kans op overlijden - Dit wordt versterkt door weinig inname van vitamine B3 in de voeding en roken
  40. 40. Figure 2: mortality in prevalent diabetes First tertile of niacin intake 181614121086420 CumSurvival 1,0 ,8 ,6 ,4 ,2 0,0 sirt1 haplotype 1 homozygotes heterozygotes noncarriers Aantal jaren Overleving 2 variaties 1 variatie 0 variaties Overleving bij suikerziekte metOverleving bij suikerziekte met weinig vitamine B3weinig vitamine B3
  41. 41. • Nieuwste techniek om nieuwe genen te vinden voor complexe aandoeningen zoals obesitas en osteoporose • Hierbij worden meer dan 300.000 variaties in genen gemeten en een verband gezocht met ziekten of eigenschappen Genoomwijde associatie (GWA)Genoomwijde associatie (GWA)
  42. 42. Dissection of a Complex Disease/Trait : identify “risk” alleles of susceptibility genes “Top-down”/hypothesis free * Whole-Genome-Linkage analysis - Pedigrees - Sib-pairs - Human, mouse * Genome-Wide Association (GWA) analysis - 100K – 1000K SNP analysis in cases/controls “Bottom-up”/up-front hypothesis * Association analyses of candidate gene polymorphisms (based on biology) EffectivenessType of approach - +/- + >>All approaches converge to testing (candidate) gene polymorphisms!! Resolution 5-20 million bp 5-50 thousand bp 1 bp
  43. 43. Time required for genotyping 1 SNP in 7.000 DNA samples from “the Rotterdam Study”: 1996 6 months: RFLP, Epp tubes 1999 3 months: RFLP, 96-well plates 2001 1 week: SBE, 384-well plates 2003 1 day: Taqman (manual) 2004 6 hrs: Taqman, Caliper pipetting robot (automated) 2005 3 hrs: Taqman, Deerac, “Fast” PCR 2007 6 sec: Illumina 1000K array, 600 DNAs/week The influence of “technology-push”
  44. 44. AAAA→→ BB→BB→ AB→AB→ AB→AB→ SNPSNP11 SNPSNP22 SNPSNP33 SNPSNP550,000550,000 11 22 33 44 55 66 77 88 1414 1818 XX ChromosomesChromosomes 1010 1212 AA AB BBAA AB BB AAAA ABAB BBBB DATA ANALYSIS by PLINK:DATA ANALYSIS by PLINK: REPLICATION in other cohorts ! Illumina Affymetrix Genome-Wide Association (GWA) study:Genome-Wide Association (GWA) study: Hypothesis-freeHypothesis-free search across the genome for DNA variantssearch across the genome for DNA variants associatedassociated toto disease/trait, using high-density SNP arrays in DNA collections with phenotypedisease/trait, using high-density SNP arrays in DNA collections with phenotype Select SNPs (p-value, frequency, annotation, etc.) DNA collection
  45. 45. EffectSizeEffectSize Frequency Genetic VariantFrequency Genetic Variant rare, monogenicrare, monogenic ((linkagelinkage)) common, complexcommon, complex ((associationassociation))will require high throughputwill require high throughput sequencing and very largesequencing and very large sample sizessample sizes (very) few examples(very) few examples rarerare commoncommon smallsmallbigbig Genetic architecture of traitsGenetic architecture of traits Gene hunting success in complexGene hunting success in complex diseases is determined by design:diseases is determined by design:
  46. 46. Examples of DNA polymorphisms with consistent association with complex disease (pre-GWA) DISEASE GENE POLYMORPHISM FREQUENCY ALLELE ODDS RATIO Thrombophilia Factor V Arg506Gln (“Leiden”) 0.03 4 Crohn’ s Disease CARD15 3 SNPs 0.06 4 Alzheimer’ s Disease ApoE e4 0.15 3 Osteoporosis COLIA1 IVS1 G2046T (“Sp1”) 0.18 1.3 ESR1 2 SNPs 0.48 1.3 Type 2 diabetes KCNJ11 Glu23Lys 0.36 1.2 PPARG Pro12Ala 0.85 1.2 Graves’ disease CTLA4 Thr17Ala 0.36 1.6 Type 1 diabetes INS 5’ VNTR 0.67 1.2 Bladder cancer GSTM1 Δ (Deletion) 0.70 1.3
  47. 47. Counting fish in the sea of association analyses….. Multiplier Parameter >1.000.000 Gene variants >1.000 Diseases >10 Outcomes >10 Subgroups >10 Genetic contrasts >10 Investigators 100 trillion Candidate analyses J Ioannidis
  48. 48. Levels of evidence: - Collaborative prospective meta-analysis of individual level data (e.g., GENOMOS) - Meta-analysis of published data - >2 large studies (n > 1000 each) - 1-3 smaller studies - 1 small study (n<500) Good Not so good Grades of evidence in Complex GeneticsGrades of evidence in Complex Genetics Effects per SNP are small, so: - large sample sizes are needed - replication across multiple studies is required
  49. 49. Bevindingen: GWA obesitasBevindingen: GWA obesitas • In een groot internationaal consortium (CHARGE) 30.000 mensen onderzocht • Nieuw gen geassocieerd met de middelomvang en de BMI: Neurexine 3 • Eerder geassocieerd met verslaving en beloningsgedrag
  50. 50. Bevindingen: GWABevindingen: GWA osteoporoseosteoporose • In een groot internationaal consortium (GEFOS) 20.000 mensen onderzocht • 20 plaatsen op het DNA geassocieerd met de botmineraaldichtheid, waarvan 13 in nieuwe gebieden
  51. 51. ->ESR1 A. B. CRHR1FOXL1STARD3NLSPTBN1 CTNNB1 MEPE ->OPG ->LRP5 ->SP7 ->RANK-L<- ->RANK ->ZBTB40 ->ESR1 GPR177 FLJ42280 DCD5 ->OPG FLJ42280 SOX6 ARHGAP1GPR177 MEF2C ->ZBTB40 HDAC5 Rivadeneira et al. Nat Genet 2009; 41, 1199 - 1206 LS FN
  52. 52. A. B. ≤ ≥ ≤ ≥ Rivadeneira et al. Nat Genet 2009; 41, 1199 - 1206
  53. 53. ConclusiesConclusies • Meer inzicht in de erfelijke achtergrond van obesitas en osteoporose en de relatie tussen deze aandoeningen • Het SIRT1 gen is bij de mens van belang voor gewicht en voor overleving bij mensen met suikerziekte in interactie met dieet • Nieuwe genen ontdekt die te maken hebben met obesitas en osteoporose. De effecten van deze genen zijn klein.
  54. 54. ConsequentiesConsequenties • Onderzoek nodig naar effect van SIRT1 stimulatoren op metabole ziekten en veroudering • Vervolgonderzoek nodig naar onderliggende biologische mechanismen van de nieuw ontdekte genen

×