Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.

Using liquid biopsies to study cancer dynamics and drug resistance

175 views

Published on

A liquid biopsy is a test done on a sample of blood to look for cancer cells or for pieces of DNA from tumor cells that are circulating in the blood  In this talk I will introduce the notion of liquid biopsy and report how a minimally invasive blood test can be developed using next-generation sequencing technology on circulating tumor DNA obtained from plasma. I will also show the capacity of this test to interrogate for disease evolution and identify genomic aberrations that emerge with drug resistance

Published in: Health & Medicine
  • Be the first to comment

  • Be the first to like this

Using liquid biopsies to study cancer dynamics and drug resistance

  1. 1. Using liquid biopsies to study cancer dynamics and drug resistance Alessandro Romanel, PhD Laboratory of Bioinformatics and Computational Genomics Centre for Integrative Biology (CIBIO), University of Trento Speck&Tech, 27 February 2018
  2. 2. What is the human genome? Complete set of nucleic acid sequences for humans Encoded as DNA
  3. 3. What is DNA?
  4. 4. DNA representation
  5. 5. DNA in numbers 3.2 billion base pairs <2% protein coding DNA Remaining is non-coding RNA, regulatory sequences, introns, …
  6. 6. What is NGS?
  7. 7. What is NGS? Reference genome
  8. 8. What is a DNA variation?  Less than 1% of the human genome  Single Nucleotide Variations (SNVs)  Copy Number Variations (CNVs)  Germline variations  Polymorphism when fraction >1%  Mutation when <1%  Somatic variations Bob: ACGTGGCATACCAATACCTGGTGTAAGTTTA Alice: ACGTGGCATACCGATACCTGGTGTAAGTTTA Bob: Alice:
  9. 9. What is cancer?  Disease where abnormal cells divide without control  Most cancers start due to somatic variations  Gene functions are altered (e.g. oncogenes) Primary carcinoma lymphoma leukemia sarcoma Metastatis spread
  10. 10. Cancer is heterogeneus Patient 1 Patient 2 Patient 3 Primary Metastasis BMetastasis A Mutation 2 Mutation 1 Mutation 4 Mutation 3 Intra-patientInter-patient
  11. 11. Clonality of mutations Clonal mutation Mutation 2 Mutation 1 Mutation 4 Mutation 3 Primary or metastasis Subclonal mutation
  12. 12. Cancer evolution and drug resistance  Prostate cancer (PCa)  >1M cases worldwide, strongly heritable (57%) respond to castration (ADT) metastatic PCa Tumorvolumeandactivity CRPC
  13. 13. How to study cancer evolution and resistance? Collect and evaluate sequential samples over disease Collection of repeated tumor tissue biopsies is challenging and may not reflect real heterogeneity
  14. 14. Liquid biopsy
  15. 15. Liquid biopsy (cfDNA) Schweizer MT and Antonarakis ES, Sci Transl Med. 2015
  16. 16. Liquid biopsy Bioanalyzer of cell free DNA from a WCM patient (Jenny Xiang) 2 ml of blood → 1 ml of plasma → 5-300ng of DNA
  17. 17. NGS-based minimally invasive plasma DNA test Design a targeted panel Analyze the data Perform the sequencing
  18. 18. Targeted sequencing panel Select genomic regions of interest Genes involved in the disease Exonic/Coding regions Informative SNPs Other non-coding regions Include genes that are frequently aberrant in the disease
  19. 19. Targeted sequencing panel exons DNA Standard textual formats (BED files) to store this information ACGGGTCGGAAATGTGCGATGTCCGATGTCGATGTGGCCCCGATGTCCGATGTCGATGTCCGATGTCGATGTG Panel design
  20. 20. Targeted sequencing panel Illumina SureDesign
  21. 21. Generate/preprocess data FASTQ files Quality Control Alignment to human reference genome Removal of duplicates INDEL realignment Recalibration QC and data cleaning BAM files Library preparation
  22. 22. Generate/preprocess data Liquidbiopsy PlasmaDNA Controlsample baccalswabDNA
  23. 23. What is tumor DNA fraction? Romanel A*, Gasi Tandefelt D*, et al, Science Transl Med 2015 Normal DNA Tumor DNA
  24. 24. Learning from control samples 99.63% 99.63% 0.020.0150.01 Noise estimated from control samples Somatic SNVs detection Somatic CNVs detection The local total coverage is >= 100 The alternative base is supported by at least 5 reads The allelic fraction (AF) is > 0.02 (estimated from control samples) Exclusion of all genomic positions close to amplicon edges Exclusion of all positions not satisfying strand bias criteria The allelic fraction of the position for the control samples is <0.01
  25. 25. What is tumor DNA fraction? Romanel A*, Gasi Tandefelt D*, et al, Science Transl Med 2015 TOTAL DNA ~ 90 ng/ml TUMOR FRACTION 4-fold higher Normal DNA Tumor DNA
  26. 26. Patient Time point Observed allelic fraction of TP53 mutation Rossi 1 10% Rossi 2 10% Rossi 3 5% Verdi 1 50% Why is important?
  27. 27. Patient Time point Observed allelic fraction of TP53 mutation Tumor DNA fraction Percentage of tumor molecules harboring TP53 mutation Rossi 1 10% 1 10% Rossi 2 10% 0.2 50% Rossi 3 5% 0.5 100% Verdi 1 50% 0.7 71% Any time we need to compare multiple plasma samples, either longitudinal or cross-sectional Why is important?
  28. 28. Normal cell Tumor cell 1 Maternal Paternal Maternal Paternal Informative SNPs reference alternative base Allelic Fraction Proportion of reads supporting the reference base SNP1 SNP2 SNP3 Allelic fraction property
  29. 29. gene A gene B Baca S et al, Cell 2013 Prandi D et al, Genome Biology 2014 Tumor fraction estimation Clonal Subclonal
  30. 30. Is an informative biomarker Romanel A*, Gasi Tandefelt D*, et al, Science Transl Med 2015 Tumor fraction is a biomarker Advanced patients with high tumor DNA fraction live less and some treatments are less effective
  31. 31. Tumor clones Blood vein DNA release
  32. 32. No aberration Subclonal aberration Clonal aberration Dynamics of tumor over time
  33. 33. Appearing Progression on anti-androgens Start taxane Disappearing NKX3-1PTEN Pre-castration Carreira S*, Romanel A*, et al, Science Transl Med 2014 Independent tumor clones
  34. 34. Independent tumor clones Treatment Blood vein
  35. 35. Create a temporal map Carreira S*, Romanel A*, et al, Science Transl Med 2014 Identify mechanisms or biomarkers of drug resistance
  36. 36. Mutations with temporal relationship with progression Carreira S*, Romanel A*, et al, Science Transl Med 2014 Romanel A*, Gasi Tandefelt D*, et al, Science Transl Med 2015 Drug resistance biomarkers AR
  37. 37. Drug resistance biomarkers Patients with high AR copy number live less and show stronger resistance to some drugs
  38. 38. Precision medicine Personalized treatments
  39. 39. Where are we?
  40. 40. Early detection of cancers
  41. 41. Current limitations  Many tumors lack well-establish biomarkers  Heterogeneity adds a level of complexity in liquid biopsy test establishment  Biomarkers for different tumors at different stages  DNA in blood is truly representative of all tumors?  Can liquid biopsies improve cancer survival?  Large studies and clinical trial needed  Precision/recall of aberration identification  Advances in technology  Improvement of computational methods
  42. 42. Laboratory of Functional and Computational Oncology Francesca Demichelis POST-DOC positions Contact: f.demichelis@unitn.it OPEN POSITIONS at CIBIO

×