SlideShare a Scribd company logo
1 of 43
Download to read offline
Transgenic Plants
(Genetically modified organisms (plants)
Genetically engineered plants))
Why create transgenic plants?
When there is no naturally occurring genetic variation for
the target trait.
Examples:
1. Glyphosate herbicide resistance in soybean, corn
2.Vitamin A in rice
3.Blue roses
What genes to transfer?
1. One gene to a few genes - the CP4 ESPS example
2. Multiple genes - Golden Rice and Applause rose
3. In principle, any gene (or genes)
ORIGIN
1 cctttcctac tcactctgga caggaacagc tgtctgcagc cacgccgcgc ctgagtgagg
61 agaggcgtag gcaccagccg aggccaccca gcaaacatct atgctgactc tgaatgggcc
121 cagtcctccg gaacagctcc ggtagaagca gccaaagcct gtctgtccat ggcgggatgc
181 cgggagctgg agttgaccaa cggctccaat ggcggcttgg agttcaaccc tatgaaggag
241 tacatgatct tgagtgatgc gcagcagatc gctgtggcgg tgctgtgtac cctgatgggg
301 ctgctgagtg ccctggagaa cgtggctgtg ctctatctca tcctgtcctc gcagcggctc
CP4 EPSPS: The gene conferring resistance to the
herbicide Roundup
The gene was found in Agrobacterium tumefaciens and
transferred to various plants
Coincidentally, this organism is also used for creating
transgenic plants
TGGAAAAGGAAGGTGGCTCCTACAAATGCCATCATTGCGATAAAGGAAAGGCCATCGTTGAAGATGCCTCTGCCGACAGTGGTCCCAAAG
ATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGATATCTCCACTGA
CGTAAGGGATGACGCACAATCCCACTATCCTTCGCAAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGACACGCTGACAAG
CTGACTCTAGCAGATCTTTCAAGAATGGCACAAATTAACAACATGGCACAAGGGATACAAACCCTTAATCCCAATTCCAATTTCCATAAACC
CCAAGTTCCTAAATCTTCAAGTTTTCTTGTTTTTGGATCTAAAAAACTGAAAAATTCAGCAAATTCTATGTTGGTTTTGAAAAAAGATTCAATT
TTTATGCAAAAGTTTTGTTCCTTTAGGATTTCAGCATCAGTGGCTACAGCCTGCATGCTTCACGGTGCAAGCAGCCGGCCCGCAACCGCCCG
CAAATCCTCTGGCCTTTCCGGAACCGTCCGCATTCCCGGCGACAAGTCGATCTCCCACCGGTCCTTCATGTTCGGCGGTCTCGCGAGCGGTG
AAACGCGCATCACCGGCCTTCTGGAAGGCGAGGACGTCATCAATACGGGCAAGGCCATGCAGGCCATGGGCGCCAGGATCCGTAAGGAA
GGCGACACCTGGATCATCGATGGCGTCGGCAATGGCGGCCTCCTGGCGCCTGAGGCGCCGCTCGATTTCGGCAATGCCGCCACGGGCTGC
CGCCTGACCATGGGCCTCGTCGGGGTCTACGATTTCGACAGCACCTTCATCGGCGACGCCTCGCTCACAAAGCGCCCGATGGGCCGCGTGT
TGAACCCGCTGCGCGAAATGGGCGTGCAGGTGAAATCGGAAGACGGTGACCGTCTTCCCGTTACCTTGCGCGGGCCGAAGACGCCGACGC
CGATCACCTACCGCGTGCCGATGGCCTCCGCACAGGTGAAGTCCGCCGTGCTGCTCGCCGGCCTCAACACGCCCGGCATCACGACGGTCAT
CGAGCCGATCATGACGTGCGATCATACGGAAAAGATGCTGCAGGGCTTTGGCGCCAACCTTACCGTCGAGACGGATGCGGACGGCGTGC
GCACCATCCGCCTGGAAGGCCGCGGCAAGCTCACCGGCCAAGTCATCGACGTGCCGGGCGACCCGTCCTCGACGGCCTTCCCGCTGGTTG
CGGCCCTGCTTGTTCCGGGCTCCGACGTCACCATCCTCAACGTGCTGATGAACCCCACCCGCACCGGCCTCATCCTGACGCTGCAGGAAATG
GGCGCCGACATCGAAGTCATCAACCTGCGCCTTGCCGGCGGCGAAGACGTGGCGGACCTGCGCGTTCGCTCCTCCACGCTGAAGGGCGTC
ACGGTGCCGGAAGACCGCGCGCCTCCGATGATCGACGAATATCCGATTCTCGCTGTCGCCGCCGCCTTCGCGGAAGGGGCGACCGTGATG
AACGGTCTGGAAGAACTCCGCGTCAAGGAAAGCGACCGCCTCTCGGCCGTCGCCAATGGCCTCAAGCTCAATGGCGTGGATTGCGATGAG
GGCGAGACGTCGCTCGTCGTGCGTGGCCGCCCTGACGGCAAGGGGCTCGGCAACGCCTCGGGCGCCGCCGTCGCCACCCATCTCGATCAC
CGCATCGCCATGAGCTTCCTCGTCATGGGCCTCGTGTCGGAAAACCCTGTCACGGTGGACGATGCCACGATGATCGCCACGAGCTTCCCGG
AGTTCATGGACCTGATGGCCGGGCTGGGCGCGAAGATCGAACTCTCCGATACGAAGGCTGCCTGATGAGCTCGAATTCGAGCTCGGTACC
GGATCCAATTCCCGATCGTTCAAACATTTGGCAATAAAGTTTCTTAAGATTGAATCCTGTTGCCGGTCTTGCGATGATTATCATATAATTTCT
GTTGAATTACGTTAAGCATGTAATAATTAACATGTAATGCATGACGTTATTTATGAGATGGGTTTTTATGATTAGAGTCCCGCAATTATACAT
TTAATACGCGATAGAAAACAAAATATAGCGCGCAAACTAGGATAAATTATCGCGCGCGGTGTCATCTATGTTACTAGATCGGGGATCGATC
CCCCACCGGTCCTTCATGTTCGGCGGTCTCGCGAGCGGTGAAACGCGCATCACCGGCCTTCTGGAAGGCGAGGACGTCATCAATACGGGC
AAGGCCATGCAGGCCATGGGCGCCAGGATCCGTAAGGAAGGCGACACCTGGATCATCGATGGCGTCGGCAATGGCGGCCTCCTGGCGCC
TGAGGCGCCGCTCGATTTCGGCAATGCCGCCACGGGCTGCCGCCTGACCATGGGCCTCGTCGGGGTCTACGATTTCAAGCGCATCATGCTG
GGAA
Glyphosate inhibits EPSPS enzyme - impeding the
synthesis of aromatic amino acids
EPSPS
Glyphosate Herbicide
EPSPS
Proteins
CO2
H2O
NH3
aromatic
amino acids
Proteins
CO2
H2O
NH3
aromatic
amino acids
glyphosate
Commercial RR crops
"Two key elements needed for the development
of commercially viable glyphosate-tolerant
crops are:
– a resistant target enzyme
– sufficient expression of that enzyme within the
transgenic plant”
Heck et al. 2005. Development and Characterization of a CP4 EPSPS-Based,
Glyphosate-Tolerant Corn Event: Crop Sci. 45:329-339 (2005).
EPSPS
Roundup Ready Crops
• When incorporated into the genome of RR-
susceptible plants, the Roundup ReadyTM gene
(CP4 EPSPS) confers resistance to glyphosate
Proteins
CO2
H2O
NH3
aromatic
amino acids
glyphosate
CP4 EPSPS
"Golden Rice”
Creation of a
biosynthetic pathway in
rice using genes from
daffodil and bacteria;
portions of genes from
pea, rice, and
cauliflower mosaic
virus
Golden Rice
Vitamin A deficiency in humans a serious problem
Rice is a major food crop
Rice lacks provitamin A
Create pathway for Beta-carotene synthesis
• Phytoene synthase from Narcissus pseudonarcissus
• Phytoene desaturase from Erwinia uredovora
• Endosperm-specific glutelin promoter from Oryza sativa
• CaMV promoter from cauliflower mosaic virus
• Transit peptide sequence from Pisum sativum
www.forbes.com
Constructing transgenes
The minimal requirements for the transgene are a promoter,
coding region, and terminator
General structure:
5’---Promoter …..Coding region…….terminator---3’
Example: Bt gene with 35S promoter, nptII selectable marker, and
Tnos terminator sequence
5’ --P35S…Bt…Tnos--//--P35S…nptII…Tnos---3’
Promoter: DNA sequence controlling spatial and/or temporal
level of transgene expression. Promoters can be
1. constitutive
• CaMV 35S: from Cauliflower mosaic virus 35S rRNA
gene
2. tissue specific
• Glutelin GT1: Endosperm specific
3. inducible
• Cis-Jasmone: Arabidopsis genes induced by
stress/wounding
Termination sequence: DNA sequence signaling end of the
gene during transcription.
TNOS: Nopaline synthase gene from Agrobacterium
tumefaciens
T-DNA pGKB5 (7599 b.p.)
Bluescript polylinker : 1-104
Right Border : 105-622
24 bp sequence : 574-596
GUS coding : 638-2446
NOS terminator : 2505-2766
OCS terminator : 2767-3489
KanR (nptII) : 3490-4479
NOS promoter : 4480-4766
35S promoter : 4767-5924
BastaR (bar) : 5925-6513
g7 terminator : 6514-6768
Left Border : 6790-7525
24 bp sequence : 6963-6986
Bluescript polylinker : 7526-7599
GGAAACAGCTATGACCATGATTACGCCAAGCTCGGAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGC
TCCACCGCGGTGGCGGCCGCTCTAGAGGATCCCCCCACAGACAGCTCCGTAGCCCTCGTTCTCCTTGGAG
TTCTTCGGGAAATGGATCTTTCGATTCCCGATGATGTCTCTCTTATCTGCTTTGACGACGCCGACTGGAC
Selectable Marker: Encodes a protein (enzyme) that allows
the transformed cells to grow while the growth of the non-
transformed cells is inhibited. Examples include
1. Antibiotic resistance
2. Herbicide resistance
“Among the most widely used antibiotic resistance genes as selectable
markers are neomycin phosphotransferase II (nptII) and hygromycin
phosphotransferase (hpt). The enzyme NPTII inactivates by
phosphorylation a number of aminoglycoside antibiotics such as
kanamycin, neomycin, geneticin (or G418) and paromomycin. Of these,
G418 is routinely used for selection of transformed mammalian cells. The
other three are used in a diverse range of plant species, however,
kanamycin has proved to be ineffective to select legumes and gramineae.
Hygromycin phosphotransferase is a suitable marker system for both plant
and animal systems. The HPT enzyme inactivates the antibiotic hygromycin
B. Hygromycin is usually more toxic than kanamycin and kills sensitive cells
more quickly. It is nowadays one of the preferred antibiotic resistance
marker systems for transformation of monocotyledonous plants, particularly
gramineae (cereals and forages).”
http://www.patentlens.net/daisy/Antibiotic/g1/1155.html
Selectable Marker: Encodes a protein (enzyme) that allows
the transformed cells to grow while the growth of the non-
transformed cells is inhibited. Examples include
2. Herbicide resistance
http://www.patentlens.net/daisy/Phosph/g2/710.html
“..Members of the genus Streptomyces produce bialaphos,
which leads to the production of glufosiante, ultimately inhibiting
glutamine synthetase. The biochemical and toxicological
characteristics of glufosinate have made it a popular,
nonselective herbicide, which has been commercialized under
the names Basta®, Buster® and Liberty® by Bayer Crop
Science. Other Streptomyces spp. can detoxify glufosinate by
producing an acetylating enzyme via production of a
phosphinothricin acetyl transferase (PAT) enzyme encoded by
the bar (bialaphos resistance) gene. Treatment of genetically
modified plants carrying a bar gene with glufosinate or
bialaphos provides a very efficient means of selection in
genetic transformation protocols.”
Selectable Markers. Details and examples of selectable markers
Reporter genes: Genes that, upon expression in the
transgenic plants, provide a clear indication that genetic
transformation did occur, and indicate the location and the
level of expression.
A. Glucuronidase (GUS)
B. Luciferase, green fluorescent protein (GFP)
GFP: So many ways to be green
Transformation procedures:
In order for a transgene to be inherited, it must be
incorporated into the genome of a cell which will give rise to
tissues which will be asexually propagated or to tissues
which will undergo gametogenesis
The two principal mechanisms for transforming tissues with
a transgene
•Biolistics = “Gene gun”
•Agrobacterium tumefaciens = “Agro”
The gene gun
• Micro projectile bombardment or the biolistic method
• Small metal particles are coated with the transgene DNA
• Particles are delivered to target tissues via an explosive
force
“The Helios Gene Gun is a new way for in
vivo transformation of cells or organisms apy and genetic
immunization (DNA vaccination)). This gun uses Biolistic
® particle bombardment where DNA- or RNA-coated gold
particles are loaded into the gun and you pull the trigger.
A low pressure helium pulse delivers the coated gold
particles into virtually any target cell or tissue. The
particles carry the DNA so that you do not have to remove
cells from tissue in order to transform the cells.”
The Agrobacterium method
Agrobacterium tumefaciens is a soil bacterium causing a root
disease called crown gall
In the case of disease, A. tumefaciens invades the host plant
and transfers a piece of its own DNA to the host genome
For transformation, A. tumefaciens has been engineered to
carry and transfer transgenes and to not cause disease
Selection and regeneration: a plant with one copy of the
transgene is a hemizygote (heterozygous for transgene)
Concerns regarding transgenic plants
• Cultural/ religious issues - e.g. animal genes in plants
• Dietary concerns - e.g. allergies to novel proteins
• Gene escape - e.g. RoundUp Ready beets
• Non-target organisms - e.g. transgene plant products/ parts with
unanticipated consequences
• Wasting precious genes one at a time - e.g. widespread use of
single Bt genes could provide intense selection pressure for
resistant insects, rendering the use of Bt spray ineffective
• Ownership - e.g. transgene technologies, and genes, are
generally subject to intellectual property protection
Bringing it all home….to Oregon
Herbicide resistant bentgrass in Oregon (For the Willamette
Valley sugarbeet story, see Lecture 1)
The plant: Creeping bent grass (Agrostis stolonifera L.)
• Golf greens
• Considered a weed in eight countries
• Other Agrostis species (250 worldwide; 34 North
American; 24 native)
• Diploid to polyploid
• Sexual propagation
• Outcrossing
• A. stolonifera is obligate outcrossing
• Small seeds
• Asexual propagation
• stolons
• rhizomes
The gene: CP4 EPSPS
TGGAAAAGGAAGGTGGCTCCTACAAATGCCATCATTGCGATAAAGGAAAGGCCATCGTTGAAGATGCCTCTGCCGACAGTGGTCCCAAAG
ATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGATATCTCCACTGA
CGTAAGGGATGACGCACAATCCCACTATCCTTCGCAAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGACACGCTGACAAG
CTGACTCTAGCAGATCTTTCAAGAATGGCACAAATTAACAACATGGCACAAGGGATACAAACCCTTAATCCCAATTCCAATTTCCATAAACC
CCAAGTTCCTAAATCTTCAAGTTTTCTTGTTTTTGGATCTAAAAAACTGAAAAATTCAGCAAATTCTATGTTGGTTTTGAAAAAAGATTCAATT
TTTATGCAAAAGTTTTGTTCCTTTAGGATTTCAGCATCAGTGGCTACAGCCTGCATGCTTCACGGTGCAAGCAGCCGGCCCGCAACCGCCCG
CAAATCCTCTGGCCTTTCCGGAACCGTCCGCATTCCCGGCGACAAGTCGATCTCCCACCGGTCCTTCATGTTCGGCGGTCTCGCGAGCGGTG
AAACGCGCATCACCGGCCTTCTGGAAGGCGAGGACGTCATCAATACGGGCAAGGCCATGCAGGCCATGGGCGCCAGGATCCGTAAGGAA
GGCGACACCTGGATCATCGATGGCGTCGGCAATGGCGGCCTCCTGGCGCCTGAGGCGCCGCTCGATTTCGGCAATGCCGCCACGGGCTGC
CGCCTGACCATGGGCCTCGTCGGGGTCTACGATTTCGACAGCACCTTCATCGGCGACGCCTCGCTCACAAAGCGCCCGATGGGCCGCGTGT
TGAACCCGCTGCGCGAAATGGGCGTGCAGGTGAAATCGGAAGACGGTGACCGTCTTCCCGTTACCTTGCGCGGGCCGAAGACGCCGACGC
CGATCACCTACCGCGTGCCGATGGCCTCCGCACAGGTGAAGTCCGCCGTGCTGCTCGCCGGCCTCAACACGCCCGGCATCACGACGGTCAT
CGAGCCGATCATGACGTGCGATCATACGGAAAAGATGCTGCAGGGCTTTGGCGCCAACCTTACCGTCGAGACGGATGCGGACGGCGTGC
GCACCATCCGCCTGGAAGGCCGCGGCAAGCTCACCGGCCAAGTCATCGACGTGCCGGGCGACCCGTCCTCGACGGCCTTCCCGCTGGTTG
CGGCCCTGCTTGTTCCGGGCTCCGACGTCACCATCCTCAACGTGCTGATGAACCCCACCCGCACCGGCCTCATCCTGACGCTGCAGGAAATG
GGCGCCGACATCGAAGTCATCAACCTGCGCCTTGCCGGCGGCGAAGACGTGGCGGACCTGCGCGTTCGCTCCTCCACGCTGAAGGGCGTC
ACGGTGCCGGAAGACCGCGCGCCTCCGATGATCGACGAATATCCGATTCTCGCTGTCGCCGCCGCCTTCGCGGAAGGGGCGACCGTGATG
AACGGTCTGGAAGAACTCCGCGTCAAGGAAAGCGACCGCCTCTCGGCCGTCGCCAATGGCCTCAAGCTCAATGGCGTGGATTGCGATGAG
GGCGAGACGTCGCTCGTCGTGCGTGGCCGCCCTGACGGCAAGGGGCTCGGCAACGCCTCGGGCGCCGCCGTCGCCACCCATCTCGATCAC
CGCATCGCCATGAGCTTCCTCGTCATGGGCCTCGTGTCGGAAAACCCTGTCACGGTGGACGATGCCACGATGATCGCCACGAGCTTCCCGG
AGTTCATGGACCTGATGGCCGGGCTGGGCGCGAAGATCGAACTCTCCGATACGAAGGCTGCCTGATGAGCTCGAATTCGAGCTCGGTACC
GGATCCAATTCCCGATCGTTCAAACATTTGGCAATAAAGTTTCTTAAGATTGAATCCTGTTGCCGGTCTTGCGATGATTATCATATAATTTCT
GTTGAATTACGTTAAGCATGTAATAATTAACATGTAATGCATGACGTTATTTATGAGATGGGTTTTTATGATTAGAGTCCCGCAATTATACAT
TTAATACGCGATAGAAAACAAAATATAGCGCGCAAACTAGGATAAATTATCGCGCGCGGTGTCATCTATGTTACTAGATCGGGGATCGATC
CCCCACCGGTCCTTCATGTTCGGCGGTCTCGCGAGCGGTGAAACGCGCATCACCGGCCTTCTGGAAGGCGAGGACGTCATCAATACGGGC
AAGGCCATGCAGGCCATGGGCGCCAGGATCCGTAAGGAAGGCGACACCTGGATCATCGATGGCGTCGGCAATGGCGGCCTCCTGGCGCC
TGAGGCGCCGCTCGATTTCGGCAATGCCGCCACGGGCTGCCGCCTGACCATGGGCCTCGTCGGGGTCTACGATTTCAAGCGCATCATGCTG
GGAA
The case:
2003
• Under APHIS permit, 162 ha test in Jefferson county of glyphosate-
tolerant GM creeping bentgrass (event ASR368 by Scotts and
Monsanto). The test was conducted within a 4453-ha control area
established by the Oregon Dept. of Agriculture.
2004:
• 2.5 ha of production.
• Documented gene flow primarily within ~ 2 km but up to 21 km
(Watrud et al. 2004. PNAS 14533-14538)
• Gene flow documented via seedling tests using
• protein detection (TraitCheck)
• PCR (using transgenic soybean CP4 EPSPS; GenBank
Accession No. AF464188.1,
• sequencing of cloned PCR products.
The case:
2005:
• No production
• Continued sampling
2006:
• Detected plants expressing transgene - demonstrated pollen transfer
and seed dispersal (Reichman et al. 2006. Mol. Ecology 15: 4243-
4255)
• Gene flow documented via using TraitChek, PCR, and sequencing
2007:
• Issue settled with civil penalty
2011: Transgenic plants in central and southeastern Oregon
2012: Transgenic plants in Oregon and Idaho
2013, 2014, 2015, 2016, 2017……monitoring and reporting
What is and what is not a transgenic plant?
“Our work suggests that cisgenic insertion of additional copies of native
genes involved in growth regulation may provide tools to help modify plant
architecture, expand the genetic variance in plant architecture available to
breeders and accelerate transfer of alleles between difficult-to-cross
species.”
http://www.nature.com/nrg/multimedia/rnai/animation/index.html
Transcription Activator Like Effector
Nucleases - TALENs
• Use TALEs to bind to a
particular DNA region
• Double Strand Break
• Non-Homologous End
Joining repair – error
can alter function
• Introduce new
sequence
– Exogenous DNS
– Homology Directed
Repair
Clustered Regularly Interspaced Short
Palindromic Repeats (CRISPR)
•RNA guided nucleases
with custom
specificities for
genome editing
•Modify endogenous
genes rapidly and
efficiently
•Regulation?
https://www.youtube.com/watch?v=2pp17E4E-O8
Genome Editing Example
Comparing “- enics” and “edits”
DNA Transcription Translation and beyond
ATGCTC
ATGCTC
ATCTC
+ transgene
+ RNAi construct
+ CRISPR construct
Degrade wild type mRNA
No protein, no phenotype
Change wild type DNA code
1
2
3
4
Add a gene
ATGCTC
Wild type gene

More Related Content

Similar to transgenics_17b.pptx

Cisgenics for crop improvement
Cisgenics  for crop improvementCisgenics  for crop improvement
Cisgenics for crop improvementVivek Singh
 
Chloroplast Transformation by Dr Swaati Sharma.pptx
Chloroplast Transformation by Dr Swaati Sharma.pptxChloroplast Transformation by Dr Swaati Sharma.pptx
Chloroplast Transformation by Dr Swaati Sharma.pptxSwaatiSharma2
 
Chloroplast Transformation by Dr Swaati Sharma.pptx
Chloroplast Transformation by Dr Swaati Sharma.pptxChloroplast Transformation by Dr Swaati Sharma.pptx
Chloroplast Transformation by Dr Swaati Sharma.pptxSwaatiSharma2
 
Rahul ppt Gene Stacking.pptx
Rahul ppt Gene Stacking.pptxRahul ppt Gene Stacking.pptx
Rahul ppt Gene Stacking.pptxRahul Maurya
 
4. Applications of Biotechnology in Agriculture-II.pptx
4. Applications of Biotechnology in Agriculture-II.pptx4. Applications of Biotechnology in Agriculture-II.pptx
4. Applications of Biotechnology in Agriculture-II.pptxEhtishamShah7
 
Prospectus and issues of transgenics in agriculture
Prospectus and issues of transgenics in agricultureProspectus and issues of transgenics in agriculture
Prospectus and issues of transgenics in agricultureSachin Ekatpure
 
Use of transgenics in crop production
Use of transgenics in crop productionUse of transgenics in crop production
Use of transgenics in crop productionPragyaNaithani
 
Pnr lecture 36
Pnr lecture 36Pnr lecture 36
Pnr lecture 36vinay5756
 
reporter gene assays by Tahura Mariyam
reporter gene assays by Tahura Mariyam reporter gene assays by Tahura Mariyam
reporter gene assays by Tahura Mariyam Tahura Mariyam Ansari
 
Gene stacking and its materiality in crop improvement
Gene stacking and its materiality in crop improvementGene stacking and its materiality in crop improvement
Gene stacking and its materiality in crop improvementShamlyGupta
 
Screenable and Selectable Markers
Screenable and Selectable MarkersScreenable and Selectable Markers
Screenable and Selectable MarkersShabnam Ameenudeen
 
Genetically Modified Crops SMG
Genetically Modified Crops SMGGenetically Modified Crops SMG
Genetically Modified Crops SMGsajigeorge64
 

Similar to transgenics_17b.pptx (20)

Cisgenics for crop improvement
Cisgenics  for crop improvementCisgenics  for crop improvement
Cisgenics for crop improvement
 
Chloroplast Transformation by Dr Swaati Sharma.pptx
Chloroplast Transformation by Dr Swaati Sharma.pptxChloroplast Transformation by Dr Swaati Sharma.pptx
Chloroplast Transformation by Dr Swaati Sharma.pptx
 
Chloroplast Transformation by Dr Swaati Sharma.pptx
Chloroplast Transformation by Dr Swaati Sharma.pptxChloroplast Transformation by Dr Swaati Sharma.pptx
Chloroplast Transformation by Dr Swaati Sharma.pptx
 
Rahul ppt Gene Stacking.pptx
Rahul ppt Gene Stacking.pptxRahul ppt Gene Stacking.pptx
Rahul ppt Gene Stacking.pptx
 
Transplastomics
TransplastomicsTransplastomics
Transplastomics
 
Transgenic food
Transgenic foodTransgenic food
Transgenic food
 
transgenic plants
transgenic plantstransgenic plants
transgenic plants
 
4. Applications of Biotechnology in Agriculture-II.pptx
4. Applications of Biotechnology in Agriculture-II.pptx4. Applications of Biotechnology in Agriculture-II.pptx
4. Applications of Biotechnology in Agriculture-II.pptx
 
Prospectus and issues of transgenics in agriculture
Prospectus and issues of transgenics in agricultureProspectus and issues of transgenics in agriculture
Prospectus and issues of transgenics in agriculture
 
Use of transgenics in crop production
Use of transgenics in crop productionUse of transgenics in crop production
Use of transgenics in crop production
 
Chloroplast transformation
Chloroplast transformationChloroplast transformation
Chloroplast transformation
 
Pnr lecture 36
Pnr lecture 36Pnr lecture 36
Pnr lecture 36
 
Final report mst 5
Final report mst 5Final report mst 5
Final report mst 5
 
Final report mst 5
Final report mst 5Final report mst 5
Final report mst 5
 
GM crops
GM cropsGM crops
GM crops
 
reporter gene assays by Tahura Mariyam
reporter gene assays by Tahura Mariyam reporter gene assays by Tahura Mariyam
reporter gene assays by Tahura Mariyam
 
Gene stacking and its materiality in crop improvement
Gene stacking and its materiality in crop improvementGene stacking and its materiality in crop improvement
Gene stacking and its materiality in crop improvement
 
Screenable and Selectable Markers
Screenable and Selectable MarkersScreenable and Selectable Markers
Screenable and Selectable Markers
 
marker free metheds.pptx
marker free metheds.pptxmarker free metheds.pptx
marker free metheds.pptx
 
Genetically Modified Crops SMG
Genetically Modified Crops SMGGenetically Modified Crops SMG
Genetically Modified Crops SMG
 

Recently uploaded

chapter 28 Reproductive System Power Point
chapter 28 Reproductive System Power Pointchapter 28 Reproductive System Power Point
chapter 28 Reproductive System Power Pointchelseakland
 
Potato spindle tuber disease VIRIOID DISEASE
Potato spindle tuber disease  VIRIOID DISEASEPotato spindle tuber disease  VIRIOID DISEASE
Potato spindle tuber disease VIRIOID DISEASEKARTHIK REDDY C A
 
ISOLATION OF ALGAE (INDOOR) AND PHOTOBIOREACTOR K R.ppt
ISOLATION OF ALGAE (INDOOR) AND PHOTOBIOREACTOR K R.pptISOLATION OF ALGAE (INDOOR) AND PHOTOBIOREACTOR K R.ppt
ISOLATION OF ALGAE (INDOOR) AND PHOTOBIOREACTOR K R.pptKARTHIK REDDY C A
 
SANDAL SPIKE MYCOPLASMAL DISEASE K R ppt
SANDAL SPIKE MYCOPLASMAL DISEASE K R pptSANDAL SPIKE MYCOPLASMAL DISEASE K R ppt
SANDAL SPIKE MYCOPLASMAL DISEASE K R pptKARTHIK REDDY C A
 
Combining Asynchronous Task Parallelism and Intel SGX for Secure Deep Learning
Combining Asynchronous Task Parallelism and Intel SGX for Secure Deep LearningCombining Asynchronous Task Parallelism and Intel SGX for Secure Deep Learning
Combining Asynchronous Task Parallelism and Intel SGX for Secure Deep Learningvschiavoni
 
EGYPTIAN IMPRINT IN SPAIN Lecture by Dr Abeer Zahana
EGYPTIAN IMPRINT IN SPAIN Lecture by Dr Abeer ZahanaEGYPTIAN IMPRINT IN SPAIN Lecture by Dr Abeer Zahana
EGYPTIAN IMPRINT IN SPAIN Lecture by Dr Abeer ZahanaDr.Mahmoud Abbas
 
FBI Profiling - Forensic Psychology.pptx
FBI Profiling - Forensic Psychology.pptxFBI Profiling - Forensic Psychology.pptx
FBI Profiling - Forensic Psychology.pptxPayal Shrivastava
 
STELLAR SYSTEM IN PTERIDOPHYTE Seminar 2023- By Karishma
STELLAR SYSTEM IN PTERIDOPHYTE Seminar 2023- By KarishmaSTELLAR SYSTEM IN PTERIDOPHYTE Seminar 2023- By Karishma
STELLAR SYSTEM IN PTERIDOPHYTE Seminar 2023- By KarishmaAMiracle3
 
Role of Gibberellins, mode of action and external applications.pptx
Role of Gibberellins, mode of action and external applications.pptxRole of Gibberellins, mode of action and external applications.pptx
Role of Gibberellins, mode of action and external applications.pptxjana861314
 
ESSENTIAL FEATURES REQUIRED FOR ESTABLISHING FOUR TYPES OF BIOSAFETY LABORATO...
ESSENTIAL FEATURES REQUIRED FOR ESTABLISHING FOUR TYPES OF BIOSAFETY LABORATO...ESSENTIAL FEATURES REQUIRED FOR ESTABLISHING FOUR TYPES OF BIOSAFETY LABORATO...
ESSENTIAL FEATURES REQUIRED FOR ESTABLISHING FOUR TYPES OF BIOSAFETY LABORATO...Chayanika Das
 
Density and Buoyancy for Grade 8 Science Class
Density and Buoyancy for Grade 8 Science ClassDensity and Buoyancy for Grade 8 Science Class
Density and Buoyancy for Grade 8 Science Class276318345hao
 
Efficient Fourier Pricing of Multi-Asset Options: Quasi-Monte Carlo & Domain ...
Efficient Fourier Pricing of Multi-Asset Options: Quasi-Monte Carlo & Domain ...Efficient Fourier Pricing of Multi-Asset Options: Quasi-Monte Carlo & Domain ...
Efficient Fourier Pricing of Multi-Asset Options: Quasi-Monte Carlo & Domain ...Chiheb Ben Hammouda
 
Introduction of Organ-On-A-Chip - Creative Biolabs
Introduction of Organ-On-A-Chip - Creative BiolabsIntroduction of Organ-On-A-Chip - Creative Biolabs
Introduction of Organ-On-A-Chip - Creative BiolabsCreative-Biolabs
 
Environmental Acoustics- Speech interference level, acoustics calibrator.pptx
Environmental Acoustics- Speech interference level, acoustics calibrator.pptxEnvironmental Acoustics- Speech interference level, acoustics calibrator.pptx
Environmental Acoustics- Speech interference level, acoustics calibrator.pptxpriyankatabhane
 
Physical pharmacy unit 1 solubility of drugs.pptx
Physical pharmacy unit 1 solubility of drugs.pptxPhysical pharmacy unit 1 solubility of drugs.pptx
Physical pharmacy unit 1 solubility of drugs.pptxchetanvgh
 
DNA isolation molecular biology practical.pptx
DNA isolation molecular biology practical.pptxDNA isolation molecular biology practical.pptx
DNA isolation molecular biology practical.pptxGiDMOh
 
Speed Breeding in Vegetable Crops- innovative approach for present era of cro...
Speed Breeding in Vegetable Crops- innovative approach for present era of cro...Speed Breeding in Vegetable Crops- innovative approach for present era of cro...
Speed Breeding in Vegetable Crops- innovative approach for present era of cro...jana861314
 

Recently uploaded (20)

chapter 28 Reproductive System Power Point
chapter 28 Reproductive System Power Pointchapter 28 Reproductive System Power Point
chapter 28 Reproductive System Power Point
 
Potato spindle tuber disease VIRIOID DISEASE
Potato spindle tuber disease  VIRIOID DISEASEPotato spindle tuber disease  VIRIOID DISEASE
Potato spindle tuber disease VIRIOID DISEASE
 
ISOLATION OF ALGAE (INDOOR) AND PHOTOBIOREACTOR K R.ppt
ISOLATION OF ALGAE (INDOOR) AND PHOTOBIOREACTOR K R.pptISOLATION OF ALGAE (INDOOR) AND PHOTOBIOREACTOR K R.ppt
ISOLATION OF ALGAE (INDOOR) AND PHOTOBIOREACTOR K R.ppt
 
SANDAL SPIKE MYCOPLASMAL DISEASE K R ppt
SANDAL SPIKE MYCOPLASMAL DISEASE K R pptSANDAL SPIKE MYCOPLASMAL DISEASE K R ppt
SANDAL SPIKE MYCOPLASMAL DISEASE K R ppt
 
Combining Asynchronous Task Parallelism and Intel SGX for Secure Deep Learning
Combining Asynchronous Task Parallelism and Intel SGX for Secure Deep LearningCombining Asynchronous Task Parallelism and Intel SGX for Secure Deep Learning
Combining Asynchronous Task Parallelism and Intel SGX for Secure Deep Learning
 
Bioenergetics and the role of ATP to drive the beats of life.
Bioenergetics and the role of ATP to drive the beats of life.Bioenergetics and the role of ATP to drive the beats of life.
Bioenergetics and the role of ATP to drive the beats of life.
 
EGYPTIAN IMPRINT IN SPAIN Lecture by Dr Abeer Zahana
EGYPTIAN IMPRINT IN SPAIN Lecture by Dr Abeer ZahanaEGYPTIAN IMPRINT IN SPAIN Lecture by Dr Abeer Zahana
EGYPTIAN IMPRINT IN SPAIN Lecture by Dr Abeer Zahana
 
FBI Profiling - Forensic Psychology.pptx
FBI Profiling - Forensic Psychology.pptxFBI Profiling - Forensic Psychology.pptx
FBI Profiling - Forensic Psychology.pptx
 
STELLAR SYSTEM IN PTERIDOPHYTE Seminar 2023- By Karishma
STELLAR SYSTEM IN PTERIDOPHYTE Seminar 2023- By KarishmaSTELLAR SYSTEM IN PTERIDOPHYTE Seminar 2023- By Karishma
STELLAR SYSTEM IN PTERIDOPHYTE Seminar 2023- By Karishma
 
Biopreservation .pptx
Biopreservation                    .pptxBiopreservation                    .pptx
Biopreservation .pptx
 
Role of Gibberellins, mode of action and external applications.pptx
Role of Gibberellins, mode of action and external applications.pptxRole of Gibberellins, mode of action and external applications.pptx
Role of Gibberellins, mode of action and external applications.pptx
 
ESSENTIAL FEATURES REQUIRED FOR ESTABLISHING FOUR TYPES OF BIOSAFETY LABORATO...
ESSENTIAL FEATURES REQUIRED FOR ESTABLISHING FOUR TYPES OF BIOSAFETY LABORATO...ESSENTIAL FEATURES REQUIRED FOR ESTABLISHING FOUR TYPES OF BIOSAFETY LABORATO...
ESSENTIAL FEATURES REQUIRED FOR ESTABLISHING FOUR TYPES OF BIOSAFETY LABORATO...
 
Density and Buoyancy for Grade 8 Science Class
Density and Buoyancy for Grade 8 Science ClassDensity and Buoyancy for Grade 8 Science Class
Density and Buoyancy for Grade 8 Science Class
 
Efficient Fourier Pricing of Multi-Asset Options: Quasi-Monte Carlo & Domain ...
Efficient Fourier Pricing of Multi-Asset Options: Quasi-Monte Carlo & Domain ...Efficient Fourier Pricing of Multi-Asset Options: Quasi-Monte Carlo & Domain ...
Efficient Fourier Pricing of Multi-Asset Options: Quasi-Monte Carlo & Domain ...
 
Introduction of Organ-On-A-Chip - Creative Biolabs
Introduction of Organ-On-A-Chip - Creative BiolabsIntroduction of Organ-On-A-Chip - Creative Biolabs
Introduction of Organ-On-A-Chip - Creative Biolabs
 
Environmental Acoustics- Speech interference level, acoustics calibrator.pptx
Environmental Acoustics- Speech interference level, acoustics calibrator.pptxEnvironmental Acoustics- Speech interference level, acoustics calibrator.pptx
Environmental Acoustics- Speech interference level, acoustics calibrator.pptx
 
Physical pharmacy unit 1 solubility of drugs.pptx
Physical pharmacy unit 1 solubility of drugs.pptxPhysical pharmacy unit 1 solubility of drugs.pptx
Physical pharmacy unit 1 solubility of drugs.pptx
 
DNA isolation molecular biology practical.pptx
DNA isolation molecular biology practical.pptxDNA isolation molecular biology practical.pptx
DNA isolation molecular biology practical.pptx
 
Speed Breeding in Vegetable Crops- innovative approach for present era of cro...
Speed Breeding in Vegetable Crops- innovative approach for present era of cro...Speed Breeding in Vegetable Crops- innovative approach for present era of cro...
Speed Breeding in Vegetable Crops- innovative approach for present era of cro...
 
Battery Reasearch Reagents from TCI Chemicals
Battery Reasearch Reagents from TCI ChemicalsBattery Reasearch Reagents from TCI Chemicals
Battery Reasearch Reagents from TCI Chemicals
 

transgenics_17b.pptx

  • 1. Transgenic Plants (Genetically modified organisms (plants) Genetically engineered plants))
  • 2. Why create transgenic plants? When there is no naturally occurring genetic variation for the target trait. Examples: 1. Glyphosate herbicide resistance in soybean, corn 2.Vitamin A in rice 3.Blue roses
  • 3. What genes to transfer? 1. One gene to a few genes - the CP4 ESPS example 2. Multiple genes - Golden Rice and Applause rose 3. In principle, any gene (or genes) ORIGIN 1 cctttcctac tcactctgga caggaacagc tgtctgcagc cacgccgcgc ctgagtgagg 61 agaggcgtag gcaccagccg aggccaccca gcaaacatct atgctgactc tgaatgggcc 121 cagtcctccg gaacagctcc ggtagaagca gccaaagcct gtctgtccat ggcgggatgc 181 cgggagctgg agttgaccaa cggctccaat ggcggcttgg agttcaaccc tatgaaggag 241 tacatgatct tgagtgatgc gcagcagatc gctgtggcgg tgctgtgtac cctgatgggg 301 ctgctgagtg ccctggagaa cgtggctgtg ctctatctca tcctgtcctc gcagcggctc
  • 4. CP4 EPSPS: The gene conferring resistance to the herbicide Roundup The gene was found in Agrobacterium tumefaciens and transferred to various plants Coincidentally, this organism is also used for creating transgenic plants TGGAAAAGGAAGGTGGCTCCTACAAATGCCATCATTGCGATAAAGGAAAGGCCATCGTTGAAGATGCCTCTGCCGACAGTGGTCCCAAAG ATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGATATCTCCACTGA CGTAAGGGATGACGCACAATCCCACTATCCTTCGCAAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGACACGCTGACAAG CTGACTCTAGCAGATCTTTCAAGAATGGCACAAATTAACAACATGGCACAAGGGATACAAACCCTTAATCCCAATTCCAATTTCCATAAACC CCAAGTTCCTAAATCTTCAAGTTTTCTTGTTTTTGGATCTAAAAAACTGAAAAATTCAGCAAATTCTATGTTGGTTTTGAAAAAAGATTCAATT TTTATGCAAAAGTTTTGTTCCTTTAGGATTTCAGCATCAGTGGCTACAGCCTGCATGCTTCACGGTGCAAGCAGCCGGCCCGCAACCGCCCG CAAATCCTCTGGCCTTTCCGGAACCGTCCGCATTCCCGGCGACAAGTCGATCTCCCACCGGTCCTTCATGTTCGGCGGTCTCGCGAGCGGTG AAACGCGCATCACCGGCCTTCTGGAAGGCGAGGACGTCATCAATACGGGCAAGGCCATGCAGGCCATGGGCGCCAGGATCCGTAAGGAA GGCGACACCTGGATCATCGATGGCGTCGGCAATGGCGGCCTCCTGGCGCCTGAGGCGCCGCTCGATTTCGGCAATGCCGCCACGGGCTGC CGCCTGACCATGGGCCTCGTCGGGGTCTACGATTTCGACAGCACCTTCATCGGCGACGCCTCGCTCACAAAGCGCCCGATGGGCCGCGTGT TGAACCCGCTGCGCGAAATGGGCGTGCAGGTGAAATCGGAAGACGGTGACCGTCTTCCCGTTACCTTGCGCGGGCCGAAGACGCCGACGC CGATCACCTACCGCGTGCCGATGGCCTCCGCACAGGTGAAGTCCGCCGTGCTGCTCGCCGGCCTCAACACGCCCGGCATCACGACGGTCAT CGAGCCGATCATGACGTGCGATCATACGGAAAAGATGCTGCAGGGCTTTGGCGCCAACCTTACCGTCGAGACGGATGCGGACGGCGTGC GCACCATCCGCCTGGAAGGCCGCGGCAAGCTCACCGGCCAAGTCATCGACGTGCCGGGCGACCCGTCCTCGACGGCCTTCCCGCTGGTTG CGGCCCTGCTTGTTCCGGGCTCCGACGTCACCATCCTCAACGTGCTGATGAACCCCACCCGCACCGGCCTCATCCTGACGCTGCAGGAAATG GGCGCCGACATCGAAGTCATCAACCTGCGCCTTGCCGGCGGCGAAGACGTGGCGGACCTGCGCGTTCGCTCCTCCACGCTGAAGGGCGTC ACGGTGCCGGAAGACCGCGCGCCTCCGATGATCGACGAATATCCGATTCTCGCTGTCGCCGCCGCCTTCGCGGAAGGGGCGACCGTGATG AACGGTCTGGAAGAACTCCGCGTCAAGGAAAGCGACCGCCTCTCGGCCGTCGCCAATGGCCTCAAGCTCAATGGCGTGGATTGCGATGAG GGCGAGACGTCGCTCGTCGTGCGTGGCCGCCCTGACGGCAAGGGGCTCGGCAACGCCTCGGGCGCCGCCGTCGCCACCCATCTCGATCAC CGCATCGCCATGAGCTTCCTCGTCATGGGCCTCGTGTCGGAAAACCCTGTCACGGTGGACGATGCCACGATGATCGCCACGAGCTTCCCGG AGTTCATGGACCTGATGGCCGGGCTGGGCGCGAAGATCGAACTCTCCGATACGAAGGCTGCCTGATGAGCTCGAATTCGAGCTCGGTACC GGATCCAATTCCCGATCGTTCAAACATTTGGCAATAAAGTTTCTTAAGATTGAATCCTGTTGCCGGTCTTGCGATGATTATCATATAATTTCT GTTGAATTACGTTAAGCATGTAATAATTAACATGTAATGCATGACGTTATTTATGAGATGGGTTTTTATGATTAGAGTCCCGCAATTATACAT TTAATACGCGATAGAAAACAAAATATAGCGCGCAAACTAGGATAAATTATCGCGCGCGGTGTCATCTATGTTACTAGATCGGGGATCGATC CCCCACCGGTCCTTCATGTTCGGCGGTCTCGCGAGCGGTGAAACGCGCATCACCGGCCTTCTGGAAGGCGAGGACGTCATCAATACGGGC AAGGCCATGCAGGCCATGGGCGCCAGGATCCGTAAGGAAGGCGACACCTGGATCATCGATGGCGTCGGCAATGGCGGCCTCCTGGCGCC TGAGGCGCCGCTCGATTTCGGCAATGCCGCCACGGGCTGCCGCCTGACCATGGGCCTCGTCGGGGTCTACGATTTCAAGCGCATCATGCTG GGAA
  • 5. Glyphosate inhibits EPSPS enzyme - impeding the synthesis of aromatic amino acids EPSPS Glyphosate Herbicide EPSPS Proteins CO2 H2O NH3 aromatic amino acids Proteins CO2 H2O NH3 aromatic amino acids glyphosate
  • 6. Commercial RR crops "Two key elements needed for the development of commercially viable glyphosate-tolerant crops are: – a resistant target enzyme – sufficient expression of that enzyme within the transgenic plant” Heck et al. 2005. Development and Characterization of a CP4 EPSPS-Based, Glyphosate-Tolerant Corn Event: Crop Sci. 45:329-339 (2005).
  • 7. EPSPS Roundup Ready Crops • When incorporated into the genome of RR- susceptible plants, the Roundup ReadyTM gene (CP4 EPSPS) confers resistance to glyphosate Proteins CO2 H2O NH3 aromatic amino acids glyphosate CP4 EPSPS
  • 8. "Golden Rice” Creation of a biosynthetic pathway in rice using genes from daffodil and bacteria; portions of genes from pea, rice, and cauliflower mosaic virus
  • 9. Golden Rice Vitamin A deficiency in humans a serious problem Rice is a major food crop Rice lacks provitamin A Create pathway for Beta-carotene synthesis • Phytoene synthase from Narcissus pseudonarcissus • Phytoene desaturase from Erwinia uredovora • Endosperm-specific glutelin promoter from Oryza sativa • CaMV promoter from cauliflower mosaic virus • Transit peptide sequence from Pisum sativum www.forbes.com
  • 10. Constructing transgenes The minimal requirements for the transgene are a promoter, coding region, and terminator General structure: 5’---Promoter …..Coding region…….terminator---3’ Example: Bt gene with 35S promoter, nptII selectable marker, and Tnos terminator sequence 5’ --P35S…Bt…Tnos--//--P35S…nptII…Tnos---3’
  • 11. Promoter: DNA sequence controlling spatial and/or temporal level of transgene expression. Promoters can be 1. constitutive • CaMV 35S: from Cauliflower mosaic virus 35S rRNA gene 2. tissue specific • Glutelin GT1: Endosperm specific 3. inducible • Cis-Jasmone: Arabidopsis genes induced by stress/wounding
  • 12. Termination sequence: DNA sequence signaling end of the gene during transcription. TNOS: Nopaline synthase gene from Agrobacterium tumefaciens T-DNA pGKB5 (7599 b.p.) Bluescript polylinker : 1-104 Right Border : 105-622 24 bp sequence : 574-596 GUS coding : 638-2446 NOS terminator : 2505-2766 OCS terminator : 2767-3489 KanR (nptII) : 3490-4479 NOS promoter : 4480-4766 35S promoter : 4767-5924 BastaR (bar) : 5925-6513 g7 terminator : 6514-6768 Left Border : 6790-7525 24 bp sequence : 6963-6986 Bluescript polylinker : 7526-7599 GGAAACAGCTATGACCATGATTACGCCAAGCTCGGAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGC TCCACCGCGGTGGCGGCCGCTCTAGAGGATCCCCCCACAGACAGCTCCGTAGCCCTCGTTCTCCTTGGAG TTCTTCGGGAAATGGATCTTTCGATTCCCGATGATGTCTCTCTTATCTGCTTTGACGACGCCGACTGGAC
  • 13. Selectable Marker: Encodes a protein (enzyme) that allows the transformed cells to grow while the growth of the non- transformed cells is inhibited. Examples include 1. Antibiotic resistance 2. Herbicide resistance “Among the most widely used antibiotic resistance genes as selectable markers are neomycin phosphotransferase II (nptII) and hygromycin phosphotransferase (hpt). The enzyme NPTII inactivates by phosphorylation a number of aminoglycoside antibiotics such as kanamycin, neomycin, geneticin (or G418) and paromomycin. Of these, G418 is routinely used for selection of transformed mammalian cells. The other three are used in a diverse range of plant species, however, kanamycin has proved to be ineffective to select legumes and gramineae. Hygromycin phosphotransferase is a suitable marker system for both plant and animal systems. The HPT enzyme inactivates the antibiotic hygromycin B. Hygromycin is usually more toxic than kanamycin and kills sensitive cells more quickly. It is nowadays one of the preferred antibiotic resistance marker systems for transformation of monocotyledonous plants, particularly gramineae (cereals and forages).” http://www.patentlens.net/daisy/Antibiotic/g1/1155.html
  • 14. Selectable Marker: Encodes a protein (enzyme) that allows the transformed cells to grow while the growth of the non- transformed cells is inhibited. Examples include 2. Herbicide resistance http://www.patentlens.net/daisy/Phosph/g2/710.html “..Members of the genus Streptomyces produce bialaphos, which leads to the production of glufosiante, ultimately inhibiting glutamine synthetase. The biochemical and toxicological characteristics of glufosinate have made it a popular, nonselective herbicide, which has been commercialized under the names Basta®, Buster® and Liberty® by Bayer Crop Science. Other Streptomyces spp. can detoxify glufosinate by producing an acetylating enzyme via production of a phosphinothricin acetyl transferase (PAT) enzyme encoded by the bar (bialaphos resistance) gene. Treatment of genetically modified plants carrying a bar gene with glufosinate or bialaphos provides a very efficient means of selection in genetic transformation protocols.”
  • 15. Selectable Markers. Details and examples of selectable markers
  • 16. Reporter genes: Genes that, upon expression in the transgenic plants, provide a clear indication that genetic transformation did occur, and indicate the location and the level of expression. A. Glucuronidase (GUS) B. Luciferase, green fluorescent protein (GFP)
  • 17. GFP: So many ways to be green
  • 18.
  • 19. Transformation procedures: In order for a transgene to be inherited, it must be incorporated into the genome of a cell which will give rise to tissues which will be asexually propagated or to tissues which will undergo gametogenesis The two principal mechanisms for transforming tissues with a transgene •Biolistics = “Gene gun” •Agrobacterium tumefaciens = “Agro”
  • 20. The gene gun • Micro projectile bombardment or the biolistic method • Small metal particles are coated with the transgene DNA • Particles are delivered to target tissues via an explosive force “The Helios Gene Gun is a new way for in vivo transformation of cells or organisms apy and genetic immunization (DNA vaccination)). This gun uses Biolistic ® particle bombardment where DNA- or RNA-coated gold particles are loaded into the gun and you pull the trigger. A low pressure helium pulse delivers the coated gold particles into virtually any target cell or tissue. The particles carry the DNA so that you do not have to remove cells from tissue in order to transform the cells.”
  • 21. The Agrobacterium method Agrobacterium tumefaciens is a soil bacterium causing a root disease called crown gall In the case of disease, A. tumefaciens invades the host plant and transfers a piece of its own DNA to the host genome For transformation, A. tumefaciens has been engineered to carry and transfer transgenes and to not cause disease
  • 22.
  • 23.
  • 24.
  • 25. Selection and regeneration: a plant with one copy of the transgene is a hemizygote (heterozygous for transgene)
  • 26. Concerns regarding transgenic plants • Cultural/ religious issues - e.g. animal genes in plants • Dietary concerns - e.g. allergies to novel proteins • Gene escape - e.g. RoundUp Ready beets • Non-target organisms - e.g. transgene plant products/ parts with unanticipated consequences • Wasting precious genes one at a time - e.g. widespread use of single Bt genes could provide intense selection pressure for resistant insects, rendering the use of Bt spray ineffective • Ownership - e.g. transgene technologies, and genes, are generally subject to intellectual property protection
  • 27. Bringing it all home….to Oregon Herbicide resistant bentgrass in Oregon (For the Willamette Valley sugarbeet story, see Lecture 1)
  • 28. The plant: Creeping bent grass (Agrostis stolonifera L.) • Golf greens • Considered a weed in eight countries • Other Agrostis species (250 worldwide; 34 North American; 24 native) • Diploid to polyploid • Sexual propagation • Outcrossing • A. stolonifera is obligate outcrossing • Small seeds • Asexual propagation • stolons • rhizomes
  • 29.
  • 30. The gene: CP4 EPSPS TGGAAAAGGAAGGTGGCTCCTACAAATGCCATCATTGCGATAAAGGAAAGGCCATCGTTGAAGATGCCTCTGCCGACAGTGGTCCCAAAG ATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGATATCTCCACTGA CGTAAGGGATGACGCACAATCCCACTATCCTTCGCAAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGACACGCTGACAAG CTGACTCTAGCAGATCTTTCAAGAATGGCACAAATTAACAACATGGCACAAGGGATACAAACCCTTAATCCCAATTCCAATTTCCATAAACC CCAAGTTCCTAAATCTTCAAGTTTTCTTGTTTTTGGATCTAAAAAACTGAAAAATTCAGCAAATTCTATGTTGGTTTTGAAAAAAGATTCAATT TTTATGCAAAAGTTTTGTTCCTTTAGGATTTCAGCATCAGTGGCTACAGCCTGCATGCTTCACGGTGCAAGCAGCCGGCCCGCAACCGCCCG CAAATCCTCTGGCCTTTCCGGAACCGTCCGCATTCCCGGCGACAAGTCGATCTCCCACCGGTCCTTCATGTTCGGCGGTCTCGCGAGCGGTG AAACGCGCATCACCGGCCTTCTGGAAGGCGAGGACGTCATCAATACGGGCAAGGCCATGCAGGCCATGGGCGCCAGGATCCGTAAGGAA GGCGACACCTGGATCATCGATGGCGTCGGCAATGGCGGCCTCCTGGCGCCTGAGGCGCCGCTCGATTTCGGCAATGCCGCCACGGGCTGC CGCCTGACCATGGGCCTCGTCGGGGTCTACGATTTCGACAGCACCTTCATCGGCGACGCCTCGCTCACAAAGCGCCCGATGGGCCGCGTGT TGAACCCGCTGCGCGAAATGGGCGTGCAGGTGAAATCGGAAGACGGTGACCGTCTTCCCGTTACCTTGCGCGGGCCGAAGACGCCGACGC CGATCACCTACCGCGTGCCGATGGCCTCCGCACAGGTGAAGTCCGCCGTGCTGCTCGCCGGCCTCAACACGCCCGGCATCACGACGGTCAT CGAGCCGATCATGACGTGCGATCATACGGAAAAGATGCTGCAGGGCTTTGGCGCCAACCTTACCGTCGAGACGGATGCGGACGGCGTGC GCACCATCCGCCTGGAAGGCCGCGGCAAGCTCACCGGCCAAGTCATCGACGTGCCGGGCGACCCGTCCTCGACGGCCTTCCCGCTGGTTG CGGCCCTGCTTGTTCCGGGCTCCGACGTCACCATCCTCAACGTGCTGATGAACCCCACCCGCACCGGCCTCATCCTGACGCTGCAGGAAATG GGCGCCGACATCGAAGTCATCAACCTGCGCCTTGCCGGCGGCGAAGACGTGGCGGACCTGCGCGTTCGCTCCTCCACGCTGAAGGGCGTC ACGGTGCCGGAAGACCGCGCGCCTCCGATGATCGACGAATATCCGATTCTCGCTGTCGCCGCCGCCTTCGCGGAAGGGGCGACCGTGATG AACGGTCTGGAAGAACTCCGCGTCAAGGAAAGCGACCGCCTCTCGGCCGTCGCCAATGGCCTCAAGCTCAATGGCGTGGATTGCGATGAG GGCGAGACGTCGCTCGTCGTGCGTGGCCGCCCTGACGGCAAGGGGCTCGGCAACGCCTCGGGCGCCGCCGTCGCCACCCATCTCGATCAC CGCATCGCCATGAGCTTCCTCGTCATGGGCCTCGTGTCGGAAAACCCTGTCACGGTGGACGATGCCACGATGATCGCCACGAGCTTCCCGG AGTTCATGGACCTGATGGCCGGGCTGGGCGCGAAGATCGAACTCTCCGATACGAAGGCTGCCTGATGAGCTCGAATTCGAGCTCGGTACC GGATCCAATTCCCGATCGTTCAAACATTTGGCAATAAAGTTTCTTAAGATTGAATCCTGTTGCCGGTCTTGCGATGATTATCATATAATTTCT GTTGAATTACGTTAAGCATGTAATAATTAACATGTAATGCATGACGTTATTTATGAGATGGGTTTTTATGATTAGAGTCCCGCAATTATACAT TTAATACGCGATAGAAAACAAAATATAGCGCGCAAACTAGGATAAATTATCGCGCGCGGTGTCATCTATGTTACTAGATCGGGGATCGATC CCCCACCGGTCCTTCATGTTCGGCGGTCTCGCGAGCGGTGAAACGCGCATCACCGGCCTTCTGGAAGGCGAGGACGTCATCAATACGGGC AAGGCCATGCAGGCCATGGGCGCCAGGATCCGTAAGGAAGGCGACACCTGGATCATCGATGGCGTCGGCAATGGCGGCCTCCTGGCGCC TGAGGCGCCGCTCGATTTCGGCAATGCCGCCACGGGCTGCCGCCTGACCATGGGCCTCGTCGGGGTCTACGATTTCAAGCGCATCATGCTG GGAA
  • 31. The case: 2003 • Under APHIS permit, 162 ha test in Jefferson county of glyphosate- tolerant GM creeping bentgrass (event ASR368 by Scotts and Monsanto). The test was conducted within a 4453-ha control area established by the Oregon Dept. of Agriculture. 2004: • 2.5 ha of production. • Documented gene flow primarily within ~ 2 km but up to 21 km (Watrud et al. 2004. PNAS 14533-14538) • Gene flow documented via seedling tests using • protein detection (TraitCheck) • PCR (using transgenic soybean CP4 EPSPS; GenBank Accession No. AF464188.1, • sequencing of cloned PCR products.
  • 32. The case: 2005: • No production • Continued sampling 2006: • Detected plants expressing transgene - demonstrated pollen transfer and seed dispersal (Reichman et al. 2006. Mol. Ecology 15: 4243- 4255) • Gene flow documented via using TraitChek, PCR, and sequencing 2007: • Issue settled with civil penalty 2011: Transgenic plants in central and southeastern Oregon 2012: Transgenic plants in Oregon and Idaho 2013, 2014, 2015, 2016, 2017……monitoring and reporting
  • 33. What is and what is not a transgenic plant?
  • 34.
  • 35.
  • 36.
  • 37. “Our work suggests that cisgenic insertion of additional copies of native genes involved in growth regulation may provide tools to help modify plant architecture, expand the genetic variance in plant architecture available to breeders and accelerate transfer of alleles between difficult-to-cross species.”
  • 38.
  • 40. Transcription Activator Like Effector Nucleases - TALENs • Use TALEs to bind to a particular DNA region • Double Strand Break • Non-Homologous End Joining repair – error can alter function • Introduce new sequence – Exogenous DNS – Homology Directed Repair
  • 41. Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) •RNA guided nucleases with custom specificities for genome editing •Modify endogenous genes rapidly and efficiently •Regulation? https://www.youtube.com/watch?v=2pp17E4E-O8
  • 43. Comparing “- enics” and “edits” DNA Transcription Translation and beyond ATGCTC ATGCTC ATCTC + transgene + RNAi construct + CRISPR construct Degrade wild type mRNA No protein, no phenotype Change wild type DNA code 1 2 3 4 Add a gene ATGCTC Wild type gene