SlideShare a Scribd company logo
Transcription of DNA to RNA
How does RNA differ from DNA?
DNA RNA
• Deoxyribonucleic acid
• Double helix
• Ribonucleic acid
• Single strand
• Makes proteins
Both have
different
nucleotides!
Both have
different
nucleotides!
Differences in Nucleotides
RNA Nucleotides
DNA Nucleotides
• Guanine
• Cytosine
• Adenine
• Uracil
• Guanine
• Cytosine
• Adenine
• Thymine
G
T
A
C
G
U
A
C
RNADNA
What is transcription?
• Transcription is the name given to the
process where the information in a gene in
a DNA strand is transferred to an RNA
molecule.
Transfer RNA
Messenger RNA (mRNA)
Ribosome RNA
Transfer RNA
• Transfers specific amino acids to
growing polypeptide chains at the
ribosomal site of protein synthesis
during translation.
Messenger RNA (mRNA)
• The form of RNA that mediates the
transfer of genetic information from the
cell nucleus to ribosomes in the cytoplasm,
where it serves as a template for protein
synthesis.
Ribosomal RNA
• It’s a component of the ribosome, and
is essential for protein synthesis in all
living organisms.
RNA Polymerase Binds to DNA
Elongation
Termination
RNA Polymerase Binds to DNA
• DNA is transcribed by an enzyme called RNA
polymerase. Specific nucleotide sequences tell RNA
polymerase where to begin and where to end. RNA
polymerase attaches to the DNA at a specific area
called the promoter region.
Elongation
• Certain proteins called transcription factors unwind
the DNA strand and allow RNA polymerase to
transcribe only a single strand of DNA into a single
stranded RNA polymer called messenger RNA
(mRNA).
• The strand that serves as the template is called the
antisense strand. The strand that is not transcribed is
called the sense strand.
Termination
• RNA polymerase moves along the DNA until it reaches
a terminator sequence. At that point, RNA polymerase
releases the mRNA polymer and detaches from the
DNA.
• The new mRNA is released from the RNA polymerase
and ready to be used in the traslation protein.
http://www.youtube.com/watch?v=5MfSYnItYvg
SUMMARY
• RNA is created from DNA template
• RNA polymerase bonds to the promoter site of a DNA strand in order to
begin DNA transcription
• It conbines with transcription factors to form the transcription iniciation
complex
• RNA polymerase moves thru DNA and breaks hidrogen bonds
• Only one strand of DNA is copied in the process of transcription
• RNA nucleotides pair with complementary DNA nucleotides in order to
form a RNA strand (its known as mRNA; its the copy of the message
contained in the gene)
• Ends when the RNA polymerase reaches the termination site of the DNA,
the DNA strands unite again and the RNA moves away.
• The new mRNA is released from the RNA polymerase and ready to be
used in the traslation protein.
Activity DNA-RNA
• ACTGGATCAAGTAGGATCATGAA
• TACGGATCGTTATTCGATAGTTCA
• TTTCGGATGGTCTAGGATAGTACG

More Related Content

What's hot

Protein Synthesis
Protein SynthesisProtein Synthesis
Protein Synthesis
SOUVIK BISWAS
 
Transcription
Transcription Transcription
Transcription
Lovnish Thakur
 
Regulation of Gene Expression
Regulation of Gene Expression Regulation of Gene Expression
Regulation of Gene Expression
Garry D. Lasaga
 
Translation in prokaryotes
Translation in prokaryotesTranslation in prokaryotes
Translation in prokaryotes
Maryam Shakeel
 
DNA replication-in-eukaryotes
DNA replication-in-eukaryotesDNA replication-in-eukaryotes
DNA replication-in-eukaryotes
FaisalAlshareefi
 
Transcription of DNA
Transcription of DNATranscription of DNA
Transcription of DNA
Prof Viyatprajna Acharya
 
Dna replication
Dna replication Dna replication
Dna replication
MANGLAM ARYA
 
Dna replication in eukaryotes
Dna replication in eukaryotesDna replication in eukaryotes
Dna replication in eukaryotes
Amol Pawar
 
DNA for Middle School Science
DNA for Middle School ScienceDNA for Middle School Science
DNA for Middle School Science
MrsTabor
 
DNA Transcription (Pharmaceutical Biotechnology)
DNA Transcription (Pharmaceutical Biotechnology)DNA Transcription (Pharmaceutical Biotechnology)
DNA Transcription (Pharmaceutical Biotechnology)
Rikesh lal Shrestha
 
Dna replication
Dna replicationDna replication
Dna replication
naveenagirish
 
DNA
DNADNA
Transcription dna2011
Transcription dna2011Transcription dna2011
Transcription dna2011
MUBOSScz
 
Nucleus
NucleusNucleus
Biochemistry transcription (RNA biosynsthesis)
Biochemistry transcription (RNA biosynsthesis)Biochemistry transcription (RNA biosynsthesis)
Biochemistry transcription (RNA biosynsthesis)
Prabesh Raj Jamkatel
 
The flow of genetic information transcription
The flow of genetic information transcriptionThe flow of genetic information transcription
The flow of genetic information transcription
Lama K Banna
 
Transcription and Translation PowerPoint
Transcription and Translation PowerPointTranscription and Translation PowerPoint
Transcription and Translation PowerPoint
BiologyIB
 
Translation in Pro and Eu karyotes
Translation in Pro  and Eu karyotesTranslation in Pro  and Eu karyotes
Translation in Pro and Eu karyotes
Nusrat Gulbarga
 
Transcription of RNA
Transcription of RNATranscription of RNA
Transcription of RNA
Farhana Atia
 
Presentation1
Presentation1Presentation1
Presentation1
Zahoor Ahmed
 

What's hot (20)

Protein Synthesis
Protein SynthesisProtein Synthesis
Protein Synthesis
 
Transcription
Transcription Transcription
Transcription
 
Regulation of Gene Expression
Regulation of Gene Expression Regulation of Gene Expression
Regulation of Gene Expression
 
Translation in prokaryotes
Translation in prokaryotesTranslation in prokaryotes
Translation in prokaryotes
 
DNA replication-in-eukaryotes
DNA replication-in-eukaryotesDNA replication-in-eukaryotes
DNA replication-in-eukaryotes
 
Transcription of DNA
Transcription of DNATranscription of DNA
Transcription of DNA
 
Dna replication
Dna replication Dna replication
Dna replication
 
Dna replication in eukaryotes
Dna replication in eukaryotesDna replication in eukaryotes
Dna replication in eukaryotes
 
DNA for Middle School Science
DNA for Middle School ScienceDNA for Middle School Science
DNA for Middle School Science
 
DNA Transcription (Pharmaceutical Biotechnology)
DNA Transcription (Pharmaceutical Biotechnology)DNA Transcription (Pharmaceutical Biotechnology)
DNA Transcription (Pharmaceutical Biotechnology)
 
Dna replication
Dna replicationDna replication
Dna replication
 
DNA
DNADNA
DNA
 
Transcription dna2011
Transcription dna2011Transcription dna2011
Transcription dna2011
 
Nucleus
NucleusNucleus
Nucleus
 
Biochemistry transcription (RNA biosynsthesis)
Biochemistry transcription (RNA biosynsthesis)Biochemistry transcription (RNA biosynsthesis)
Biochemistry transcription (RNA biosynsthesis)
 
The flow of genetic information transcription
The flow of genetic information transcriptionThe flow of genetic information transcription
The flow of genetic information transcription
 
Transcription and Translation PowerPoint
Transcription and Translation PowerPointTranscription and Translation PowerPoint
Transcription and Translation PowerPoint
 
Translation in Pro and Eu karyotes
Translation in Pro  and Eu karyotesTranslation in Pro  and Eu karyotes
Translation in Pro and Eu karyotes
 
Transcription of RNA
Transcription of RNATranscription of RNA
Transcription of RNA
 
Presentation1
Presentation1Presentation1
Presentation1
 

Viewers also liked

Dna replication transcription and translation
Dna replication transcription and translationDna replication transcription and translation
Dna replication transcription and translation
James H. Workman
 
DNA Transcription- Part-1
DNA Transcription- Part-1DNA Transcription- Part-1
DNA Transcription- Part-1
Namrata Chhabra
 
Dna and transcription_tutorial
Dna and transcription_tutorialDna and transcription_tutorial
Dna and transcription_tutorial
daniela gonzalez
 
AP Biology Ch. 14 part 1 Transcription
AP Biology Ch. 14 part 1 TranscriptionAP Biology Ch. 14 part 1 Transcription
AP Biology Ch. 14 part 1 Transcription
Stephanie Beck
 
3.5 7.3 Dna Transcription
3.5 7.3 Dna Transcription3.5 7.3 Dna Transcription
3.5 7.3 Dna Transcription
Fernanda Silva
 
Motiffs
MotiffsMotiffs
Transcription
TranscriptionTranscription
Transcription
joyjulie
 
Protein Synthesis
Protein SynthesisProtein Synthesis
Protein Synthesis
Dolores Gowland
 
Transcription II- Post transcriptional modifications and inhibitors of Transc...
Transcription II- Post transcriptional modifications and inhibitors of Transc...Transcription II- Post transcriptional modifications and inhibitors of Transc...
Transcription II- Post transcriptional modifications and inhibitors of Transc...
Namrata Chhabra
 

Viewers also liked (9)

Dna replication transcription and translation
Dna replication transcription and translationDna replication transcription and translation
Dna replication transcription and translation
 
DNA Transcription- Part-1
DNA Transcription- Part-1DNA Transcription- Part-1
DNA Transcription- Part-1
 
Dna and transcription_tutorial
Dna and transcription_tutorialDna and transcription_tutorial
Dna and transcription_tutorial
 
AP Biology Ch. 14 part 1 Transcription
AP Biology Ch. 14 part 1 TranscriptionAP Biology Ch. 14 part 1 Transcription
AP Biology Ch. 14 part 1 Transcription
 
3.5 7.3 Dna Transcription
3.5 7.3 Dna Transcription3.5 7.3 Dna Transcription
3.5 7.3 Dna Transcription
 
Motiffs
MotiffsMotiffs
Motiffs
 
Transcription
TranscriptionTranscription
Transcription
 
Protein Synthesis
Protein SynthesisProtein Synthesis
Protein Synthesis
 
Transcription II- Post transcriptional modifications and inhibitors of Transc...
Transcription II- Post transcriptional modifications and inhibitors of Transc...Transcription II- Post transcriptional modifications and inhibitors of Transc...
Transcription II- Post transcriptional modifications and inhibitors of Transc...
 

Similar to Transcription of DNA to RNA

Molecular genetics partii 100131193902-phpapp01
Molecular  genetics partii 100131193902-phpapp01Molecular  genetics partii 100131193902-phpapp01
Molecular genetics partii 100131193902-phpapp01
Muhammad Fahad Saleh
 
Chapter 7 - DNA to Protein.ppt
Chapter 7 - DNA to Protein.pptChapter 7 - DNA to Protein.ppt
Chapter 7 - DNA to Protein.ppt
ahmedisseali
 
4.3 Transcription and translation
4.3 Transcription and translation4.3 Transcription and translation
4.3 Transcription and translation
Saint Andrew's School
 
4.3 Transcription and Translation
4.3 Transcription and Translation4.3 Transcription and Translation
4.3 Transcription and Translation
Patricia Lopez
 
Transcription of DNA to RNA full description only on Slide share by Naeem Ullah
Transcription of DNA to RNA full description only on Slide share by Naeem UllahTranscription of DNA to RNA full description only on Slide share by Naeem Ullah
Transcription of DNA to RNA full description only on Slide share by Naeem Ullah
Yo yo Nody khan
 
Transcription.ppt
Transcription.pptTranscription.ppt
Transcription.ppt
KimEliakim1
 
Transcription.ppt
Transcription.pptTranscription.ppt
Transcription.ppt
areenfakhoury1
 
Protein Synthesis in Prokaryotes and Eukaroytes
Protein Synthesis in Prokaryotes and EukaroytesProtein Synthesis in Prokaryotes and Eukaroytes
Protein Synthesis in Prokaryotes and Eukaroytes
Bir Bahadur Thapa
 
Molecular Biology 1-7
Molecular Biology 1-7Molecular Biology 1-7
Molecular Biology 1-7
Linda Fahlberg-Stojanovska
 
Gene expression
Gene expressionGene expression
Gene expression
Muhammad Fahad Saleh
 
RNA Synthesis (Transcription).pptx
RNA Synthesis (Transcription).pptxRNA Synthesis (Transcription).pptx
RNA Synthesis (Transcription).pptx
GraceT12
 
Structure and importance of RNA
Structure and importance of RNAStructure and importance of RNA
Structure and importance of RNA
megr1412
 
DNA and RNAon.pptx
DNA and RNAon.pptxDNA and RNAon.pptx
DNA and RNAon.pptx
GeethuSuresh12
 
Physiology-brief about RNA and its types
Physiology-brief about RNA and its typesPhysiology-brief about RNA and its types
Physiology-brief about RNA and its types
DrHamza Nafees
 
Protein synthesis
Protein synthesisProtein synthesis
Protein synthesis
nidhiinjbp
 
Demo presentation protein synthesis xander jon siose
Demo presentation   protein synthesis xander jon sioseDemo presentation   protein synthesis xander jon siose
Demo presentation protein synthesis xander jon siose
SirXandz
 
200L lect 2.ppt
200L lect 2.ppt200L lect 2.ppt
200L lect 2.ppt
MUHAMMEDBAWAYUSUF
 
4_2022_09_14!11_26_26_PM.ppt
4_2022_09_14!11_26_26_PM.ppt4_2022_09_14!11_26_26_PM.ppt
4_2022_09_14!11_26_26_PM.ppt
Jabir Hussain
 
RECOMBINANT DNA TECNOLOGY AND PROTEIN.ppt
RECOMBINANT DNA TECNOLOGY AND PROTEIN.pptRECOMBINANT DNA TECNOLOGY AND PROTEIN.ppt
RECOMBINANT DNA TECNOLOGY AND PROTEIN.ppt
midolyon1990gmailcom
 
Transcription-and-Translation.ppt
Transcription-and-Translation.pptTranscription-and-Translation.ppt
Transcription-and-Translation.ppt
SudhaKavitha1
 

Similar to Transcription of DNA to RNA (20)

Molecular genetics partii 100131193902-phpapp01
Molecular  genetics partii 100131193902-phpapp01Molecular  genetics partii 100131193902-phpapp01
Molecular genetics partii 100131193902-phpapp01
 
Chapter 7 - DNA to Protein.ppt
Chapter 7 - DNA to Protein.pptChapter 7 - DNA to Protein.ppt
Chapter 7 - DNA to Protein.ppt
 
4.3 Transcription and translation
4.3 Transcription and translation4.3 Transcription and translation
4.3 Transcription and translation
 
4.3 Transcription and Translation
4.3 Transcription and Translation4.3 Transcription and Translation
4.3 Transcription and Translation
 
Transcription of DNA to RNA full description only on Slide share by Naeem Ullah
Transcription of DNA to RNA full description only on Slide share by Naeem UllahTranscription of DNA to RNA full description only on Slide share by Naeem Ullah
Transcription of DNA to RNA full description only on Slide share by Naeem Ullah
 
Transcription.ppt
Transcription.pptTranscription.ppt
Transcription.ppt
 
Transcription.ppt
Transcription.pptTranscription.ppt
Transcription.ppt
 
Protein Synthesis in Prokaryotes and Eukaroytes
Protein Synthesis in Prokaryotes and EukaroytesProtein Synthesis in Prokaryotes and Eukaroytes
Protein Synthesis in Prokaryotes and Eukaroytes
 
Molecular Biology 1-7
Molecular Biology 1-7Molecular Biology 1-7
Molecular Biology 1-7
 
Gene expression
Gene expressionGene expression
Gene expression
 
RNA Synthesis (Transcription).pptx
RNA Synthesis (Transcription).pptxRNA Synthesis (Transcription).pptx
RNA Synthesis (Transcription).pptx
 
Structure and importance of RNA
Structure and importance of RNAStructure and importance of RNA
Structure and importance of RNA
 
DNA and RNAon.pptx
DNA and RNAon.pptxDNA and RNAon.pptx
DNA and RNAon.pptx
 
Physiology-brief about RNA and its types
Physiology-brief about RNA and its typesPhysiology-brief about RNA and its types
Physiology-brief about RNA and its types
 
Protein synthesis
Protein synthesisProtein synthesis
Protein synthesis
 
Demo presentation protein synthesis xander jon siose
Demo presentation   protein synthesis xander jon sioseDemo presentation   protein synthesis xander jon siose
Demo presentation protein synthesis xander jon siose
 
200L lect 2.ppt
200L lect 2.ppt200L lect 2.ppt
200L lect 2.ppt
 
4_2022_09_14!11_26_26_PM.ppt
4_2022_09_14!11_26_26_PM.ppt4_2022_09_14!11_26_26_PM.ppt
4_2022_09_14!11_26_26_PM.ppt
 
RECOMBINANT DNA TECNOLOGY AND PROTEIN.ppt
RECOMBINANT DNA TECNOLOGY AND PROTEIN.pptRECOMBINANT DNA TECNOLOGY AND PROTEIN.ppt
RECOMBINANT DNA TECNOLOGY AND PROTEIN.ppt
 
Transcription-and-Translation.ppt
Transcription-and-Translation.pptTranscription-and-Translation.ppt
Transcription-and-Translation.ppt
 

Recently uploaded

What is an RPA CoE? Session 2 – CoE Roles
What is an RPA CoE?  Session 2 – CoE RolesWhat is an RPA CoE?  Session 2 – CoE Roles
What is an RPA CoE? Session 2 – CoE Roles
DianaGray10
 
Introducing BoxLang : A new JVM language for productivity and modularity!
Introducing BoxLang : A new JVM language for productivity and modularity!Introducing BoxLang : A new JVM language for productivity and modularity!
Introducing BoxLang : A new JVM language for productivity and modularity!
Ortus Solutions, Corp
 
From Natural Language to Structured Solr Queries using LLMs
From Natural Language to Structured Solr Queries using LLMsFrom Natural Language to Structured Solr Queries using LLMs
From Natural Language to Structured Solr Queries using LLMs
Sease
 
"Frontline Battles with DDoS: Best practices and Lessons Learned", Igor Ivaniuk
"Frontline Battles with DDoS: Best practices and Lessons Learned",  Igor Ivaniuk"Frontline Battles with DDoS: Best practices and Lessons Learned",  Igor Ivaniuk
"Frontline Battles with DDoS: Best practices and Lessons Learned", Igor Ivaniuk
Fwdays
 
AWS Certified Solutions Architect Associate (SAA-C03)
AWS Certified Solutions Architect Associate (SAA-C03)AWS Certified Solutions Architect Associate (SAA-C03)
AWS Certified Solutions Architect Associate (SAA-C03)
HarpalGohil4
 
Apps Break Data
Apps Break DataApps Break Data
Apps Break Data
Ivo Velitchkov
 
Astute Business Solutions | Oracle Cloud Partner |
Astute Business Solutions | Oracle Cloud Partner |Astute Business Solutions | Oracle Cloud Partner |
Astute Business Solutions | Oracle Cloud Partner |
AstuteBusiness
 
Essentials of Automations: Exploring Attributes & Automation Parameters
Essentials of Automations: Exploring Attributes & Automation ParametersEssentials of Automations: Exploring Attributes & Automation Parameters
Essentials of Automations: Exploring Attributes & Automation Parameters
Safe Software
 
AppSec PNW: Android and iOS Application Security with MobSF
AppSec PNW: Android and iOS Application Security with MobSFAppSec PNW: Android and iOS Application Security with MobSF
AppSec PNW: Android and iOS Application Security with MobSF
Ajin Abraham
 
Mutation Testing for Task-Oriented Chatbots
Mutation Testing for Task-Oriented ChatbotsMutation Testing for Task-Oriented Chatbots
Mutation Testing for Task-Oriented Chatbots
Pablo Gómez Abajo
 
inQuba Webinar Mastering Customer Journey Management with Dr Graham Hill
inQuba Webinar Mastering Customer Journey Management with Dr Graham HillinQuba Webinar Mastering Customer Journey Management with Dr Graham Hill
inQuba Webinar Mastering Customer Journey Management with Dr Graham Hill
LizaNolte
 
GlobalLogic Java Community Webinar #18 “How to Improve Web Application Perfor...
GlobalLogic Java Community Webinar #18 “How to Improve Web Application Perfor...GlobalLogic Java Community Webinar #18 “How to Improve Web Application Perfor...
GlobalLogic Java Community Webinar #18 “How to Improve Web Application Perfor...
GlobalLogic Ukraine
 
"$10 thousand per minute of downtime: architecture, queues, streaming and fin...
"$10 thousand per minute of downtime: architecture, queues, streaming and fin..."$10 thousand per minute of downtime: architecture, queues, streaming and fin...
"$10 thousand per minute of downtime: architecture, queues, streaming and fin...
Fwdays
 
Northern Engraving | Nameplate Manufacturing Process - 2024
Northern Engraving | Nameplate Manufacturing Process - 2024Northern Engraving | Nameplate Manufacturing Process - 2024
Northern Engraving | Nameplate Manufacturing Process - 2024
Northern Engraving
 
"Choosing proper type of scaling", Olena Syrota
"Choosing proper type of scaling", Olena Syrota"Choosing proper type of scaling", Olena Syrota
"Choosing proper type of scaling", Olena Syrota
Fwdays
 
GNSS spoofing via SDR (Criptored Talks 2024)
GNSS spoofing via SDR (Criptored Talks 2024)GNSS spoofing via SDR (Criptored Talks 2024)
GNSS spoofing via SDR (Criptored Talks 2024)
Javier Junquera
 
"What does it really mean for your system to be available, or how to define w...
"What does it really mean for your system to be available, or how to define w..."What does it really mean for your system to be available, or how to define w...
"What does it really mean for your system to be available, or how to define w...
Fwdays
 
"NATO Hackathon Winner: AI-Powered Drug Search", Taras Kloba
"NATO Hackathon Winner: AI-Powered Drug Search",  Taras Kloba"NATO Hackathon Winner: AI-Powered Drug Search",  Taras Kloba
"NATO Hackathon Winner: AI-Powered Drug Search", Taras Kloba
Fwdays
 
Containers & AI - Beauty and the Beast!?!
Containers & AI - Beauty and the Beast!?!Containers & AI - Beauty and the Beast!?!
Containers & AI - Beauty and the Beast!?!
Tobias Schneck
 
JavaLand 2024: Application Development Green Masterplan
JavaLand 2024: Application Development Green MasterplanJavaLand 2024: Application Development Green Masterplan
JavaLand 2024: Application Development Green Masterplan
Miro Wengner
 

Recently uploaded (20)

What is an RPA CoE? Session 2 – CoE Roles
What is an RPA CoE?  Session 2 – CoE RolesWhat is an RPA CoE?  Session 2 – CoE Roles
What is an RPA CoE? Session 2 – CoE Roles
 
Introducing BoxLang : A new JVM language for productivity and modularity!
Introducing BoxLang : A new JVM language for productivity and modularity!Introducing BoxLang : A new JVM language for productivity and modularity!
Introducing BoxLang : A new JVM language for productivity and modularity!
 
From Natural Language to Structured Solr Queries using LLMs
From Natural Language to Structured Solr Queries using LLMsFrom Natural Language to Structured Solr Queries using LLMs
From Natural Language to Structured Solr Queries using LLMs
 
"Frontline Battles with DDoS: Best practices and Lessons Learned", Igor Ivaniuk
"Frontline Battles with DDoS: Best practices and Lessons Learned",  Igor Ivaniuk"Frontline Battles with DDoS: Best practices and Lessons Learned",  Igor Ivaniuk
"Frontline Battles with DDoS: Best practices and Lessons Learned", Igor Ivaniuk
 
AWS Certified Solutions Architect Associate (SAA-C03)
AWS Certified Solutions Architect Associate (SAA-C03)AWS Certified Solutions Architect Associate (SAA-C03)
AWS Certified Solutions Architect Associate (SAA-C03)
 
Apps Break Data
Apps Break DataApps Break Data
Apps Break Data
 
Astute Business Solutions | Oracle Cloud Partner |
Astute Business Solutions | Oracle Cloud Partner |Astute Business Solutions | Oracle Cloud Partner |
Astute Business Solutions | Oracle Cloud Partner |
 
Essentials of Automations: Exploring Attributes & Automation Parameters
Essentials of Automations: Exploring Attributes & Automation ParametersEssentials of Automations: Exploring Attributes & Automation Parameters
Essentials of Automations: Exploring Attributes & Automation Parameters
 
AppSec PNW: Android and iOS Application Security with MobSF
AppSec PNW: Android and iOS Application Security with MobSFAppSec PNW: Android and iOS Application Security with MobSF
AppSec PNW: Android and iOS Application Security with MobSF
 
Mutation Testing for Task-Oriented Chatbots
Mutation Testing for Task-Oriented ChatbotsMutation Testing for Task-Oriented Chatbots
Mutation Testing for Task-Oriented Chatbots
 
inQuba Webinar Mastering Customer Journey Management with Dr Graham Hill
inQuba Webinar Mastering Customer Journey Management with Dr Graham HillinQuba Webinar Mastering Customer Journey Management with Dr Graham Hill
inQuba Webinar Mastering Customer Journey Management with Dr Graham Hill
 
GlobalLogic Java Community Webinar #18 “How to Improve Web Application Perfor...
GlobalLogic Java Community Webinar #18 “How to Improve Web Application Perfor...GlobalLogic Java Community Webinar #18 “How to Improve Web Application Perfor...
GlobalLogic Java Community Webinar #18 “How to Improve Web Application Perfor...
 
"$10 thousand per minute of downtime: architecture, queues, streaming and fin...
"$10 thousand per minute of downtime: architecture, queues, streaming and fin..."$10 thousand per minute of downtime: architecture, queues, streaming and fin...
"$10 thousand per minute of downtime: architecture, queues, streaming and fin...
 
Northern Engraving | Nameplate Manufacturing Process - 2024
Northern Engraving | Nameplate Manufacturing Process - 2024Northern Engraving | Nameplate Manufacturing Process - 2024
Northern Engraving | Nameplate Manufacturing Process - 2024
 
"Choosing proper type of scaling", Olena Syrota
"Choosing proper type of scaling", Olena Syrota"Choosing proper type of scaling", Olena Syrota
"Choosing proper type of scaling", Olena Syrota
 
GNSS spoofing via SDR (Criptored Talks 2024)
GNSS spoofing via SDR (Criptored Talks 2024)GNSS spoofing via SDR (Criptored Talks 2024)
GNSS spoofing via SDR (Criptored Talks 2024)
 
"What does it really mean for your system to be available, or how to define w...
"What does it really mean for your system to be available, or how to define w..."What does it really mean for your system to be available, or how to define w...
"What does it really mean for your system to be available, or how to define w...
 
"NATO Hackathon Winner: AI-Powered Drug Search", Taras Kloba
"NATO Hackathon Winner: AI-Powered Drug Search",  Taras Kloba"NATO Hackathon Winner: AI-Powered Drug Search",  Taras Kloba
"NATO Hackathon Winner: AI-Powered Drug Search", Taras Kloba
 
Containers & AI - Beauty and the Beast!?!
Containers & AI - Beauty and the Beast!?!Containers & AI - Beauty and the Beast!?!
Containers & AI - Beauty and the Beast!?!
 
JavaLand 2024: Application Development Green Masterplan
JavaLand 2024: Application Development Green MasterplanJavaLand 2024: Application Development Green Masterplan
JavaLand 2024: Application Development Green Masterplan
 

Transcription of DNA to RNA

  • 2. How does RNA differ from DNA? DNA RNA • Deoxyribonucleic acid • Double helix • Ribonucleic acid • Single strand • Makes proteins Both have different nucleotides! Both have different nucleotides!
  • 3. Differences in Nucleotides RNA Nucleotides DNA Nucleotides • Guanine • Cytosine • Adenine • Uracil • Guanine • Cytosine • Adenine • Thymine G T A C G U A C RNADNA
  • 4.
  • 5. What is transcription? • Transcription is the name given to the process where the information in a gene in a DNA strand is transferred to an RNA molecule.
  • 6. Transfer RNA Messenger RNA (mRNA) Ribosome RNA
  • 7. Transfer RNA • Transfers specific amino acids to growing polypeptide chains at the ribosomal site of protein synthesis during translation.
  • 8. Messenger RNA (mRNA) • The form of RNA that mediates the transfer of genetic information from the cell nucleus to ribosomes in the cytoplasm, where it serves as a template for protein synthesis.
  • 9. Ribosomal RNA • It’s a component of the ribosome, and is essential for protein synthesis in all living organisms.
  • 10. RNA Polymerase Binds to DNA Elongation Termination
  • 11. RNA Polymerase Binds to DNA • DNA is transcribed by an enzyme called RNA polymerase. Specific nucleotide sequences tell RNA polymerase where to begin and where to end. RNA polymerase attaches to the DNA at a specific area called the promoter region.
  • 12. Elongation • Certain proteins called transcription factors unwind the DNA strand and allow RNA polymerase to transcribe only a single strand of DNA into a single stranded RNA polymer called messenger RNA (mRNA). • The strand that serves as the template is called the antisense strand. The strand that is not transcribed is called the sense strand.
  • 13. Termination • RNA polymerase moves along the DNA until it reaches a terminator sequence. At that point, RNA polymerase releases the mRNA polymer and detaches from the DNA. • The new mRNA is released from the RNA polymerase and ready to be used in the traslation protein.
  • 15. SUMMARY • RNA is created from DNA template • RNA polymerase bonds to the promoter site of a DNA strand in order to begin DNA transcription • It conbines with transcription factors to form the transcription iniciation complex • RNA polymerase moves thru DNA and breaks hidrogen bonds • Only one strand of DNA is copied in the process of transcription • RNA nucleotides pair with complementary DNA nucleotides in order to form a RNA strand (its known as mRNA; its the copy of the message contained in the gene) • Ends when the RNA polymerase reaches the termination site of the DNA, the DNA strands unite again and the RNA moves away. • The new mRNA is released from the RNA polymerase and ready to be used in the traslation protein.
  • 16. Activity DNA-RNA • ACTGGATCAAGTAGGATCATGAA • TACGGATCGTTATTCGATAGTTCA • TTTCGGATGGTCTAGGATAGTACG

Editor's Notes

  1. The code is first transcribed to messenger RNA. That then travels out of the nucleus of the cell (where the DNA is found) into the cytoplasm of the cell. The cytoplasm contains essentially everything else in the cell apart from the nucleus. Here the code is read and the protein is synthesised with the help of two other forms of RNA - ribosomal RNA and transfer RNA.
  2. Brings amino acids to RNA
  3. It is synthesized from a DNA template during the process of transcription.
  4. Like DNA polymerase, RNA polymerase uses one strand of DNA as a template or model which guides the synthesis of a new strand of nucleic acid.