SlideShare a Scribd company logo
Can someone please help me with these questions and also explain the answer for 1. Most
sequencing method require the amplification of target DNA. Which of the following primer pairs
would be the most appropriate to amplify this sequence for sequencing?
GCAGGAGTTTCAAACTTTACGACACATAATAAAAGTAGTAAATAATAATGACAGTA
TCTCAAATCAG
TGCAGGGGGGAAAGGCCTACTAATACCTTACCACCCTAGAAAGGCATGATGAAAAT
TTAAGATAGA
AGGAAAATATAAATTGAAAAAAAAAAACCTAAATATTCTAAGAAAAAAGGAATCTA
GTTTGTCAAAA
TGTGACTTGAATTAATAGATAAGGAGAGTCACTTAACAAATGATTCTGACAAATATC
TTCTCTTTCCA
GGGAGAATCACTGAGCCAGAATAAAATTGAACAGATGATAAGAGGGTCAAAATTAT
GTTTATCTTA
GGAAAAGTAGAATAGAAAATTTATAAGCAGATTAAAATTTTCCCAACATTCTTGTGA
AATATGACA
CATCCCAATCTTAACAGATGTGATGGTGGGATAATTGGATAGCAATATGGGAAAAG
ATATATTTAAT
TTCCGTTGCTACACCAAATGCCATCATTTGGGATACTGTACTTGTGAGTGGAAGTGT
GGTACTATTTC ACCAAATGCCA A B C
You are planning a Next Generation Sequencing (NGS) experiment to study the mechanism of
tumorigenesis. Formation of tumor could happen due to overexpression of an oncogene,
translocation leading to a fusion gene or reduced expression of tumor suppressor gene. Which of
the following order of NGS experiments would be most appropriate? A. WGS--MethylSeq--
RNASeq--CLiPSeq B. MethylSeq-WES-RNASeq-CLiPSeq C. WES-- MethylSeq-RNASeq-
CliPSeq D. RNASeq-WES-MethylSeq--CliPSeq

More Related Content

More from sales88

CASO DE ESTUDIO La cl�nica Mayo es uno de los nombres m�s respetad.pdf
CASO DE ESTUDIO La cl�nica Mayo es uno de los nombres m�s respetad.pdfCASO DE ESTUDIO La cl�nica Mayo es uno de los nombres m�s respetad.pdf
CASO DE ESTUDIO La cl�nica Mayo es uno de los nombres m�s respetad.pdf
sales88
 
CASO DE ESTUDIO La �pera de Sydney es uno de los edificios ic�nico.pdf
CASO DE ESTUDIO La �pera de Sydney es uno de los edificios ic�nico.pdfCASO DE ESTUDIO La �pera de Sydney es uno de los edificios ic�nico.pdf
CASO DE ESTUDIO La �pera de Sydney es uno de los edificios ic�nico.pdf
sales88
 
Caso de estudio Despu�s de luchar con la deuda y la fuerte compete.pdf
Caso de estudio Despu�s de luchar con la deuda y la fuerte compete.pdfCaso de estudio Despu�s de luchar con la deuda y la fuerte compete.pdf
Caso de estudio Despu�s de luchar con la deuda y la fuerte compete.pdf
sales88
 
Caso cl�nicoSDRAPregunta 1.Dados sus s�ntomas de fatiga, disne.pdf
Caso cl�nicoSDRAPregunta 1.Dados sus s�ntomas de fatiga, disne.pdfCaso cl�nicoSDRAPregunta 1.Dados sus s�ntomas de fatiga, disne.pdf
Caso cl�nicoSDRAPregunta 1.Dados sus s�ntomas de fatiga, disne.pdf
sales88
 
Caso 21-3 Orden de prueba de deterioro Five Star Hotel Corporati.pdf
Caso 21-3 Orden de prueba de deterioro Five Star Hotel Corporati.pdfCaso 21-3 Orden de prueba de deterioro Five Star Hotel Corporati.pdf
Caso 21-3 Orden de prueba de deterioro Five Star Hotel Corporati.pdf
sales88
 
Caso 6.2 Seguro Mar�timo Cl�usula Inchmaree Un barco pesquero c.pdf
Caso 6.2 Seguro Mar�timo Cl�usula Inchmaree Un barco pesquero c.pdfCaso 6.2 Seguro Mar�timo Cl�usula Inchmaree Un barco pesquero c.pdf
Caso 6.2 Seguro Mar�timo Cl�usula Inchmaree Un barco pesquero c.pdf
sales88
 
Caso 3.1 Firma de contadores Moss y McAdams Bruce Palmer hab�a t.pdf
Caso 3.1 Firma de contadores Moss y McAdams Bruce Palmer hab�a t.pdfCaso 3.1 Firma de contadores Moss y McAdams Bruce Palmer hab�a t.pdf
Caso 3.1 Firma de contadores Moss y McAdams Bruce Palmer hab�a t.pdf
sales88
 
Caso 2 (TV de Alta Definici�n La Gran Alianza) (1) Seg�n el caso .pdf
Caso 2 (TV de Alta Definici�n La Gran Alianza) (1) Seg�n el caso .pdfCaso 2 (TV de Alta Definici�n La Gran Alianza) (1) Seg�n el caso .pdf
Caso 2 (TV de Alta Definici�n La Gran Alianza) (1) Seg�n el caso .pdf
sales88
 
Caso 1 (8 puntos) Miguel y Cinthia Leatch viven en Covington, Ten.pdf
Caso 1 (8 puntos) Miguel y Cinthia Leatch viven en Covington, Ten.pdfCaso 1 (8 puntos) Miguel y Cinthia Leatch viven en Covington, Ten.pdf
Caso 1 (8 puntos) Miguel y Cinthia Leatch viven en Covington, Ten.pdf
sales88
 
Caso 1 Agmmaglobulinemia ligada al X 1. Bill fue testamento duran.pdf
Caso 1 Agmmaglobulinemia ligada al X 1. Bill fue testamento duran.pdfCaso 1 Agmmaglobulinemia ligada al X 1. Bill fue testamento duran.pdf
Caso 1 Agmmaglobulinemia ligada al X 1. Bill fue testamento duran.pdf
sales88
 
Caso 1 Felipe R�os y Tiffany De Los Rios married filling jointl.pdf
Caso 1 Felipe R�os  y Tiffany De Los Rios married filling jointl.pdfCaso 1 Felipe R�os  y Tiffany De Los Rios married filling jointl.pdf
Caso 1 Felipe R�os y Tiffany De Los Rios married filling jointl.pdf
sales88
 
Case studyData Protect and PrivacyHuman beings value their priva.pdf
Case studyData Protect and PrivacyHuman beings value their priva.pdfCase studyData Protect and PrivacyHuman beings value their priva.pdf
Case studyData Protect and PrivacyHuman beings value their priva.pdf
sales88
 
CASE STUDY [30 Marks] Former Tongaat Hulett bosses in court for frau.pdf
CASE STUDY [30 Marks] Former Tongaat Hulett bosses in court for frau.pdfCASE STUDY [30 Marks] Former Tongaat Hulett bosses in court for frau.pdf
CASE STUDY [30 Marks] Former Tongaat Hulett bosses in court for frau.pdf
sales88
 
case study Private Practice Implements Safeguards for Waiting .pdf
case study Private Practice Implements Safeguards for Waiting .pdfcase study Private Practice Implements Safeguards for Waiting .pdf
case study Private Practice Implements Safeguards for Waiting .pdf
sales88
 
Case Study Liberty and the Elderly Patient Ronald is 71 years old..pdf
Case Study Liberty and the Elderly Patient Ronald is 71 years old..pdfCase Study Liberty and the Elderly Patient Ronald is 71 years old..pdf
Case Study Liberty and the Elderly Patient Ronald is 71 years old..pdf
sales88
 
Case Study AMr. P tripped and broke her left hip while attempting.pdf
Case Study AMr. P tripped and broke her left hip while attempting.pdfCase Study AMr. P tripped and broke her left hip while attempting.pdf
Case Study AMr. P tripped and broke her left hip while attempting.pdf
sales88
 
Case Study - Rescuing a Troubled Project C.A. McCall-Peat Liberty Li.pdf
Case Study - Rescuing a Troubled Project C.A. McCall-Peat Liberty Li.pdfCase Study - Rescuing a Troubled Project C.A. McCall-Peat Liberty Li.pdf
Case Study - Rescuing a Troubled Project C.A. McCall-Peat Liberty Li.pdf
sales88
 
Case presentation Isabelle is a four-year-old girl who lives with he.pdf
Case presentation Isabelle is a four-year-old girl who lives with he.pdfCase presentation Isabelle is a four-year-old girl who lives with he.pdf
Case presentation Isabelle is a four-year-old girl who lives with he.pdf
sales88
 
Cap�tulo 14 Preguntas para completar Selecciona las palabras neces.pdf
Cap�tulo 14 Preguntas para completar Selecciona las palabras neces.pdfCap�tulo 14 Preguntas para completar Selecciona las palabras neces.pdf
Cap�tulo 14 Preguntas para completar Selecciona las palabras neces.pdf
sales88
 
Cap�tulo 3 Pensamiento cr�tico Pregunta 10 Da ejemplos de voz acti.pdf
Cap�tulo 3 Pensamiento cr�tico Pregunta 10 Da ejemplos de voz acti.pdfCap�tulo 3 Pensamiento cr�tico Pregunta 10 Da ejemplos de voz acti.pdf
Cap�tulo 3 Pensamiento cr�tico Pregunta 10 Da ejemplos de voz acti.pdf
sales88
 

More from sales88 (20)

CASO DE ESTUDIO La cl�nica Mayo es uno de los nombres m�s respetad.pdf
CASO DE ESTUDIO La cl�nica Mayo es uno de los nombres m�s respetad.pdfCASO DE ESTUDIO La cl�nica Mayo es uno de los nombres m�s respetad.pdf
CASO DE ESTUDIO La cl�nica Mayo es uno de los nombres m�s respetad.pdf
 
CASO DE ESTUDIO La �pera de Sydney es uno de los edificios ic�nico.pdf
CASO DE ESTUDIO La �pera de Sydney es uno de los edificios ic�nico.pdfCASO DE ESTUDIO La �pera de Sydney es uno de los edificios ic�nico.pdf
CASO DE ESTUDIO La �pera de Sydney es uno de los edificios ic�nico.pdf
 
Caso de estudio Despu�s de luchar con la deuda y la fuerte compete.pdf
Caso de estudio Despu�s de luchar con la deuda y la fuerte compete.pdfCaso de estudio Despu�s de luchar con la deuda y la fuerte compete.pdf
Caso de estudio Despu�s de luchar con la deuda y la fuerte compete.pdf
 
Caso cl�nicoSDRAPregunta 1.Dados sus s�ntomas de fatiga, disne.pdf
Caso cl�nicoSDRAPregunta 1.Dados sus s�ntomas de fatiga, disne.pdfCaso cl�nicoSDRAPregunta 1.Dados sus s�ntomas de fatiga, disne.pdf
Caso cl�nicoSDRAPregunta 1.Dados sus s�ntomas de fatiga, disne.pdf
 
Caso 21-3 Orden de prueba de deterioro Five Star Hotel Corporati.pdf
Caso 21-3 Orden de prueba de deterioro Five Star Hotel Corporati.pdfCaso 21-3 Orden de prueba de deterioro Five Star Hotel Corporati.pdf
Caso 21-3 Orden de prueba de deterioro Five Star Hotel Corporati.pdf
 
Caso 6.2 Seguro Mar�timo Cl�usula Inchmaree Un barco pesquero c.pdf
Caso 6.2 Seguro Mar�timo Cl�usula Inchmaree Un barco pesquero c.pdfCaso 6.2 Seguro Mar�timo Cl�usula Inchmaree Un barco pesquero c.pdf
Caso 6.2 Seguro Mar�timo Cl�usula Inchmaree Un barco pesquero c.pdf
 
Caso 3.1 Firma de contadores Moss y McAdams Bruce Palmer hab�a t.pdf
Caso 3.1 Firma de contadores Moss y McAdams Bruce Palmer hab�a t.pdfCaso 3.1 Firma de contadores Moss y McAdams Bruce Palmer hab�a t.pdf
Caso 3.1 Firma de contadores Moss y McAdams Bruce Palmer hab�a t.pdf
 
Caso 2 (TV de Alta Definici�n La Gran Alianza) (1) Seg�n el caso .pdf
Caso 2 (TV de Alta Definici�n La Gran Alianza) (1) Seg�n el caso .pdfCaso 2 (TV de Alta Definici�n La Gran Alianza) (1) Seg�n el caso .pdf
Caso 2 (TV de Alta Definici�n La Gran Alianza) (1) Seg�n el caso .pdf
 
Caso 1 (8 puntos) Miguel y Cinthia Leatch viven en Covington, Ten.pdf
Caso 1 (8 puntos) Miguel y Cinthia Leatch viven en Covington, Ten.pdfCaso 1 (8 puntos) Miguel y Cinthia Leatch viven en Covington, Ten.pdf
Caso 1 (8 puntos) Miguel y Cinthia Leatch viven en Covington, Ten.pdf
 
Caso 1 Agmmaglobulinemia ligada al X 1. Bill fue testamento duran.pdf
Caso 1 Agmmaglobulinemia ligada al X 1. Bill fue testamento duran.pdfCaso 1 Agmmaglobulinemia ligada al X 1. Bill fue testamento duran.pdf
Caso 1 Agmmaglobulinemia ligada al X 1. Bill fue testamento duran.pdf
 
Caso 1 Felipe R�os y Tiffany De Los Rios married filling jointl.pdf
Caso 1 Felipe R�os  y Tiffany De Los Rios married filling jointl.pdfCaso 1 Felipe R�os  y Tiffany De Los Rios married filling jointl.pdf
Caso 1 Felipe R�os y Tiffany De Los Rios married filling jointl.pdf
 
Case studyData Protect and PrivacyHuman beings value their priva.pdf
Case studyData Protect and PrivacyHuman beings value their priva.pdfCase studyData Protect and PrivacyHuman beings value their priva.pdf
Case studyData Protect and PrivacyHuman beings value their priva.pdf
 
CASE STUDY [30 Marks] Former Tongaat Hulett bosses in court for frau.pdf
CASE STUDY [30 Marks] Former Tongaat Hulett bosses in court for frau.pdfCASE STUDY [30 Marks] Former Tongaat Hulett bosses in court for frau.pdf
CASE STUDY [30 Marks] Former Tongaat Hulett bosses in court for frau.pdf
 
case study Private Practice Implements Safeguards for Waiting .pdf
case study Private Practice Implements Safeguards for Waiting .pdfcase study Private Practice Implements Safeguards for Waiting .pdf
case study Private Practice Implements Safeguards for Waiting .pdf
 
Case Study Liberty and the Elderly Patient Ronald is 71 years old..pdf
Case Study Liberty and the Elderly Patient Ronald is 71 years old..pdfCase Study Liberty and the Elderly Patient Ronald is 71 years old..pdf
Case Study Liberty and the Elderly Patient Ronald is 71 years old..pdf
 
Case Study AMr. P tripped and broke her left hip while attempting.pdf
Case Study AMr. P tripped and broke her left hip while attempting.pdfCase Study AMr. P tripped and broke her left hip while attempting.pdf
Case Study AMr. P tripped and broke her left hip while attempting.pdf
 
Case Study - Rescuing a Troubled Project C.A. McCall-Peat Liberty Li.pdf
Case Study - Rescuing a Troubled Project C.A. McCall-Peat Liberty Li.pdfCase Study - Rescuing a Troubled Project C.A. McCall-Peat Liberty Li.pdf
Case Study - Rescuing a Troubled Project C.A. McCall-Peat Liberty Li.pdf
 
Case presentation Isabelle is a four-year-old girl who lives with he.pdf
Case presentation Isabelle is a four-year-old girl who lives with he.pdfCase presentation Isabelle is a four-year-old girl who lives with he.pdf
Case presentation Isabelle is a four-year-old girl who lives with he.pdf
 
Cap�tulo 14 Preguntas para completar Selecciona las palabras neces.pdf
Cap�tulo 14 Preguntas para completar Selecciona las palabras neces.pdfCap�tulo 14 Preguntas para completar Selecciona las palabras neces.pdf
Cap�tulo 14 Preguntas para completar Selecciona las palabras neces.pdf
 
Cap�tulo 3 Pensamiento cr�tico Pregunta 10 Da ejemplos de voz acti.pdf
Cap�tulo 3 Pensamiento cr�tico Pregunta 10 Da ejemplos de voz acti.pdfCap�tulo 3 Pensamiento cr�tico Pregunta 10 Da ejemplos de voz acti.pdf
Cap�tulo 3 Pensamiento cr�tico Pregunta 10 Da ejemplos de voz acti.pdf
 

Recently uploaded

Imagination in Computer Science Research
Imagination in Computer Science ResearchImagination in Computer Science Research
Imagination in Computer Science Research
Abhik Roychoudhury
 
How to Manage Large Scrollbar in Odoo 17 POS
How to Manage Large Scrollbar in Odoo 17 POSHow to Manage Large Scrollbar in Odoo 17 POS
How to Manage Large Scrollbar in Odoo 17 POS
Celine George
 
How to Manage Line Discount in Odoo 17 POS
How to Manage Line Discount in Odoo 17 POSHow to Manage Line Discount in Odoo 17 POS
How to Manage Line Discount in Odoo 17 POS
Celine George
 
View Inheritance in Odoo 17 - Odoo 17 Slides
View Inheritance in Odoo 17 - Odoo 17  SlidesView Inheritance in Odoo 17 - Odoo 17  Slides
View Inheritance in Odoo 17 - Odoo 17 Slides
Celine George
 
Our Guide to the July 2024 USPS® Rate Change
Our Guide to the July 2024 USPS® Rate ChangeOur Guide to the July 2024 USPS® Rate Change
Our Guide to the July 2024 USPS® Rate Change
Postal Advocate Inc.
 
E-learning Odoo 17 New features - Odoo 17 Slides
E-learning Odoo 17  New features - Odoo 17 SlidesE-learning Odoo 17  New features - Odoo 17 Slides
E-learning Odoo 17 New features - Odoo 17 Slides
Celine George
 
How To Update One2many Field From OnChange of Field in Odoo 17
How To Update One2many Field From OnChange of Field in Odoo 17How To Update One2many Field From OnChange of Field in Odoo 17
How To Update One2many Field From OnChange of Field in Odoo 17
Celine George
 
C Interview Questions PDF By Scholarhat.pdf
C Interview Questions PDF By Scholarhat.pdfC Interview Questions PDF By Scholarhat.pdf
C Interview Questions PDF By Scholarhat.pdf
Scholarhat
 
How to Manage Shipping Connectors & Shipping Methods in Odoo 17
How to Manage Shipping Connectors & Shipping Methods in Odoo 17How to Manage Shipping Connectors & Shipping Methods in Odoo 17
How to Manage Shipping Connectors & Shipping Methods in Odoo 17
Celine George
 
How to Manage Early Receipt Printing in Odoo 17 POS
How to Manage Early Receipt Printing in Odoo 17 POSHow to Manage Early Receipt Printing in Odoo 17 POS
How to Manage Early Receipt Printing in Odoo 17 POS
Celine George
 
How to Create & Publish a Blog in Odoo 17 Website
How to Create & Publish a Blog in Odoo 17 WebsiteHow to Create & Publish a Blog in Odoo 17 Website
How to Create & Publish a Blog in Odoo 17 Website
Celine George
 
Power of Ignored Skills: Change the Way You Think and Decide by Manoj Tripathi
Power of Ignored Skills: Change the Way You Think and Decide by Manoj TripathiPower of Ignored Skills: Change the Way You Think and Decide by Manoj Tripathi
Power of Ignored Skills: Change the Way You Think and Decide by Manoj Tripathi
Pankaj523992
 
The Cruelty of Animal Testing in the Industry.pdf
The Cruelty of Animal Testing in the Industry.pdfThe Cruelty of Animal Testing in the Industry.pdf
The Cruelty of Animal Testing in the Industry.pdf
luzmilaglez334
 
Odoo 17 Events - Attendees List Scanning
Odoo 17 Events - Attendees List ScanningOdoo 17 Events - Attendees List Scanning
Odoo 17 Events - Attendees List Scanning
Celine George
 
C# Interview Questions PDF By ScholarHat.pdf
C# Interview Questions PDF By ScholarHat.pdfC# Interview Questions PDF By ScholarHat.pdf
C# Interview Questions PDF By ScholarHat.pdf
Scholarhat
 
Genetics Teaching Plan: Dr.Kshirsagar R.V.
Genetics Teaching Plan: Dr.Kshirsagar R.V.Genetics Teaching Plan: Dr.Kshirsagar R.V.
Genetics Teaching Plan: Dr.Kshirsagar R.V.
DrRavindrakshirsagar1
 
Codeavour 5.0 International Impact Report - The Biggest International AI, Cod...
Codeavour 5.0 International Impact Report - The Biggest International AI, Cod...Codeavour 5.0 International Impact Report - The Biggest International AI, Cod...
Codeavour 5.0 International Impact Report - The Biggest International AI, Cod...
Codeavour International
 
11EHS Term 3 Week 1 Unit 1 Review: Feedback and improvementpptx
11EHS Term 3 Week 1 Unit 1 Review: Feedback and improvementpptx11EHS Term 3 Week 1 Unit 1 Review: Feedback and improvementpptx
11EHS Term 3 Week 1 Unit 1 Review: Feedback and improvementpptx
mansk2
 
Cómo crear video-tutoriales con ScreenPal (2 de julio de 2024)
Cómo crear video-tutoriales con ScreenPal (2 de julio de 2024)Cómo crear video-tutoriales con ScreenPal (2 de julio de 2024)
Cómo crear video-tutoriales con ScreenPal (2 de julio de 2024)
Cátedra Banco Santander
 
"DANH SÁCH THÍ SINH XÉT TUYỂN SỚM ĐỦ ĐIỀU KIỆN TRÚNG TUYỂN ĐẠI HỌC CHÍNH QUY ...
"DANH SÁCH THÍ SINH XÉT TUYỂN SỚM ĐỦ ĐIỀU KIỆN TRÚNG TUYỂN ĐẠI HỌC CHÍNH QUY ..."DANH SÁCH THÍ SINH XÉT TUYỂN SỚM ĐỦ ĐIỀU KIỆN TRÚNG TUYỂN ĐẠI HỌC CHÍNH QUY ...
"DANH SÁCH THÍ SINH XÉT TUYỂN SỚM ĐỦ ĐIỀU KIỆN TRÚNG TUYỂN ĐẠI HỌC CHÍNH QUY ...
thanhluan21
 

Recently uploaded (20)

Imagination in Computer Science Research
Imagination in Computer Science ResearchImagination in Computer Science Research
Imagination in Computer Science Research
 
How to Manage Large Scrollbar in Odoo 17 POS
How to Manage Large Scrollbar in Odoo 17 POSHow to Manage Large Scrollbar in Odoo 17 POS
How to Manage Large Scrollbar in Odoo 17 POS
 
How to Manage Line Discount in Odoo 17 POS
How to Manage Line Discount in Odoo 17 POSHow to Manage Line Discount in Odoo 17 POS
How to Manage Line Discount in Odoo 17 POS
 
View Inheritance in Odoo 17 - Odoo 17 Slides
View Inheritance in Odoo 17 - Odoo 17  SlidesView Inheritance in Odoo 17 - Odoo 17  Slides
View Inheritance in Odoo 17 - Odoo 17 Slides
 
Our Guide to the July 2024 USPS® Rate Change
Our Guide to the July 2024 USPS® Rate ChangeOur Guide to the July 2024 USPS® Rate Change
Our Guide to the July 2024 USPS® Rate Change
 
E-learning Odoo 17 New features - Odoo 17 Slides
E-learning Odoo 17  New features - Odoo 17 SlidesE-learning Odoo 17  New features - Odoo 17 Slides
E-learning Odoo 17 New features - Odoo 17 Slides
 
How To Update One2many Field From OnChange of Field in Odoo 17
How To Update One2many Field From OnChange of Field in Odoo 17How To Update One2many Field From OnChange of Field in Odoo 17
How To Update One2many Field From OnChange of Field in Odoo 17
 
C Interview Questions PDF By Scholarhat.pdf
C Interview Questions PDF By Scholarhat.pdfC Interview Questions PDF By Scholarhat.pdf
C Interview Questions PDF By Scholarhat.pdf
 
How to Manage Shipping Connectors & Shipping Methods in Odoo 17
How to Manage Shipping Connectors & Shipping Methods in Odoo 17How to Manage Shipping Connectors & Shipping Methods in Odoo 17
How to Manage Shipping Connectors & Shipping Methods in Odoo 17
 
How to Manage Early Receipt Printing in Odoo 17 POS
How to Manage Early Receipt Printing in Odoo 17 POSHow to Manage Early Receipt Printing in Odoo 17 POS
How to Manage Early Receipt Printing in Odoo 17 POS
 
How to Create & Publish a Blog in Odoo 17 Website
How to Create & Publish a Blog in Odoo 17 WebsiteHow to Create & Publish a Blog in Odoo 17 Website
How to Create & Publish a Blog in Odoo 17 Website
 
Power of Ignored Skills: Change the Way You Think and Decide by Manoj Tripathi
Power of Ignored Skills: Change the Way You Think and Decide by Manoj TripathiPower of Ignored Skills: Change the Way You Think and Decide by Manoj Tripathi
Power of Ignored Skills: Change the Way You Think and Decide by Manoj Tripathi
 
The Cruelty of Animal Testing in the Industry.pdf
The Cruelty of Animal Testing in the Industry.pdfThe Cruelty of Animal Testing in the Industry.pdf
The Cruelty of Animal Testing in the Industry.pdf
 
Odoo 17 Events - Attendees List Scanning
Odoo 17 Events - Attendees List ScanningOdoo 17 Events - Attendees List Scanning
Odoo 17 Events - Attendees List Scanning
 
C# Interview Questions PDF By ScholarHat.pdf
C# Interview Questions PDF By ScholarHat.pdfC# Interview Questions PDF By ScholarHat.pdf
C# Interview Questions PDF By ScholarHat.pdf
 
Genetics Teaching Plan: Dr.Kshirsagar R.V.
Genetics Teaching Plan: Dr.Kshirsagar R.V.Genetics Teaching Plan: Dr.Kshirsagar R.V.
Genetics Teaching Plan: Dr.Kshirsagar R.V.
 
Codeavour 5.0 International Impact Report - The Biggest International AI, Cod...
Codeavour 5.0 International Impact Report - The Biggest International AI, Cod...Codeavour 5.0 International Impact Report - The Biggest International AI, Cod...
Codeavour 5.0 International Impact Report - The Biggest International AI, Cod...
 
11EHS Term 3 Week 1 Unit 1 Review: Feedback and improvementpptx
11EHS Term 3 Week 1 Unit 1 Review: Feedback and improvementpptx11EHS Term 3 Week 1 Unit 1 Review: Feedback and improvementpptx
11EHS Term 3 Week 1 Unit 1 Review: Feedback and improvementpptx
 
Cómo crear video-tutoriales con ScreenPal (2 de julio de 2024)
Cómo crear video-tutoriales con ScreenPal (2 de julio de 2024)Cómo crear video-tutoriales con ScreenPal (2 de julio de 2024)
Cómo crear video-tutoriales con ScreenPal (2 de julio de 2024)
 
"DANH SÁCH THÍ SINH XÉT TUYỂN SỚM ĐỦ ĐIỀU KIỆN TRÚNG TUYỂN ĐẠI HỌC CHÍNH QUY ...
"DANH SÁCH THÍ SINH XÉT TUYỂN SỚM ĐỦ ĐIỀU KIỆN TRÚNG TUYỂN ĐẠI HỌC CHÍNH QUY ..."DANH SÁCH THÍ SINH XÉT TUYỂN SỚM ĐỦ ĐIỀU KIỆN TRÚNG TUYỂN ĐẠI HỌC CHÍNH QUY ...
"DANH SÁCH THÍ SINH XÉT TUYỂN SỚM ĐỦ ĐIỀU KIỆN TRÚNG TUYỂN ĐẠI HỌC CHÍNH QUY ...
 

Can someone please help me with these questions and also explain the.pdf

  • 1. Can someone please help me with these questions and also explain the answer for 1. Most sequencing method require the amplification of target DNA. Which of the following primer pairs would be the most appropriate to amplify this sequence for sequencing? GCAGGAGTTTCAAACTTTACGACACATAATAAAAGTAGTAAATAATAATGACAGTA TCTCAAATCAG TGCAGGGGGGAAAGGCCTACTAATACCTTACCACCCTAGAAAGGCATGATGAAAAT TTAAGATAGA AGGAAAATATAAATTGAAAAAAAAAAACCTAAATATTCTAAGAAAAAAGGAATCTA GTTTGTCAAAA TGTGACTTGAATTAATAGATAAGGAGAGTCACTTAACAAATGATTCTGACAAATATC TTCTCTTTCCA GGGAGAATCACTGAGCCAGAATAAAATTGAACAGATGATAAGAGGGTCAAAATTAT GTTTATCTTA GGAAAAGTAGAATAGAAAATTTATAAGCAGATTAAAATTTTCCCAACATTCTTGTGA AATATGACA CATCCCAATCTTAACAGATGTGATGGTGGGATAATTGGATAGCAATATGGGAAAAG ATATATTTAAT TTCCGTTGCTACACCAAATGCCATCATTTGGGATACTGTACTTGTGAGTGGAAGTGT GGTACTATTTC ACCAAATGCCA A B C You are planning a Next Generation Sequencing (NGS) experiment to study the mechanism of tumorigenesis. Formation of tumor could happen due to overexpression of an oncogene, translocation leading to a fusion gene or reduced expression of tumor suppressor gene. Which of the following order of NGS experiments would be most appropriate? A. WGS--MethylSeq-- RNASeq--CLiPSeq B. MethylSeq-WES-RNASeq-CLiPSeq C. WES-- MethylSeq-RNASeq- CliPSeq D. RNASeq-WES-MethylSeq--CliPSeq