SlideShare a Scribd company logo
1 of 52
Download to read offline
Whole genome restriction maps for
nonmodel organisms: genomic
resources where there were none.
Sue Brown
Division of Biology
Kansas State University

Tuesday, February 25, 14
• de novo genome assembly and i5K
• Improving assemblies with Bionano genome
▫ Irys system
▫ File formats
▫ Assembly pipeline
▫ Alignment filtering

• Results

Tuesday, February 25, 14
• Genomes come in many sizes
• Genome assemblies come in many qualities
• Draft Assemblies
▫ Most genomes sequenced today (nonmodel)

• Finished Assemblies

▫ Model organisms (lots of resources)
 Human
 Computational
 Genetic and genomic tools

• Genomic resources increase the value of the
genome sequence
▫ Reverse genetic approaches

Tuesday, February 25, 14
Many initiatives to sequence genomes
• 1,000 human genomes
▫ To provide a deep catalog of human genetic

• Genome 10K -started as an intiative to
sequence 10,000 vertebrate genomes. Database
currently catalogs specimens from over 16,000
▫ To understand how complex animal life evolved
through changes in DNA and use this knowledge to
become better stewards of the planet
Tuesday, February 25, 14
Letter to Science Announces i5k in 2011

Tuesday, February 25, 14
Why sequence 5,000 insect genomes?
• 53% of all living species
• Maintenance and productivity of natural and agricultural
• Consume or damage 25% of all agricultural, forestry and
livestock production
▫ >$30 Billion in annual loss

• Vector plant, animal and human disease
▫ >$50 Billion cost world wide

• Just as human and veterinary medicine now rely on
personal or animal genome info, revealing info stored in
their genomes will transform our ability to manage
insects that threaten our health, food supply and
economic security
• Improve our lives
Tuesday, February 25, 14
Standard Draft Genome Assemblies
• Highly fragmented, even at deep coverage
• Scaffolds terminate in repetitive regions
• Relatively low N50 values
• Example:
• 7x Sanger-based Tribolium castaneum
genome assembly

Tuesday, February 25, 14
Tribolium castaneum genomics
• Cot analysis
▫ Genome ~200Mb
▫ Long stretches of unique sequence
▫ Low methylation

• 9 autosomes, X and Y

Jeff Stuart, Purdue

Tuesday, February 25, 14
Standard Draft

Minimally or unfiltered data, from any number of
different sequencing platforms, that are assembled
into contiguous strings of bases (AGTC), with no gaps

This is the minimum
standard for submission
to public databases.
Science Oct 9, 2009 pp236-237
Tuesday, February 25, 14
Molecular linkage map used to anchor scaffolds
in chromosome builds (ChLG)

Low X coverage, no Y, marker density varies
Tuesday, February 25, 14
Molecular linkage map used to anchor scaffolds
in chromosome builds (ChLG)

Low X coverage, no Y, marker density varies
Tuesday, February 25, 14
T. castaneum assembly stats

Number of contigs! !
Contig N50! !
Number of scaffolds!!
! 481
Scaffold N50! !
Total number of chromosomes!
10 (-Y)
Unmapped scaffolds!!
Single contig scaffolds

• (481 + 1830 = 2321 scaffolds total)
Tuesday, February 25, 14
Scaffold structure of the Tribolium
genome assembly




300K Ns



Tuesday, February 25, 14

300K Ns
• de novo genome assembly and i5K
• Improving assemblies with Bionano genome
▫ Irys system
▫ File formats
▫ Assembly pipeline
▫ Alignment filtering

• Results

Tuesday, February 25, 14
genetic recombination map to the assembly scaffolds,
anchoring greater than 90% of the assembled
sequence1 (fig1). 
To improve this draft assembly, we constructed
physical maps of the T. castaneum genome. Using the

orientation of scaffolds have been corrected, and
scaffolds have been extended by spanning repetitive
Nature 2008 452:949-55.

Genome assembly improvements
Figure 2 Genome refinements
T. castaneum 3.0
Baylor Sanger 7x draft assembly
and molecular genetic map

T. castaneum 4.0

length (Mb): 160.466
scaffold N50 (Mb): 0.98


Illumina long distance jumplibraries extended scaffolds into
gaps and capturing gaps with
Atlas gap-link and gap-filler.

length (Mb): 160.862
scaffold N50 (Mb): 1.16


T. castaneum 4.0
and gam-ngs

Gam-ngs merged Illumina
assembly and T.cas 4.0
extending several unknowns and
an LGX scaffold.

length (Mb): 160.864
scaffold N50 (Mb): 1.16


T. castaneum 4.0
and gam-ngs plus
BioNano maps

Sequence scaffolds were aligned
to maps with IrysView the
alignment was filtered and used
to create new scaffolds.

Figure Assembly
length (Mb): 189.629
scaffold N50 (Mb): 3.31


An independent platform to validate and improve genomes
Figure Mis-assemblies
Tuesday, February 25, 14


Validate and expa
Three scaffolds fr
scaffolded with ca
How to validate a de novo assembly?
• Describe assembly
 # contigs, # scaffolds, total bases, N50 lengths
 coverage, # ESTs, # orthologs found

• But is the assembly accurate?
▫ Compare to BAC sequences
▫ If you have the resources

• Need independent (reasonably priced) method

Tuesday, February 25, 14
Genome maps based on
• BioNanos Genomics
▫ San Diego, California

• Imaging ultra-long molecules of DNA
• Labeled at restriction sites

Tuesday, February 25, 14
• de novo genome assembly and i5K
• Improving assemblies with Bionano genome
▫ Irys system
▫ File formats
▫ Assembly pipeline
▫ Alignment filtering

• Results

Tuesday, February 25, 14
Introducing the irys system

Tuesday, February 25, 14
Labeling schema
BspQ1 nicks at GCTCTTCN

10 sites /100 Kb

Tuesday, February 25, 14
Chip Design

Tuesday, February 25, 14
Samples loaded into 2 flow cells per chip

3 lasers 3 detection channels
Detect yoyo 1 in DNA backbone
Fluorescent nucleotides at labeled sites
Tuesday, February 25, 14
DNA molecules entering channels

Tuesday, February 25, 14
DNA molecules entering channels

Tuesday, February 25, 14
A long repeat in the Tribolium genome

Tuesday, February 25, 14

Mapping individual images back to map
• hthe

Regions flanking repeat are unique
Some sites are polymorphic

Tuesday, February 25, 14
Limitations of the Irys system
• Sample prep is very specific
• Requires gram amounts of starting material
• Bacterial cells, tissue culture cells, eukaryotic
• Less complex tissue is best
▫ Blood
▫ Embryos

• Not applicable to transcriptomics projects
• contig N50 >30Kb (5 restriction sites)
Tuesday, February 25, 14
• de novo genome assembly and i5K
• Improving assemblies with Bionano genome
▫ Irys system
▫ File formats
▫ Assembly pipeline
▫ Alignment filtering

• Results

Tuesday, February 25, 14
Assembly images into genomic maps

Tuesday, February 25, 14

Align BNG maps to in silico maps

Tuesday, February 25, 14

File formats are similar to
generating sequence data...

Image files

de novo assemble



@SRR014849.2 EIXKN4201AKDUH/2

Image files

call labels

Tuesday, February 25, 14


2578! 0!
2578! 0


de novo assemble




#h CMapId
#f int float
20.0 0.0


#h XmapEntryID!QryContigID
#f int
5839.8! 57024.0
Visualizing an xmap
contig id
label alignment
BioNano contig map

Tuesday, February 25, 14
• de novo genome assembly and i5K
• Improving assemblies with Bionano genome
▫ Irys system
▫ File formats
▫ Assembly pipeline
▫ Alignment filtering

• Results

Tuesday, February 25, 14
• de novo genome assembly and i5K
• Improving assemblies with Bionano genome
▫ Irys system
▫ File formats
▫ Assembly pipeline
▫ Alignment filtering

• Results

Tuesday, February 25, 14
K-INBRE i5K Github scripts:
Irys Scaffolding scripts and manuals written by Jennifer Shelton and Nic Herndon
Assembly workflow was developed by Ernest Lam (BioNano)
git pull

Tuesday, February 25, 14

Assembly pipeline
developed with Ernest Lam (BioNano)

scripts available at: i5k-KINBRE script share at GitHub: Irys-scaffolding
Tuesday, February 25, 14
Filtering alignments
Label density varies throughout the
genome so we created scripts to filter in
two passes:
Pass 1: looks for high confidence
score over at least ~30% of the total
possible alignment
Pass 2: looks for low confidence
score over the majority of the total
possible alignment (~90%)
Pass 1 finds most high quality
Pass 2 finds high-quality low-density

Tuesday, February 25, 14
Filtering alignments
Super-scaffolded scaffolds are joined
in a new reference fasta file.
Overlaping scaffolds have a 30bp
spacing gap between them
If a scaffold aligns more than once
only the longest alignment is used
If two alignments have the same
length only the highest confidence
alignment is used

Tuesday, February 25, 14
• de novo genome assembly and i5K
• Improving assemblies with Bionano genome
▫ Irys system
▫ File formats
▫ Assembly pipeline
▫ Alignment filtering

• Results

Tuesday, February 25, 14

BNG restriction maps for
• Dual nicked Bsp.QI and BbvCI
• 28.6Gb = ~143x coverage of 200Mb Tribolium genome
(>150 Kb)

• N contigs: 216
• Total Contig Len (Mb):   200.473
• Avg. Contig Len  (Mb):     0.928
• Contig N50       (Mb):    1.350
• Total Ref Len    (Mb):   157.186
• Total Contig Len / Ref Len  : 1.275
Tuesday, February 25, 14
ChLGX had 13 scaffolds. Alignment to BioNano maps
captured gaps and validated order for 11 of 13 scaffolds,
incorporated 2 unplaced scaffolds and identified a
potential misplaced scaffold (scaffold 2 aligns with another
linkage group).

Tuesday, February 25, 14
ChLGX had 13 scaffolds. Alignment to BioNano maps
captured gaps and validated order for 11 of 13 scaffolds,
incorporated 2 unplaced scaffolds and identified a
potential misplaced scaffold (scaffold 2 aligns with another
linkage group).

Tuesday, February 25, 14
ChLGX had 13 scaffolds. Alignment to BioNano maps
captured gaps and validated order for 11 of 13 scaffolds,
incorporated 2 unplaced scaffolds and identified a
potential misplaced scaffold (scaffold 2 aligns with another
linkage group).

Tuesday, February 25, 14
ChLG 7
Alignment to BioNano maps captured gaps and validated
order for 13 of 15 scaffolds. Scaffold 14 needs to be
reversed in the super-scaffold.

Tuesday, February 25, 14
ChLG 7
Alignment to BioNano maps captured gaps and validated
order for 13 of 15 scaffolds. Scaffold 14 needs to be
reversed in the super-scaffold.

Tuesday, February 25, 14
Additional chromosome linkage groups.

Tuesday, February 25, 14
Additional chromosome linkage groups.
ChLG 3

Tuesday, February 25, 14
Additional chromosome linkage groups.
ChLG 3

ChLG 9

Tuesday, February 25, 14
Additional chromosome linkage groups.
ChLG 3

ChLG 9

ChLG 2

Tuesday, February 25, 14

what does it cost?
• 100-500Mb genome <$5,000
▫ 70-100x coverage

• 1Gb genome <$8,000
▫ 70-100x coverage

• completely dependent on homogeneity of starting
• assembly and analysis software is included in

Tuesday, February 25, 14


Standard Draft Genomes are highly fragmented
BNG provides independent platform
Whole genome restriction maps
Validate assembly
Extend scaffolds/Size Gaps
Identify structural variants
Identify haplotypes
Comprehensive view of repetitive DNA (HORs)
A validated genome assembly improves
downstream analyses

Tuesday, February 25, 14
Thanks to:
• Michelle Gordon
▫ Research Assistant: optimizing sample preps

• Jennifer Shelton
▫ Biologist turned Bioinformaticist

• Nic Herndon
▫ Computer scientist turned Bioinformaticist

• BioNano Genomics
▫ Ernest Lam
▫ Weiping Wang

Tuesday, February 25, 14

More Related Content

What's hot

2013 stamps-intro-assembly
2013 stamps-intro-assembly2013 stamps-intro-assembly
2013 stamps-intro-assembly
Techniques of-biotechnology-mcclean-good
Techniques of-biotechnology-mcclean-goodTechniques of-biotechnology-mcclean-good
Techniques of-biotechnology-mcclean-good
2013 stamps-intro-assembly
2013 stamps-intro-assembly2013 stamps-intro-assembly
2013 stamps-intro-assembly
Ngs microbiome
Ngs microbiomeNgs microbiome
Ngs microbiome

What's hot (20)

Evaluation of Pool-Seq as a cost-effective alternative to GWAS
Evaluation of Pool-Seq as a cost-effective alternative to GWASEvaluation of Pool-Seq as a cost-effective alternative to GWAS
Evaluation of Pool-Seq as a cost-effective alternative to GWAS
Toward A Better Understanding Of Plant Genome Structure: Combining NGS, Optic...
Toward A Better Understanding Of Plant Genome Structure: Combining NGS, Optic...Toward A Better Understanding Of Plant Genome Structure: Combining NGS, Optic...
Toward A Better Understanding Of Plant Genome Structure: Combining NGS, Optic...
Cross-Kingdom Standards in Genomics, Epigenomics and Metagenomics
Cross-Kingdom Standards in Genomics, Epigenomics and MetagenomicsCross-Kingdom Standards in Genomics, Epigenomics and Metagenomics
Cross-Kingdom Standards in Genomics, Epigenomics and Metagenomics
Sequencing 2016
Sequencing 2016Sequencing 2016
Sequencing 2016
Phylogenomic methods for comparative evolutionary biology - University Colleg...
Phylogenomic methods for comparative evolutionary biology - University Colleg...Phylogenomic methods for comparative evolutionary biology - University Colleg...
Phylogenomic methods for comparative evolutionary biology - University Colleg...
Genetic Analysis Solutions for Plant Sciences
Genetic Analysis Solutions for Plant SciencesGenetic Analysis Solutions for Plant Sciences
Genetic Analysis Solutions for Plant Sciences
Basics of Genome Assembly
Basics of Genome Assembly Basics of Genome Assembly
Basics of Genome Assembly
2013 stamps-intro-assembly
2013 stamps-intro-assembly2013 stamps-intro-assembly
2013 stamps-intro-assembly
Future of metagenomics
Future of metagenomicsFuture of metagenomics
Future of metagenomics
NGS Introduction and Technology Overview (UEB-UAT Bioinformatics Course - Ses...
NGS Introduction and Technology Overview (UEB-UAT Bioinformatics Course - Ses...NGS Introduction and Technology Overview (UEB-UAT Bioinformatics Course - Ses...
NGS Introduction and Technology Overview (UEB-UAT Bioinformatics Course - Ses...
How to Standardise and Assemble Raw Data into Sequences: What Does it Mean fo...
How to Standardise and Assemble Raw Data into Sequences: What Does it Mean fo...How to Standardise and Assemble Raw Data into Sequences: What Does it Mean fo...
How to Standardise and Assemble Raw Data into Sequences: What Does it Mean fo...
Techniques of-biotechnology-mcclean-good
Techniques of-biotechnology-mcclean-goodTechniques of-biotechnology-mcclean-good
Techniques of-biotechnology-mcclean-good
Telomere-to-telomere assembly of a complete human chromosomes
Telomere-to-telomere assembly of a complete human chromosomesTelomere-to-telomere assembly of a complete human chromosomes
Telomere-to-telomere assembly of a complete human chromosomes
2013 stamps-intro-assembly
2013 stamps-intro-assembly2013 stamps-intro-assembly
2013 stamps-intro-assembly
Machine Learning
Machine LearningMachine Learning
Machine Learning
London Calling 2019: Karen Miga
London Calling 2019: Karen MigaLondon Calling 2019: Karen Miga
London Calling 2019: Karen Miga
Previewing GRCm39: Assembly Updates from the GRC
Previewing GRCm39: Assembly Updates from the GRCPreviewing GRCm39: Assembly Updates from the GRC
Previewing GRCm39: Assembly Updates from the GRC
Ngs microbiome
Ngs microbiomeNgs microbiome
Ngs microbiome
Big data nebraska
Big data nebraskaBig data nebraska
Big data nebraska
New generation Sequencing
New generation Sequencing New generation Sequencing
New generation Sequencing

Similar to Bionano genome maps_feb2014

What I learned at CSHL SynBio 2013.
What I learned at CSHL SynBio 2013.What I learned at CSHL SynBio 2013.
What I learned at CSHL SynBio 2013.
Kevin Spring

Similar to Bionano genome maps_feb2014 (20)

Jan2016 pac bio giab
Jan2016 pac bio giabJan2016 pac bio giab
Jan2016 pac bio giab
What should Bioinformatics do for EvoDevo?
What should Bioinformatics do for EvoDevo?What should Bioinformatics do for EvoDevo?
What should Bioinformatics do for EvoDevo?
High Throughput Sequencing Technologies: What We Can Know
High Throughput Sequencing Technologies: What We Can KnowHigh Throughput Sequencing Technologies: What We Can Know
High Throughput Sequencing Technologies: What We Can Know
RNA-Seq transcriptome analysis of Gonium pectorale cell cycle
RNA-Seq transcriptome analysis of Gonium pectorale cell cycleRNA-Seq transcriptome analysis of Gonium pectorale cell cycle
RNA-Seq transcriptome analysis of Gonium pectorale cell cycle
Microbial Phylogenomics (EVE161) Class 10-11: Genome Sequencing
Microbial Phylogenomics (EVE161) Class 10-11: Genome SequencingMicrobial Phylogenomics (EVE161) Class 10-11: Genome Sequencing
Microbial Phylogenomics (EVE161) Class 10-11: Genome Sequencing
High Throughput Sequencing Technologies: On the path to the $0* genome
High Throughput Sequencing Technologies: On the path to the $0* genomeHigh Throughput Sequencing Technologies: On the path to the $0* genome
High Throughput Sequencing Technologies: On the path to the $0* genome
RNA-Seq transcriptome analysis of Gonium pectorale cell cycle.
RNA-Seq transcriptome analysis of Gonium pectorale cell cycle.RNA-Seq transcriptome analysis of Gonium pectorale cell cycle.
RNA-Seq transcriptome analysis of Gonium pectorale cell cycle.
Giab jan2016 intro and update 160128
Giab jan2016 intro and update 160128Giab jan2016 intro and update 160128
Giab jan2016 intro and update 160128
20150601 bio sb_assembly_course
20150601 bio sb_assembly_course20150601 bio sb_assembly_course
20150601 bio sb_assembly_course
Towards a Reference Genome for Switchgrass (Panicum virgatum) - Schmutz jeremy
Towards a Reference Genome for Switchgrass (Panicum virgatum) - Schmutz jeremyTowards a Reference Genome for Switchgrass (Panicum virgatum) - Schmutz jeremy
Towards a Reference Genome for Switchgrass (Panicum virgatum) - Schmutz jeremy
Review of Liao et al - A draft human pangenome reference - Nature (2023)
Review of Liao et al - A draft human pangenome reference - Nature (2023)Review of Liao et al - A draft human pangenome reference - Nature (2023)
Review of Liao et al - A draft human pangenome reference - Nature (2023)
How we revealed genomes secrets?
How we revealed genomes secrets? How we revealed genomes secrets?
How we revealed genomes secrets?
What I learned at CSHL SynBio 2013.
What I learned at CSHL SynBio 2013.What I learned at CSHL SynBio 2013.
What I learned at CSHL SynBio 2013.
Ashg grc workshop2014_tg
Ashg grc workshop2014_tgAshg grc workshop2014_tg
Ashg grc workshop2014_tg
Alignment Approaches II: Long Reads
Alignment Approaches II: Long ReadsAlignment Approaches II: Long Reads
Alignment Approaches II: Long Reads
Genome10K & Genome Science gEVAL Talk (Earlham Institute/Norwich)
Genome10K & Genome Science gEVAL Talk (Earlham Institute/Norwich)Genome10K & Genome Science gEVAL Talk (Earlham Institute/Norwich)
Genome10K & Genome Science gEVAL Talk (Earlham Institute/Norwich)
2011 jeroen vanhoudt_ngs
2011 jeroen vanhoudt_ngs2011 jeroen vanhoudt_ngs
2011 jeroen vanhoudt_ngs
Analyzing the exome—focusing your NGS analysis with high performance target c...
Analyzing the exome—focusing your NGS analysis with high performance target c...Analyzing the exome—focusing your NGS analysis with high performance target c...
Analyzing the exome—focusing your NGS analysis with high performance target c...

More from Jennifer Shelton

Applied Bioinformatics Journal Club Pacbio RNA-Seq
Applied Bioinformatics Journal Club Pacbio RNA-SeqApplied Bioinformatics Journal Club Pacbio RNA-Seq
Applied Bioinformatics Journal Club Pacbio RNA-Seq
Jennifer Shelton
RNASeq DE methods review Applied Bioinformatics Journal Club
RNASeq DE methods review Applied Bioinformatics Journal ClubRNASeq DE methods review Applied Bioinformatics Journal Club
RNASeq DE methods review Applied Bioinformatics Journal Club
Jennifer Shelton
Translocation detection in lung cancer using mate-pair sequencing and iVIGS
Translocation detection in lung cancer using mate-pair sequencing and iVIGSTranslocation detection in lung cancer using mate-pair sequencing and iVIGS
Translocation detection in lung cancer using mate-pair sequencing and iVIGS
Jennifer Shelton

More from Jennifer Shelton (14)

Bioinformatic core facilities discussion
Bioinformatic core facilities discussionBioinformatic core facilities discussion
Bioinformatic core facilities discussion
Using BioNano Maps to Improve an Insect Genome Assembly​
Using BioNano Maps to Improve an Insect Genome Assembly​Using BioNano Maps to Improve an Insect Genome Assembly​
Using BioNano Maps to Improve an Insect Genome Assembly​
Structural Variation Detection
Structural Variation DetectionStructural Variation Detection
Structural Variation Detection
Bng presentation draft
Bng presentation draftBng presentation draft
Bng presentation draft
Lecture1: NGS Analysis on Beocat and an introduction to Perl programming for ...
Lecture1: NGS Analysis on Beocat and an introduction to Perl programming for ...Lecture1: NGS Analysis on Beocat and an introduction to Perl programming for ...
Lecture1: NGS Analysis on Beocat and an introduction to Perl programming for ...
Journal club slides to discuss "Differential analysis of gene regulation at t...
Journal club slides to discuss "Differential analysis of gene regulation at t...Journal club slides to discuss "Differential analysis of gene regulation at t...
Journal club slides to discuss "Differential analysis of gene regulation at t...
Hub gene selection_ds
Hub gene selection_dsHub gene selection_ds
Hub gene selection_ds
Applied Bioinformatics Journal Club Pacbio RNA-Seq
Applied Bioinformatics Journal Club Pacbio RNA-SeqApplied Bioinformatics Journal Club Pacbio RNA-Seq
Applied Bioinformatics Journal Club Pacbio RNA-Seq
RNASeq DE methods review Applied Bioinformatics Journal Club
RNASeq DE methods review Applied Bioinformatics Journal ClubRNASeq DE methods review Applied Bioinformatics Journal Club
RNASeq DE methods review Applied Bioinformatics Journal Club
Translocation detection in lung cancer using mate-pair sequencing and iVIGS
Translocation detection in lung cancer using mate-pair sequencing and iVIGSTranslocation detection in lung cancer using mate-pair sequencing and iVIGS
Translocation detection in lung cancer using mate-pair sequencing and iVIGS
Summary slides by Prabhakar Chalise of the Oberg et al. 2012 article "Technic...
Summary slides by Prabhakar Chalise of the Oberg et al. 2012 article "Technic...Summary slides by Prabhakar Chalise of the Oberg et al. 2012 article "Technic...
Summary slides by Prabhakar Chalise of the Oberg et al. 2012 article "Technic...
Multi-k-mer de novo transcriptome assembly and assembly of assemblies using 4...
Multi-k-mer de novo transcriptome assembly and assembly of assemblies using 4...Multi-k-mer de novo transcriptome assembly and assembly of assemblies using 4...
Multi-k-mer de novo transcriptome assembly and assembly of assemblies using 4...
Param selection phase1summary_v2
Param selection phase1summary_v2Param selection phase1summary_v2
Param selection phase1summary_v2
Bioinformatic jc 08_14_2013_formal
Bioinformatic jc 08_14_2013_formalBioinformatic jc 08_14_2013_formal
Bioinformatic jc 08_14_2013_formal

Recently uploaded

中 央社
SURVEY I created for uni project research
SURVEY I created for uni project researchSURVEY I created for uni project research
SURVEY I created for uni project research
MSc Ag Genetics & Plant Breeding: Insights from Previous Year JNKVV Entrance ...
MSc Ag Genetics & Plant Breeding: Insights from Previous Year JNKVV Entrance ...MSc Ag Genetics & Plant Breeding: Insights from Previous Year JNKVV Entrance ...
MSc Ag Genetics & Plant Breeding: Insights from Previous Year JNKVV Entrance ...
Krashi Coaching

Recently uploaded (20)

Mattingly "AI and Prompt Design: LLMs with Text Classification and Open Source"
Mattingly "AI and Prompt Design: LLMs with Text Classification and Open Source"Mattingly "AI and Prompt Design: LLMs with Text Classification and Open Source"
Mattingly "AI and Prompt Design: LLMs with Text Classification and Open Source"
demyelinated disorder: multiple sclerosis.pptx
demyelinated disorder: multiple sclerosis.pptxdemyelinated disorder: multiple sclerosis.pptx
demyelinated disorder: multiple sclerosis.pptx
Capitol Tech Univ Doctoral Presentation -May 2024
Capitol Tech Univ Doctoral Presentation -May 2024Capitol Tech Univ Doctoral Presentation -May 2024
Capitol Tech Univ Doctoral Presentation -May 2024
Stl Algorithms in C++ jjjjjjjjjjjjjjjjjj
Stl Algorithms in C++ jjjjjjjjjjjjjjjjjjStl Algorithms in C++ jjjjjjjjjjjjjjjjjj
Stl Algorithms in C++ jjjjjjjjjjjjjjjjjj
Features of Video Calls in the Discuss Module in Odoo 17
Features of Video Calls in the Discuss Module in Odoo 17Features of Video Calls in the Discuss Module in Odoo 17
Features of Video Calls in the Discuss Module in Odoo 17
SURVEY I created for uni project research
SURVEY I created for uni project researchSURVEY I created for uni project research
SURVEY I created for uni project research
How to Analyse Profit of a Sales Order in Odoo 17
How to Analyse Profit of a Sales Order in Odoo 17How to Analyse Profit of a Sales Order in Odoo 17
How to Analyse Profit of a Sales Order in Odoo 17
The Ball Poem- John Berryman_20240518_001617_0000.pptx
The Ball Poem- John Berryman_20240518_001617_0000.pptxThe Ball Poem- John Berryman_20240518_001617_0000.pptx
The Ball Poem- John Berryman_20240518_001617_0000.pptx
ANTI         PARKISON          DRUGS.pptxANTI         PARKISON          DRUGS.pptx
MOOD     STABLIZERS           DRUGS.pptxMOOD     STABLIZERS           DRUGS.pptx
Dementia (Alzheimer & vasular dementia).
Dementia (Alzheimer & vasular dementia).Dementia (Alzheimer & vasular dementia).
Dementia (Alzheimer & vasular dementia).
Removal Strategy _ FEFO _ Working with Perishable Products in Odoo 17
Removal Strategy _ FEFO _ Working with Perishable Products in Odoo 17Removal Strategy _ FEFO _ Working with Perishable Products in Odoo 17
Removal Strategy _ FEFO _ Working with Perishable Products in Odoo 17
Improved Approval Flow in Odoo 17 Studio App
Improved Approval Flow in Odoo 17 Studio AppImproved Approval Flow in Odoo 17 Studio App
Improved Approval Flow in Odoo 17 Studio App
Sternal Fractures & Dislocations - EMGuidewire Radiology Reading Room
Sternal Fractures & Dislocations - EMGuidewire Radiology Reading RoomSternal Fractures & Dislocations - EMGuidewire Radiology Reading Room
Sternal Fractures & Dislocations - EMGuidewire Radiology Reading Room
“O BEIJO” EM ARTE                       .“O BEIJO” EM ARTE                       .
MSc Ag Genetics & Plant Breeding: Insights from Previous Year JNKVV Entrance ...
MSc Ag Genetics & Plant Breeding: Insights from Previous Year JNKVV Entrance ...MSc Ag Genetics & Plant Breeding: Insights from Previous Year JNKVV Entrance ...
MSc Ag Genetics & Plant Breeding: Insights from Previous Year JNKVV Entrance ...
UChicago CMSC 23320 - The Best Commit Messages of 2024
UChicago CMSC 23320 - The Best Commit Messages of 2024UChicago CMSC 23320 - The Best Commit Messages of 2024
UChicago CMSC 23320 - The Best Commit Messages of 2024
Đề tieng anh thpt 2024 danh cho cac ban hoc sinh
Đề tieng anh thpt 2024 danh cho cac ban hoc sinhĐề tieng anh thpt 2024 danh cho cac ban hoc sinh
Đề tieng anh thpt 2024 danh cho cac ban hoc sinh

Bionano genome maps_feb2014

  • 1. Whole genome restriction maps for nonmodel organisms: genomic resources where there were none. Sue Brown Division of Biology Kansas State University Tuesday, February 25, 14
  • 2. Outline • de novo genome assembly and i5K • Improving assemblies with Bionano genome maps ▫ Irys system ▫ File formats ▫ Assembly pipeline ▫ Alignment filtering • Results Tuesday, February 25, 14
  • 3. Genomes • Genomes come in many sizes • Genome assemblies come in many qualities • Draft Assemblies ▫ Most genomes sequenced today (nonmodel) • Finished Assemblies ▫ Model organisms (lots of resources)  Human  Computational  Genetic and genomic tools • Genomic resources increase the value of the genome sequence ▫ Reverse genetic approaches Tuesday, February 25, 14
  • 4. Many initiatives to sequence genomes • 1,000 human genomes ▫ To provide a deep catalog of human genetic variation • Genome 10K -started as an intiative to sequence 10,000 vertebrate genomes. Database currently catalogs specimens from over 16,000 organisms ▫ To understand how complex animal life evolved through changes in DNA and use this knowledge to become better stewards of the planet Tuesday, February 25, 14
  • 5. Letter to Science Announces i5k in 2011 Tuesday, February 25, 14
  • 6. Why sequence 5,000 insect genomes? • 53% of all living species • Maintenance and productivity of natural and agricultural ecosystems • Consume or damage 25% of all agricultural, forestry and livestock production ▫ >$30 Billion in annual loss • Vector plant, animal and human disease ▫ >$50 Billion cost world wide • Just as human and veterinary medicine now rely on personal or animal genome info, revealing info stored in their genomes will transform our ability to manage insects that threaten our health, food supply and economic security • Improve our lives Tuesday, February 25, 14
  • 7. Standard Draft Genome Assemblies • Highly fragmented, even at deep coverage • Scaffolds terminate in repetitive regions • Relatively low N50 values • Example: • 7x Sanger-based Tribolium castaneum genome assembly Tuesday, February 25, 14
  • 8. Tribolium castaneum genomics • Cot analysis ▫ Genome ~200Mb ▫ Long stretches of unique sequence ▫ Low methylation • 9 autosomes, X and Y Jeff Stuart, Purdue Tuesday, February 25, 14
  • 9. Standard Draft  Minimally or unfiltered data, from any number of different sequencing platforms, that are assembled into contiguous strings of bases (AGTC), with no gaps (contigs). This is the minimum standard for submission to public databases. Science Oct 9, 2009 pp236-237 Tuesday, February 25, 14
  • 10. Molecular linkage map used to anchor scaffolds in chromosome builds (ChLG) Low X coverage, no Y, marker density varies Tuesday, February 25, 14
  • 11. Molecular linkage map used to anchor scaffolds in chromosome builds (ChLG) Low X coverage, no Y, marker density varies Tuesday, February 25, 14
  • 12. T. castaneum assembly stats • • • • • • • Number of contigs! ! ! 8,814 Contig N50! ! ! 43,511 Number of scaffolds!! ! 481 Scaffold N50! ! ! 975,455 Total number of chromosomes! 10 (-Y) Unmapped scaffolds!! ! 352 Single contig scaffolds 1835 • (481 + 1830 = 2321 scaffolds total) Tuesday, February 25, 14
  • 13. Scaffold structure of the Tribolium genome assembly ChLG NW NW NW AAJJ 300K Ns Unanchored DS AAJJ DS AAJJ DS AAJJ DS AAJJ Tuesday, February 25, 14 300K Ns
  • 14. Outline • de novo genome assembly and i5K • Improving assemblies with Bionano genome maps ▫ Irys system ▫ File formats ▫ Assembly pipeline ▫ Alignment filtering • Results Tuesday, February 25, 14
  • 15. genetic recombination map to the assembly scaffolds, anchoring greater than 90% of the assembled sequence1 (fig1).  To improve this draft assembly, we constructed physical maps of the T. castaneum genome. Using the orientation of scaffolds have been corrected, and scaffolds have been extended by spanning repetitive regions.   Nature 2008 452:949-55. Genome assembly improvements Figure 2 Genome refinements T. castaneum 3.0 Baylor Sanger 7x draft assembly and molecular genetic map T. castaneum 4.0 length (Mb): 160.466 scaffolds: 2321 scaffold N50 (Mb): 0.98 multicontig scaffolds 481 Illumina long distance jumplibraries extended scaffolds into gaps and capturing gaps with Atlas gap-link and gap-filler. length (Mb): 160.862 scaffolds: 2219 scaffold N50 (Mb): 1.16 411 T. castaneum 4.0 and gam-ngs Gam-ngs merged Illumina assembly and T.cas 4.0 extending several unknowns and an LGX scaffold. length (Mb): 160.864 scaffolds: 2219 scaffold N50 (Mb): 1.16 411 T. castaneum 4.0 and gam-ngs plus BioNano maps Sequence scaffolds were aligned to maps with IrysView the alignment was filtered and used to create new scaffolds. Figure Assembly length (Mb): 189.629 scaffolds: 2153 scaffold N50 (Mb): 3.31 341 An independent platform to validate and improve genomes Figure Mis-assemblies Tuesday, February 25, 14 ChLG3 Validate and expa Three scaffolds fr scaffolded with ca
  • 16. How to validate a de novo assembly? • Describe assembly  # contigs, # scaffolds, total bases, N50 lengths  coverage, # ESTs, # orthologs found • But is the assembly accurate? ▫ Compare to BAC sequences ▫ If you have the resources • Need independent (reasonably priced) method Tuesday, February 25, 14
  • 17. Genome maps based on landmarks • BioNanos Genomics ▫ San Diego, California • Imaging ultra-long molecules of DNA • Labeled at restriction sites Tuesday, February 25, 14
  • 18. Outline • de novo genome assembly and i5K • Improving assemblies with Bionano genome maps ▫ Irys system ▫ File formats ▫ Assembly pipeline ▫ Alignment filtering • Results Tuesday, February 25, 14
  • 19. Introducing the irys system Tuesday, February 25, 14
  • 20. Labeling schema BspQ1 nicks at GCTCTTCN CGAGAAGN 10 sites /100 Kb Tuesday, February 25, 14
  • 22. Samples loaded into 2 flow cells per chip 3 lasers 3 detection channels Detect yoyo 1 in DNA backbone Fluorescent nucleotides at labeled sites Tuesday, February 25, 14
  • 23. DNA molecules entering channels Tuesday, February 25, 14
  • 24. DNA molecules entering channels Tuesday, February 25, 14
  • 25. A long repeat in the Tribolium genome Tuesday, February 25, 14
  • 26. 24 Mapping individual images back to map • hthe Regions flanking repeat are unique Some sites are polymorphic Tuesday, February 25, 14
  • 27. Limitations of the Irys system • Sample prep is very specific • Requires gram amounts of starting material • Bacterial cells, tissue culture cells, eukaryotic nuclei • Less complex tissue is best ▫ Blood ▫ Embryos • Not applicable to transcriptomics projects • contig N50 >30Kb (5 restriction sites) Tuesday, February 25, 14
  • 28. Outline • de novo genome assembly and i5K • Improving assemblies with Bionano genome maps ▫ Irys system ▫ File formats ▫ Assembly pipeline ▫ Alignment filtering • Results Tuesday, February 25, 14
  • 29. Assembly images into genomic maps .tiff .bnx .cmap Tuesday, February 25, 14
  • 30. 28 Align BNG maps to in silico maps (.xmap) Tuesday, February 25, 14
  • 31. 29 File formats are similar to generating sequence data... basecall Image files de novo assemble fastq fasta @SRR014849.2 EIXKN4201AKDUH/2 TCAAGTGGTGAACGGCAGAAA + <=B:==B:=<?6=B;<;=B=) Image files call labels Tuesday, February 25, 14 21! 202146.4 1096.2! 8973.8 10.0565! 11.7966 0.0187! 0.0604 sam HWI-ST330_C0NEHACXX: 2:1101:17113:52802#0 ! 69! contig1 ! 2578! 0! * ! =! 2578! 0 ! ATTACGGCCCATGGTTCAGAATAATGACGAA TAGAAATACTAGTACTATATCCCCTAAAAAA! <@CFFFFFHHGFHJHIJJJJJJJJJFJJJFG FHEHIHGHJGIJHIIIJJJJJJJJIJIIJIH! YT:Z:UP >conitg1 TCAAGTGGTGAACGGCAGAAA de novo assemble bnx 0! 1! QX11! QX12! align align cmap #h CMapId ContigLength NumSites SiteID LabelChannel Position StdDev Coverage Occurrence #f int float int int int float float int int 393 225073.2 21 1 1 20.0 0.0 3 3 xmap #h XmapEntryID!QryContigID ! RefcontigID! QryStartPos ! QryEndPos! RefStartPos ! RefEndPos! Orientation ! Confidence! HitEnum #f int !int ! int ! float ! float ! float ! float ! string ! float ! string 1! 94! 1! 444392.7 ! 5839.8! 57024.0 ! 550038.8! -! 28.87 ! 1M1D2M3I4D1M3I2M1I7M1I1M1I9M1I1M1I2M1I3M1D 2M
  • 32. Visualizing an xmap contig id sequence-based scaffold label alignment BioNano contig map coverage Tuesday, February 25, 14
  • 33. Outline • de novo genome assembly and i5K • Improving assemblies with Bionano genome maps ▫ Irys system ▫ File formats ▫ Assembly pipeline ▫ Alignment filtering • Results Tuesday, February 25, 14
  • 34. Outline • de novo genome assembly and i5K • Improving assemblies with Bionano genome maps ▫ Irys system ▫ File formats ▫ Assembly pipeline ▫ Alignment filtering • Results Tuesday, February 25, 14
  • 35. K-INBRE i5K Github scripts: Irys Scaffolding scripts and manuals written by Jennifer Shelton and Nic Herndon Assembly workflow was developed by Ernest Lam (BioNano) git pull Tuesday, February 25, 14
  • 36. 34 Assembly pipeline developed with Ernest Lam (BioNano) scripts available at: i5k-KINBRE script share at GitHub: Irys-scaffolding Tuesday, February 25, 14
  • 37. Filtering alignments Label density varies throughout the genome so we created scripts to filter in two passes: Pass 1: looks for high confidence score over at least ~30% of the total possible alignment Pass 2: looks for low confidence score over the majority of the total possible alignment (~90%) Pass 1 finds most high quality alignments. Pass 2 finds high-quality low-density alignments. Tuesday, February 25, 14
  • 38. Filtering alignments Super-scaffolded scaffolds are joined in a new reference fasta file. Overlaping scaffolds have a 30bp spacing gap between them If a scaffold aligns more than once only the longest alignment is used If two alignments have the same length only the highest confidence alignment is used Tuesday, February 25, 14
  • 39. Outline • de novo genome assembly and i5K • Improving assemblies with Bionano genome maps ▫ Irys system ▫ File formats ▫ Assembly pipeline ▫ Alignment filtering • Results Tuesday, February 25, 14
  • 40. 38 BNG restriction maps for Tcastaneum • Dual nicked Bsp.QI and BbvCI • 28.6Gb = ~143x coverage of 200Mb Tribolium genome (>150 Kb) • N contigs: 216 • Total Contig Len (Mb):   200.473 • Avg. Contig Len  (Mb):     0.928 • Contig N50       (Mb):    1.350 • Total Ref Len    (Mb):   157.186 • Total Contig Len / Ref Len  : 1.275 Tuesday, February 25, 14
  • 41. ChLG X ChLGX had 13 scaffolds. Alignment to BioNano maps captured gaps and validated order for 11 of 13 scaffolds, incorporated 2 unplaced scaffolds and identified a potential misplaced scaffold (scaffold 2 aligns with another linkage group). Tuesday, February 25, 14
  • 42. ChLG X ChLGX had 13 scaffolds. Alignment to BioNano maps captured gaps and validated order for 11 of 13 scaffolds, incorporated 2 unplaced scaffolds and identified a potential misplaced scaffold (scaffold 2 aligns with another linkage group). Tuesday, February 25, 14
  • 43. ChLG X ChLGX had 13 scaffolds. Alignment to BioNano maps captured gaps and validated order for 11 of 13 scaffolds, incorporated 2 unplaced scaffolds and identified a potential misplaced scaffold (scaffold 2 aligns with another linkage group). Tuesday, February 25, 14
  • 44. ChLG 7 Alignment to BioNano maps captured gaps and validated order for 13 of 15 scaffolds. Scaffold 14 needs to be reversed in the super-scaffold. Tuesday, February 25, 14
  • 45. ChLG 7 Alignment to BioNano maps captured gaps and validated order for 13 of 15 scaffolds. Scaffold 14 needs to be reversed in the super-scaffold. Tuesday, February 25, 14
  • 46. Additional chromosome linkage groups. Tuesday, February 25, 14
  • 47. Additional chromosome linkage groups. ChLG 3 Tuesday, February 25, 14
  • 48. Additional chromosome linkage groups. ChLG 3 ChLG 9 Tuesday, February 25, 14
  • 49. Additional chromosome linkage groups. ChLG 3 ChLG 9 ChLG 2 Tuesday, February 25, 14
  • 50. 42 what does it cost? • 100-500Mb genome <$5,000 ▫ 70-100x coverage • 1Gb genome <$8,000 ▫ 70-100x coverage • completely dependent on homogeneity of starting material • assembly and analysis software is included in price Tuesday, February 25, 14
  • 51. 43 Summary • • • • • • • • • Standard Draft Genomes are highly fragmented BNG provides independent platform Whole genome restriction maps Validate assembly Extend scaffolds/Size Gaps Identify structural variants Identify haplotypes Comprehensive view of repetitive DNA (HORs) A validated genome assembly improves downstream analyses Tuesday, February 25, 14
  • 52. Thanks to: • Michelle Gordon ▫ Research Assistant: optimizing sample preps • Jennifer Shelton ▫ Biologist turned Bioinformaticist • Nic Herndon ▫ Computer scientist turned Bioinformaticist • BioNano Genomics ▫ Ernest Lam ▫ Weiping Wang Tuesday, February 25, 14