Sinead Coleman, Jason Chien, Xiao-Ning Zhang                                                            Department of Biol...
Upcoming SlideShare
Loading in …5
×

Poster: An Investigation into the Phosphorylation Status of a Splicing Factor, SR45, in Arabidopsis thaliana

352 views

Published on

Research Assistance with Dr. Xiao-Ning Zhang at St. Bonaventure University

Published in: Technology, Business
0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total views
352
On SlideShare
0
From Embeds
0
Number of Embeds
1
Actions
Shares
0
Downloads
4
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide
  • Figure 1: #1:Hypothesis on Target : T218 and S219 as phosphorylation sites (Net Phos 2.0) combine #2 +#3 No green. #2: Site-Direct Muatgenesis. Use D and E to substitute T218 and S219.,#3: Plant Transformation. Introduce different mutant genes into Arabidiopsis plants. #4: Transgenic Plant Screen. #5: Trangenic Plant Verification: Confocal Imaging#6: Phenotypic Analysis. Make font larger, may use image if possible.Figure 2:Need to make – must see nucleiConstruct after transformation and GFP in root. Figure 3: titles need to line up, everything need to line up actually. Figure 4: change sr45 fonts to rest of slide font, rotate structures as shown in arrow keep name for the structure (you don’t need to redraw them. Just use rotation function in ppt), Zhang will email the sr45 structure via PPTFonts need to be the same
  • Poster: An Investigation into the Phosphorylation Status of a Splicing Factor, SR45, in Arabidopsis thaliana

    1. 1. Sinead Coleman, Jason Chien, Xiao-Ning Zhang Department of Biology, St. Bonaventure University, St. Bonaventure, NY 14778Abstract A. B. A. SR45.1 (AS1) SR45.2 (AS2)SR45 is an important splicing factor that is involved inmultiple developmental processes in Arabidopsis thaliana. CATCTCCTCAACGGAAAACAG T S P Q R K T GSR45 has two splicing isoforms, SR45.1 and SR45.2, that Alternative Acceptor Site (21 nt.)play distinct roles in root growth and flower development.SR45.1 has two hypothesized phosphorylation sites,threonine 218 (T218) and serine 219 (S219), that are missingin SR45.2. To further investigate the function of these two C. B.sites after phosphorylation, we substituted these amino acidsin the existing SR45.1-GFP construct with aspartic acid (D)and glutamic acid (E) by site-direct mutagenesis. Theresulting mutant genes were transformed into sr45-1 mutantplants to generate stable transgenic plants. Figure 2 Transgenic plants overexpressing different SR45-GFP constructs.The transgenic plant lines were screened by examining their A. Domain arrangement of SR45.1, SR45.2, and mutant constructs with different amino acid substitutions.resistance to herbicide and selected by the presence of the B and C: An example of the expression of SR45.1 mutant proteins visualized by GFP. GFP signalGFP signal. Our results show that the expression level of was detected in nucleus of root cells in the SR45.1S219E construct.GFP and its sustainability are directly related to the B: Root tip. Scale bar represents 100µm. C: Nucleus. Scale bar represents 10µm.effectiveness of the transgene. For the petal development,substitutions at either/both sites recovered the normaldevelopment to various degrees. For root growth, the double A. B. Figure 4 Phosphorylation Mimicking on threonine (T218)substitution resulted in overgrowth, while the substitution on and serine (S219) in SR45.1.T218 gave a better recovery than the substitution on S219 A. Two SR45 isoforms: SR45.1 and SR45.2. Exons are shown as greenalone. Therefore these data suggest that the phosphorylation boxes; introns are shown as straight lines; untranslated regions (UTRs)of both T218 and S219 may not be necessary for the normal are shown as white boxes. The alternative 3’ splice site sequence that isfunction of SR45.1 in both root and petal development. present in SR45.1 but missing in SR45.2 is shown with its deduced aminoHowever, a phosphorylated T218, but not a phosphorylated acid sequence.S219, may be required for a fully functional SR45.1 in roots B. Structure similarity of phosphoserine, phosphothreonine, asparticand petals acid (D) and glutamic acid (E). Conclusion In order to study the functional difference between SR45.1 and SR45.2, we identified two residues (T218 and S219) present in SR45.1 but absent in SR45.2 as potential targets for phosphorylation C. D. modification. Due to the structural similarity between the phosphorylated residues and phosphorylation mimics, namely D and E, we substituted T218 and S219 with D and E to generate a set of SR45.1 mutant genes and introduced them into sr45-1 mutant plants, separately. By analyzing the degree of recovery from mutant phenotypes in these transgenic plants, we found that both T218D and T218E had a greater effect on recovering both root growth and petal development to wild type than S219D and S219E. When both T218 and S219 were forced to be negatively charged by phosphorylation mimics, the root exhibited exaggerated growth, while the observations on petal development were not conclusive. This indicates that SR45.1 may be phosphorylated at T218 rather than S219 in its active form in roots. However, since these two residues are missing in SR45.2, SR45.2 is regulated differently from SR45.1. This study provided Figure 3 Amino acid substitutions and their effect on root growth and flower petal further evidence on the difference between two isoforms of SR45 and how it may contribute to the distinct functions of the two isoforms in development. regulating plant development and growth. Plants of Col wild type, sr45-1 and two independent transgenic lines for each amino acid substitution were used for all the analysis. Reference A and B: Root growth. Root length was measured from 4-day-old seedlings. Error bars show the X.-N. Zhang & S. M. Mount. Two alternatively spliced isoforms of the standard deviation (n=15). Arabidopsis thaliana SR45 protein have distinct roles during normal C and D: Petal development. Petal width-to-length ratio was measured from individual flowers plant development. Plant Physiol. 2009, 150(3): 1-9. randomly picked from plants at 10 days after flowering. Error bars show the standard deviation (n=19). * presents statistical difference compared to Col; † presents statistical difference compared to the sr45-1 This Project is supported by the National Science Foundation and St Figure 1 Experimental procedure mutant (p<0.05). Bonaventure University.

    ×