 20 essential amino acids Linked together to make proteins Made of amine group, carboxylic  acid, and R group (side cha...
 Sequence of amino acids Depends on the DNA sequence    › mRNA is formed by pairing with DNA    › mRNA is then read by t...
 ACAAUGGAACAUAGAUACAUA
 Uses “weak” hydrogen bonds to form Types:    › Coils    › Pleats/sheets
   “Folding” of proteins    › Occur because different attractions      (bonds) form between alpha helices      and beta s...
   2 or more amino acids put together   Multiple tertiary proteins
Lipids
   Organic molecule insoluble in water   3 types:    › Neutral fats (triglycerides)    › Phospholipids (cell membrane)  ...
   Triglycerides    › 3 fatty acid chains       Saturated/Unsaturated    › Glycerol molecule Store energy Insulate bod...
 Modified triglycerides Nonpolar fatty acid chain = tail    › Hydrophobic (“fears” water)   Polar phosphate = head    ›...
 4 connected Carbon rings Stabilizes cell membranes
Carbohydrates
   Organic compound made of Carbon,    Hydrogen, & Oxygen in ratio of    › 1C : 2H : 1O   Used for energy storage   3 t...
 Simple sugars Soluble in water Examples: Glucose &Galactose
 Two monosaccharide sugars linked  together by dehydration synthesis Soluble in water Example: Sucrose
 More than 2 sugars linked together Formed by dehydration synthesis Usually not soluble in water Examples: Starch, cel...
   Monomers joined together to make    polymers    › Loss of water when they are joined    › Electrons are rearranged    ...
   Adding water to a polymer to break it    apart
   Synthesis reactions: combining atoms    › Anabolic reactions    › Require more energy than produced   Decomposition r...
PBS Biomolecules
PBS Biomolecules
PBS Biomolecules
PBS Biomolecules
Upcoming SlideShare
Loading in …5
×

PBS Biomolecules

368 views

Published on

Published in: Education, Technology, Business
0 Comments
1 Like
Statistics
Notes
  • Be the first to comment

No Downloads
Views
Total views
368
On SlideShare
0
From Embeds
0
Number of Embeds
2
Actions
Shares
0
Downloads
10
Comments
0
Likes
1
Embeds 0
No embeds

No notes for slide

PBS Biomolecules

  1. 1.  20 essential amino acids Linked together to make proteins Made of amine group, carboxylic acid, and R group (side chain)
  2. 2.  Sequence of amino acids Depends on the DNA sequence › mRNA is formed by pairing with DNA › mRNA is then read by the ribosome › tRNA with the mRNA to bring correct amino acid to the right place › as more tRNA comes in the amino acids produced are then connected with a peptide bond ACAAUGGAACAUAGAUACAUA
  3. 3.  ACAAUGGAACAUAGAUACAUA
  4. 4.  Uses “weak” hydrogen bonds to form Types: › Coils › Pleats/sheets
  5. 5.  “Folding” of proteins › Occur because different attractions (bonds) form between alpha helices and beta sheets
  6. 6.  2 or more amino acids put together Multiple tertiary proteins
  7. 7. Lipids
  8. 8.  Organic molecule insoluble in water 3 types: › Neutral fats (triglycerides) › Phospholipids (cell membrane) › Cholesterol
  9. 9.  Triglycerides › 3 fatty acid chains  Saturated/Unsaturated › Glycerol molecule Store energy Insulate body tissue Protects organs
  10. 10.  Modified triglycerides Nonpolar fatty acid chain = tail › Hydrophobic (“fears” water) Polar phosphate = head › Hydrophilic (“loves” water)
  11. 11.  4 connected Carbon rings Stabilizes cell membranes
  12. 12. Carbohydrates
  13. 13.  Organic compound made of Carbon, Hydrogen, & Oxygen in ratio of › 1C : 2H : 1O Used for energy storage 3 types: › Monosaccharides › Disaccharides › Polysaccharides
  14. 14.  Simple sugars Soluble in water Examples: Glucose &Galactose
  15. 15.  Two monosaccharide sugars linked together by dehydration synthesis Soluble in water Example: Sucrose
  16. 16.  More than 2 sugars linked together Formed by dehydration synthesis Usually not soluble in water Examples: Starch, cellulose, & Glycogen Starch: › Sugars the same way › Primary source of calories Cellulose: › Sugars are opposite every other one Glycogen: › Sugars are branched
  17. 17.  Monomers joined together to make polymers › Loss of water when they are joined › Electrons are rearranged › New bond is formed
  18. 18.  Adding water to a polymer to break it apart
  19. 19.  Synthesis reactions: combining atoms › Anabolic reactions › Require more energy than produced Decomposition reactions: breaking apart › Catabolic reactions › More energy released than needed

×