Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.

Алгоритм сборки генома для экзафлопсных систем


Published on

  • Be the first to comment

  • Be the first to like this

Алгоритм сборки генома для экзафлопсных систем

  1. 1. Разработка алгоритма сборки геномадля вычислительных системэкзафлопсного уровня производительности· Экзафлопсные суперкомпьютерыбудут существенно отличаться отсегодняшних· Вывод – необходимы новыеалгоритмы обработки геномныхданныхРазработанный алгоритм· Геном – последовательность изчетырех типов нуклеотидов: A, G, C и T· Геномы разных живых существ имеютразный размер – от нескольких тысячнуклеотидов до сотен миллиардовнуклеотидов· Геном человека – 3 миллиардануклеотидов· Чтения генома имеют длину примерно100 нуклеотидов· Производительность устройств длячтения генома увеличивается в 10 разкаждые 18 месяцев· Производительность компьютеров затот же срок увеличивается в 2 раза· Компьютеры экзафлопснойпроизводительности (1018операций всекунду) планируется построить к 2018годуParis Japonica – геномв 150 миллиардовнуклеотидовВсе чтения генома... ...ВычислительныйузелВычислительныйузелВычислительныйузел...Кластеризациячтений геномаСобранныйгеномГосударственный контракт №07.514.11.4010Лаборатория «Алгоритмысборки геномныхпоследовательностей»НИУ ИТМОhttp://genome.ifmo.rugenome@mail.ifmo.ruРезультаты· Разработан алгоритм сборки генома для вычислительнойсистемы экзафлопсного уровня производительности· Теоретическая оценка ускорения показывает, что припереходе от 30 вычислительных узлов к 1 млн. узловскорость обработки данных повышается в 1000 раз, а дляотдельных этапов алгоритма – в 16000 разСуперкомпьютерсегодняСуперкомпьютер2018 годаПиковаяпроизводительность2 петафлопса 1 экзафлопсОбъем памяти 0.3 петабайта 32-64 петабайтаПроизводительностьвычислительного узла125 гигафлопс 1-10 терафлопсЧисло ядер на одномузле12 1000 – 10000Число вычислительныхузлов18700 100000 – 1000000Объем хранилищаданных15 петабайт 500-1000 петабайтГеном Чтение геномаКомпьютернаяобработка данныхЧтенияСобранный геном…GGCATGCGTCAGAAACTATCATAGCTAGATCGTACGTAGCC…ЧтениеСборкаЧтение геномаНабор чтений геномаСборка геномаСобранный геном
