SlideShare a Scribd company logo
1 of 45
Download to read offline
Søren Brunak
Novo Nordisk Foundation Center for Protein Research
University of Copenhagen
soren.brunak@cpr.ku.dk
Rigshospitalet
soeren.brunak@regionh.dk
Center for Biological Sequence Analysis
Technical University of Denmark
brunak@cbs.dtu.dk
The Danish Genome
– its importance for precision medicine and
for the identification of actionable variation
Copenhagen Bioscience Lecture 10 Oct 2017 - Søren Brunak
Copenhagen Bioscience Lecture 10 Oct 2017 - Søren Brunak
Copenhagen Bioscience Lecture 10 Oct 2017 - Søren Brunak
Susumu Ohno: Junk DNA
Junk genes 
Copenhagen Bioscience Lecture 10 Oct 2017 - Søren Brunak
Hans Eiberg, UCPH
Copenhagen Family Bank:
6000 frozen DNA samples
1000 families
Several generations
Prolific in terms of offspring
Linkage analysis
150 healthy Danes:
Danish ancestry
Both parents and one child alive
At least four children
Live in CPH area
ABO, …, Height and Weight
Hans Eiberg, UCPH
Selection of trios that match
population averages
(10 families)
(40 families*)
Evaluate fitness to the
average distributions:
• Blood types
• Height
• Weight
(*Random selection on 82 families.)
The algorithm evaluated 108 random sets
The frequencies of 5 blood-type classification schemes
were assessed and compared to the average Danish
distribution.
[ABO, MNSs, P, Kidd (JK) and Kell (K)]
The group (50 families) with the best fit was inspected
visually in order to identify distribution biases.  No
major biases were observed
The average gender-specific height and weight values
were also assessed as an additional quality control
Final selection
Distribution of ABO groups
(best fit, 50 families)
A B AB 0
Observed
Expected
ABO blood group system
Antigen positivity (AB)
Frequency(%)
0102030405060
49
44
10 10
4 5
37
41
Distribution of Kell groups (best fit, 50 families)
Distribution of Kidd groups (best fit, 50 families)
Distribution of MNSs groups (best fit, 50 families)
Distribution of P groups
(best fit, 50 families)
Careful selection of families
• Danish family history at least two generations back
• Cohort should follow normal distribution of
phenotypic traits (height, eye color, blood type etc.)
• SNP profile should be in accordance with known
references
• Cohort should be healthy
Danish ancestry
Thomas Als, Kirstine Belling (Izarzugaza), Jette Bork-Jensen
Filled dots are 60
Danish Trios from
which 50 were
selected
Arbitrary definition of
“Danish”
SNPrelate - PCA
Norway/Greenland ancestry in the Copenhagen Family Bank
01
05
02
02
01
05
Ancestry Informative Markers (AIM snps)
(Adapted from Jette Bork-Jensen)
TCCAAACCCAGGCTCTCTCCCAAACCAGTTTGCGGCAGATGGCCAGTGGAACCTCACTCTCCTCATCAGTAAAAAGGGGGCAGAGTGAGGGTCCTGAGAGCTAGTACAGGGACTGTG
TGAAGTAGACAATGCCCAGTGTTTAGCGTAAGAATCAGGGTCCAGCTGGTGCTCCCTAAACAGCAGCTGCTGTTCACTGTTGAAAGGCGCTCTGGAAGGCCAGGCGCGGTGGCTCAT
GCTTGTAATCCCAGCACTGTGGGAGGCCGAGGTGGGCGGATCACCTGAGGTAGGGAGTTCGAGACCAGCCTGACCAACGTGGAGAAACCCCATCTCTCCTAAAAATACAAAATTAGC
CAGGCGTGGTAGCACATACCTGTAATCCCAGCGACTCGGGAGGCTGAGGCAAGAGAATTGCTTGAAACCAGCAGGGGAGGTTGTGGTGAGCCAAGATCGAGCCATTGCACTCCAGCC
AGGGCAACAAGAGGCAAAATGGCGAAACTCCATCTCCGAGAAAAAAAAAAAAAAAGAATACTTTCTGAAAGTATTTATTCATACAAATAAAGACTTGACCCATAAGGTAGGAACGCA
AATGGGCCACGGAATCACTCATTCCACAGTATACACCGAGTGCCCTTGAAGTGCTGGGCACTGCTCCAGGATTGGGGGCATATTGGTGAAAAGAGAAGCAAGCCTGCCTGCTCAGAT
GGCAGGGAATGGGGAAAAACAGGGAGACAGTTTCCTGTTTGAGATGTTGGGAGTCTGCTTCGAGTAGTATATTTACTGGAAATAGACCACTAACTTGGATGTCCCTTTTTGGAAATG
TGCCTGCGTCCAGGGCTGGGTTGGGGCCCCAATGAACTTTGGCTCTGACATAGCTGTTGCCACACTCAGTGGAACTGAATCCATGTTTGCCTTCACCCGGCATCCTTCACCCCAACT
CTCCCCGCCACAACATACATCCCATGCCAGCCTGGGGACCCTCAAAGGTGCTTCATCATTAGGTTTGTGGCTGGGTCCTACTGAAGTAAGTCTTGGCACTCAGAGGGATAGGAATTG
AATGAAGACATGAGATTCCTCTGCGGGAGGCCTCTCTAGGAAATCTGTGGACTCACACGTTTACTAATGTTGCTGCAGCCCCGCACCCACCTTGGCCTTGGGCAGCCATACTCTAGG
GCTTTTGTAACCTCTCCATGTGAGGAACTCAAATTAGACCTGGGTTTGGAGGCGGTGCTCCGAGCTGGCCTTTGGGGGAGGTTTTGTGCGAGGCATTTCCCAAGTGCTGGCAGGATT
GTGTCACAGACACAGAGTAAACTTTTGCTGGGCTCCAAGTGACCGCCCATAGTTTATTATAAAGGTGACTGCACCCTGCAGCCACCAGCACTGCCTGGCTCCACGTGCCTCCTGGTC
TCAGTATGGCGCTGTCCTGGGTTCTTACAGTCCTGAGCCTCCTACCTCTGCTGGAAGCCCAGATCCCATTGTGTGCCAACCTAGTACCGGTGCCCATCACCAACGCCACCCTGGACC
GGGTGAGTGCCTGGGCTAGCCCTGTCCTGAGCACATGGGCAGCTGCCTCCCTTCTCTGGGCTTCCCTTTACCTGCTGGCTGTGGTCGCACCCCCACTCCCAGCTCTGCCTTTTTCTC
TTCTGGGTCCCCAGGGTGAAATTCTCACCAGCCCAGGGGACTCTGGAGGCACCCCCTGCCTCCAAACACAGAAGCCTCACTGCAGAGTCCTTCACGGAGGACGGTTCTGTGCTGGGC
CTGGAGGGGCTGCCTGGGGGGCAATGACTGATCCTCAGGGTGAGCTCCTGCATGCGCACTGCCCACCAGGGGCCTCATCTCCCCATCTGCAAAATCAGGGAGAGATCTGCCTGAGTC
TCCTCCCAGCTGACAGTCAAAGATTCAGCATCAAGCCCCCATCACCAGCTCCCCCCTTCTCCCCAGATCACTGGCAAGTGGTTTTATATCGCATCGGCCTTTCGAAACGAGGAGTAC
AATAAGTCGGTTCAGGAGATCCAAGCAACCTTCTTTTACTTTACCCCCAACAAGACAGAGGACACGATCTTTCTCAGAGAGTACCAGACCCGGTGAGAGCCCCCATTCCAATGCACC
CCCGATCTCAGCTGTCTGGCCAGAAGACCTGAGCAAGTCCCTCCTTCTTCCTGGCCTTGGCCTTCCCATGGGTGGAACCGGGAGGGTTGGCTTTAATCTCCACCAGAACTCTTGCCC
CGGGACTGTGATGGGCGATTGGCCACTTCTCCTCGATAACATTACTGTTTTTCTTCCGCCTTCTGGTTGACTTTAGCCAGAACCAGTGCTTCTATAACTCCAGTTACCTGAATGTCC
AGCGGGAGAATGGGACCGTCTCCAGATACGGTGAGGGCCAGCCCTCAGGCAGGAGGGTTCACCGTGGGAACAGGGCAGGCCAGCATAAGGTGGGGGCTGGATGTAGAGCCCTGGAGG
CTTTGGGCACAGAGAAATAACCACTAACATTTTTGAGCTCTTACCACGTGCTCAGAAAAAATCCCTAAGAAGACACTGAGAGAATTAGATGAGGAAACATAAGAACAGAGACCTCAA
ATAGTTTCCCCAAGGTCACACAGCTTATAATTAGAACTAGAATTGGAACTCCAGGCTGGCTTCAGATCTGCCTCTCTCTCACGCCCTCTTTAAGATCCTTTGCAAACCAATGGTAGA
AGCCTGTATGTTGGAGAGGTGGTACCTTCAACTATGTCCCCCATCACCGCAGAGGTGGCACATGGCAGGGATCTGATGGAGCTGAACTGACATCATTTAGCATCCCGAGCCTCCTCT
CTGGGCCTCATTTTCCTCCTCTGTAAAACGGGGAGAAAGGCCCTGACAGCCACAGTCTGTGTGAGGCTCCTGAGATCTCATGTACAGAAAGTGCTTGGCGTGGAGCTGGGCACGCAG
CAGGGGCTGGGCACACGGTGGCCCAAAGGAGACCCGGGCCTTCACTGATGGGCTTTGTGGCCCCGGACACATTTCTCTTCCAGAGGGAGGCCGAGAACATGTTGCTCACCTGCGTTC
CTTAGGGACACCCCTAGGACTCCTCACCTGTAAGACAGGCACCATTGTGCCATCCCATGTTCTCACCCAGAGGCTCTTAAGACCTTGATGTTTGGTTCCTACCTGGACGATGAGAAG
AACTGGGGGCTGTCTTTCTATGGTAGGCATGCTTAGCAGCCCCAAACTCATGCCCCTCTCAGGCCTCACCCCCCATTCACCCACCCCTGGGCTGGCCCCTAGAACCCCAGCCCTCCC
TGGCCTCCGCCGGGCCCCACCATGTCCCCAGTCAGTCTCCTTGCTCCCCCTGCAGCTGACAAGCCAGAGACGACCAAGGAGCAACTGGGAGAGTTCTACGAAGCTCTCGACTGCTTG
TGCATTCCCAGGTCAGATGTCATGTACACCGACTGGAAAAAGGTAAACGCAAGGGATTGGACATTGCCCACCTTGTCCATGGCCCAACTTGGGCAGCCCCAGAGGCCCAGAGCAGGA
AAGCTGCCAGGCAAGGCTGCACAGCTAGGCAGATCTTCTGCTTTTAGGCACCTGCCTCACTGTAGGGACAGCTGAGCTCTACAGAGGCCCAGGGGTGGTGGATGAGAGCCCAGGAGG
GAGAAGTCCCTGTGAAACCAGGGAGGACCTGAAAGCTAACAGGAGGGAACAGCGTGAGCCACGGGGTTGGGGGATTGGCAATTGGAGGGGACGTAATGCGGGGAGTTACCACCTACA
GACGCGTCCCAAACCCCAGGCTTTCACCCCAACCTCCACTCCCCGCTCATTTTTAATACCCGTGCAGTGGGGAATTGATACTGTGGTTTTCAATGTCACCCACACTGCAGCACGGCC
ACAGTCACCATCCCGATTTTTGCTACAAATGAAAATTACTGTATAATGAGCTCCTTAACACTTTTCTTTAAACCTGTGTTTGGAAGACTTGTGTTGGTGTGGCCCTGTGCCCTAATA
CCTGTGAAATCACAGCACCGATGAGCTGGTTCCAATTTTTAAAATATATACATGCAGTACTTCCATGACTATTCAAAGAAAAACAATTCCTTCCATTTGCCACCTGAGATGACCACC
AGGGATGTGAACTACCTCCTGCCCCATCCCCAGCCCCAGGATCCTGGGACAGGGCTTATGAACGCAACCACTGTAGTCAGCTCACTTGATCCACAGCCTGGCACCTCCACTGTCTGG
CTAGGGAGCCTCGAATGGGTCCCAAGGCCACCCTGCTCCTCAGTTACATCATCTGCATAGTAGTGGTGGTTGTGAGGAATTCAGGAGCTGCAGCATAAGGGCCCTGCAGGTACTATG
TGCTCAGTAAATGCCAGTGGTTCTTAAGGGTCTGAGCTCCCATTGTAGAGGCAAGTAAGCTGAGGTTCAGAGAAGAAAATGACTTGCCCAAGATCACCCAGCTGGGAAGTGACAGTG
CCAGGGTTGGAGCCCTGGTTGAGCTGGTTCCACAGGCCAGAGCTCATTCTGCCCTCTCCCCGGAAGACCTCCCACCCTGTCCCCATGCCTCTGCTTCTCCCTCACCCCAATTCCCCG
CTGCCTTCTAGGATAAGTGTGAGCCACTGGAGAAGCAGCACGAGAAGGAGAGGAAACAGGAGGAGGGGGAATCCTAGCAGGACACAGCCTTGGATCAGGACAGAGACTTGGGGGCCA
TCCTGCCCCTCCAACCCGACATGTGTACCTCAGCTTTTTCCCTCACTTGCATCAATAAAGCTTCGCATCGGCCTTTCGAAACGAGGAGTACAATAAGTCGGTTCAGGAGCCCTCAGG
CAGGAGGGTTCACCGTGGGAACAGGGCAGGCCAGCATAAGGTGGGGGCTGGATGTAGAGCCCTGGAGGCTTTGGGCACAGAGGCCACCCTGGACCGGGTGAGTGCCTGGGCTAGCCC
TGTCCTGAGCACATGGGCAGCTGCCTCCCTTCTCTGGGCTTCCCTTTACCTGCTGGCTGTGGTCGCACCCCCACTCCCAGCCCCCAACTCTCCCCGCCACAACATACATCCCATGCC
CAGGAGGGTTCACCGTGGGAACAGGGCAGGCCAGCATAAGGTGGGGGCTGGATGTAGAGCCCTGGAGGCTTTGGGCACAGAGGCCACCCTGGACCGGGTGAGTGCCTGGGCTAGCCC
Copenhagen Bioscience Lecture 10 Oct 2017 - Søren Brunak
• Design enables de novo assembly
• Illumina 100bp paired end/mate pair reads
• Short range and long range libraries
• Deep (x80) full genome sequencing
• 150 healthy Danes in the form of 50 trios
(mother-father-child)
Competitive advantages of the experimental
design
We did not sequence 10-11X,
and more individuals,
decided to go for 70-100X and
fewer individuals
High quality assembly of each
individual
Computerome at DTU Risø
– dedicated to Danish Life Science data
Collaboration between DTU, UCPH and DeiC
Was #121 on top500.org (Nov 2014), supercomputer with secure private cloud
technology, investment: 40 M DKK
Human de novo assemblies using Allpaths-LG
Callenges for the computation
• ~900gb memory for a 50-60x homo sapiens genome
• 3-4 TB disk space per run
• Very I/O intensive, working with ~5-700 gb file sizes
‘Old’ Shared Memory Machine (8TB shared memory) bottlenecks
• Limited disk space
• Disks are spread over many systems
• Slow bandwidth
• System is shared and only 2-3 jobs can run at the same time.
• One job takes 3-4 weeks depending on load
Computerome – bottlenecks are gone…
• 3 PB disk space
• +75gb/s aggregated bandwidth
• SSD’s for fast caching of data
• 1.3 PB was generated during the assembly process
• One jobs takes ~11 days, 27 could be run in parallel
Bent Petersen
Computerome benchmarking
Happy/thoughtful scientist when
he got access for testing the €5.4
million machine in October 2014
Read statistics from the two
GenomeDenmark phase projects
50 trios
~3.3 billion reads
Total: 494 billion reads!
Importantly:
Mate-pair libraries!
Maretty et al., Nature 2017
Phase I Phase II
Assembly statistics
Allpaths-LG: 2.85Gb
Soapdenovo2: 3.02Gb
SGA: 3.2Gb
N50: median 21Mb!
~13,000 pieces
Phase I:
N50: 28kb
480,000 pieces
N50 and L50 are statistics of contig or
scaffold lengths. The N50 is similar to
the mean or median of lengths, but has
greater weight given to longer contigs.
L50 is the number of contigs whose
summed length is N50. There are also
related N90, NG50 or D50 statistics.
Assemblies compared
PB+BioNano
Pendleton et al., Nat Methods, 2015
PacBio + BioNano is
more contiguous
Larger gaps in
PB+BioNano
PB+BioNano total
assembly is smaller
Cost:
PB+BioNano: $300k
Our approach: $18k*
*With HiSeqX: $10k
Assemblies compared
Larger gaps in
PB+BioNano
PB+BioNano total
assembly is smaller
Cost:
PB+BioNano: $300k
Our approach: $18k*
*With HiSeqX: $10k
Trio-based Danish reference genome finished
Individual high quality genome shown on the official reference for the humane genome
Sequencing and de novo assembly of 150 genomes from Denmark as a population reference.
Maretty L, ..., Kristiansen K (*), Brunak S (*), Schierup MH (*). Nature August 2017
N50>21Mb (Max: 30Mb)
The top-100 largest scaffolds
0
10
20
0.00 0.25 0.50 0.75 1.00
Break rate
0
10
20
30
0.00 0.25 0.50 0.75 1.00
Fraction of genome covered
Genome Covered>80%
Few breaks
HuRef
haploid CHM1
Selected Results
• Reference genome from a homogeneous population
• Top 100 longest scaffolds cover most of the human
reference genome
• Most comprehensive variant calling ever (for non SNV
variation)
• 100 new complete HLA haplotypes (only 8 incomplete exist)
• Most of the Y chromosome assembled (first time for short
read approach)
• BEST HUMAN DE NOVO ASSEMBLIES EVER (BY FAR)
Uses of a reference genome
Basic Scientific Progress
• Improved understanding of the human genome
• Detailed knowledge concerning specific Danish genetic
variations
• Knowledge concerning evolution
Applications as reference
• Reference for clinical analysis of genomes
• Improves less complete genetic analyses
• Knowledge on new and rare variations relevant to disease
Basis for the future healthcare system
• Next step towards individual patient treatment
• Enables large-scale coupling of genomics and patient
data
Copenhagen Bioscience Lecture 10 Oct 2017 - Søren Brunak
Human knock-outs
without punch
Precision medicine should also reduce
overdiagnoses and underdiagnoses
A unified conceptual
model for diagnostic
errors:
underdiagnosis,
overdiagnosis, and
misdiagnosis,
Diagnosis, David E.
Newman-Toker, 2014|
COPD trajectory cluster
with five preceding diagnoses leading
to COPD and some of the possible outcomes
#sequenced
genomes/exoms
Growth in genome data and
other types of big data (by 2025)
Stephens ZD, Lee SY, Faghri F, Campbell RH, Zhai C, et al. (2015) Big Data: Astronomical or Genomical?. PLoS Biol 13(7):
e1002195. doi:10.1371/journal.pbio.1002195
http://journals.plos.org/plosbiology/article?id=info:doi/10.1371/journal.pbio.1002195
4 bases = 1 byte
Copenhagen Bioscience Lecture 10 Oct 2017 - Søren Brunak
Copenhagen Bioscience Lecture 10 Oct 2017 - Søren Brunak
Besenbacher, S., Liu, S., Izarzugaza, J. M. G., Grove, J., Belling, K., Bork-Jensen,
J., et al. (2015). Nature Communications, 6, 5969
Copenhagen Bioscience Lecture 10 Oct 2017 - Søren Brunak
Copenhagen Bioscience Lecture 10 Oct 2017 - Søren Brunak

More Related Content

Recently uploaded

Integrated Neuromuscular Inhibition Technique (INIT)
Integrated Neuromuscular Inhibition Technique (INIT)Integrated Neuromuscular Inhibition Technique (INIT)
Integrated Neuromuscular Inhibition Technique (INIT)Anjali Parmar
 
Get the best psychology treatment in Indore at Gokuldas Hospital
Get the best psychology treatment in Indore at Gokuldas HospitalGet the best psychology treatment in Indore at Gokuldas Hospital
Get the best psychology treatment in Indore at Gokuldas HospitalGokuldas Hospital
 
Video capsule endoscopy (VCE ) in children
Video capsule endoscopy (VCE ) in childrenVideo capsule endoscopy (VCE ) in children
Video capsule endoscopy (VCE ) in childrenRaju678948
 
Tips and tricks to pass the cardiovascular station for PACES exam
Tips and tricks to pass the cardiovascular station for PACES examTips and tricks to pass the cardiovascular station for PACES exam
Tips and tricks to pass the cardiovascular station for PACES examJunhao Koh
 
Unlocking Holistic Wellness: Addressing Depression, Mental Well-Being, and St...
Unlocking Holistic Wellness: Addressing Depression, Mental Well-Being, and St...Unlocking Holistic Wellness: Addressing Depression, Mental Well-Being, and St...
Unlocking Holistic Wellness: Addressing Depression, Mental Well-Being, and St...Health Kinesiology Natural Bioenergetics
 
Case presentation on Antibody screening- how to solve 3 cell and 11 cell panel?
Case presentation on Antibody screening- how to solve 3 cell and 11 cell panel?Case presentation on Antibody screening- how to solve 3 cell and 11 cell panel?
Case presentation on Antibody screening- how to solve 3 cell and 11 cell panel?DrShinyKajal
 
CAS 110-63-4 BDO Liquid 1,4-Butanediol 1 4 BDO Warehouse Supply For Excellent...
CAS 110-63-4 BDO Liquid 1,4-Butanediol 1 4 BDO Warehouse Supply For Excellent...CAS 110-63-4 BDO Liquid 1,4-Butanediol 1 4 BDO Warehouse Supply For Excellent...
CAS 110-63-4 BDO Liquid 1,4-Butanediol 1 4 BDO Warehouse Supply For Excellent...ocean4396
 
PYODERMA, IMPETIGO, FOLLICULITIS, FURUNCLES, CARBUNCLES.pdf
PYODERMA, IMPETIGO, FOLLICULITIS, FURUNCLES, CARBUNCLES.pdfPYODERMA, IMPETIGO, FOLLICULITIS, FURUNCLES, CARBUNCLES.pdf
PYODERMA, IMPETIGO, FOLLICULITIS, FURUNCLES, CARBUNCLES.pdfDolisha Warbi
 
NDCT Rules, 2019: An Overview | New Drugs and Clinical Trial Rules 2019
NDCT Rules, 2019: An Overview | New Drugs and Clinical Trial Rules 2019NDCT Rules, 2019: An Overview | New Drugs and Clinical Trial Rules 2019
NDCT Rules, 2019: An Overview | New Drugs and Clinical Trial Rules 2019Akash Agnihotri
 
The Orbit & its contents by Dr. Rabia I. Gandapore.pptx
The Orbit & its contents by Dr. Rabia I. Gandapore.pptxThe Orbit & its contents by Dr. Rabia I. Gandapore.pptx
The Orbit & its contents by Dr. Rabia I. Gandapore.pptxDr. Rabia Inam Gandapore
 
ANAPHYLAXIS BY DR.SOHAN BISWAS,MBBS,DNB(INTERNAL MEDICINE) RESIDENT.pptx
ANAPHYLAXIS BY DR.SOHAN BISWAS,MBBS,DNB(INTERNAL MEDICINE) RESIDENT.pptxANAPHYLAXIS BY DR.SOHAN BISWAS,MBBS,DNB(INTERNAL MEDICINE) RESIDENT.pptx
ANAPHYLAXIS BY DR.SOHAN BISWAS,MBBS,DNB(INTERNAL MEDICINE) RESIDENT.pptxDr. Sohan Biswas
 
Gallbladder Double-Diverticular: A Case Report المرارة مزدوجة التج: تقرير حالة
Gallbladder Double-Diverticular: A Case Report  المرارة مزدوجة التج: تقرير حالةGallbladder Double-Diverticular: A Case Report  المرارة مزدوجة التج: تقرير حالة
Gallbladder Double-Diverticular: A Case Report المرارة مزدوجة التج: تقرير حالةMohamad محمد Al-Gailani الكيلاني
 
Cytoskeleton and Cell Inclusions - Dr Muhammad Ali Rabbani - Medicose Academics
Cytoskeleton and Cell Inclusions - Dr Muhammad Ali Rabbani - Medicose AcademicsCytoskeleton and Cell Inclusions - Dr Muhammad Ali Rabbani - Medicose Academics
Cytoskeleton and Cell Inclusions - Dr Muhammad Ali Rabbani - Medicose AcademicsMedicoseAcademics
 
Treatment Choices for Slip Disc at Gokuldas Hospital
Treatment Choices for Slip Disc at Gokuldas HospitalTreatment Choices for Slip Disc at Gokuldas Hospital
Treatment Choices for Slip Disc at Gokuldas HospitalGokuldas Hospital
 
Overview on the Automatic pill identifier
Overview on the Automatic pill identifierOverview on the Automatic pill identifier
Overview on the Automatic pill identifierNidhi Joshi
 
ESC HF 2024 Spotlights Day-2.pptx heart failure
ESC HF 2024 Spotlights Day-2.pptx heart failureESC HF 2024 Spotlights Day-2.pptx heart failure
ESC HF 2024 Spotlights Day-2.pptx heart failuremahiavy26
 
Histology of Epithelium - Dr Muhammad Ali Rabbani - Medicose Academics
Histology of Epithelium - Dr Muhammad Ali Rabbani - Medicose AcademicsHistology of Epithelium - Dr Muhammad Ali Rabbani - Medicose Academics
Histology of Epithelium - Dr Muhammad Ali Rabbani - Medicose AcademicsMedicoseAcademics
 
Unveiling Alcohol Withdrawal Syndrome: exploring it's hidden depths
Unveiling Alcohol Withdrawal Syndrome: exploring it's hidden depthsUnveiling Alcohol Withdrawal Syndrome: exploring it's hidden depths
Unveiling Alcohol Withdrawal Syndrome: exploring it's hidden depthsYash Garg
 
Connective Tissue II - Dr Muhammad Ali Rabbani - Medicose Academics
Connective Tissue II - Dr Muhammad Ali Rabbani - Medicose AcademicsConnective Tissue II - Dr Muhammad Ali Rabbani - Medicose Academics
Connective Tissue II - Dr Muhammad Ali Rabbani - Medicose AcademicsMedicoseAcademics
 

Recently uploaded (20)

Best medicine 100% Effective&Safe Mifepristion ௵+918133066128௹Abortion pills ...
Best medicine 100% Effective&Safe Mifepristion ௵+918133066128௹Abortion pills ...Best medicine 100% Effective&Safe Mifepristion ௵+918133066128௹Abortion pills ...
Best medicine 100% Effective&Safe Mifepristion ௵+918133066128௹Abortion pills ...
 
Integrated Neuromuscular Inhibition Technique (INIT)
Integrated Neuromuscular Inhibition Technique (INIT)Integrated Neuromuscular Inhibition Technique (INIT)
Integrated Neuromuscular Inhibition Technique (INIT)
 
Get the best psychology treatment in Indore at Gokuldas Hospital
Get the best psychology treatment in Indore at Gokuldas HospitalGet the best psychology treatment in Indore at Gokuldas Hospital
Get the best psychology treatment in Indore at Gokuldas Hospital
 
Video capsule endoscopy (VCE ) in children
Video capsule endoscopy (VCE ) in childrenVideo capsule endoscopy (VCE ) in children
Video capsule endoscopy (VCE ) in children
 
Tips and tricks to pass the cardiovascular station for PACES exam
Tips and tricks to pass the cardiovascular station for PACES examTips and tricks to pass the cardiovascular station for PACES exam
Tips and tricks to pass the cardiovascular station for PACES exam
 
Unlocking Holistic Wellness: Addressing Depression, Mental Well-Being, and St...
Unlocking Holistic Wellness: Addressing Depression, Mental Well-Being, and St...Unlocking Holistic Wellness: Addressing Depression, Mental Well-Being, and St...
Unlocking Holistic Wellness: Addressing Depression, Mental Well-Being, and St...
 
Case presentation on Antibody screening- how to solve 3 cell and 11 cell panel?
Case presentation on Antibody screening- how to solve 3 cell and 11 cell panel?Case presentation on Antibody screening- how to solve 3 cell and 11 cell panel?
Case presentation on Antibody screening- how to solve 3 cell and 11 cell panel?
 
CAS 110-63-4 BDO Liquid 1,4-Butanediol 1 4 BDO Warehouse Supply For Excellent...
CAS 110-63-4 BDO Liquid 1,4-Butanediol 1 4 BDO Warehouse Supply For Excellent...CAS 110-63-4 BDO Liquid 1,4-Butanediol 1 4 BDO Warehouse Supply For Excellent...
CAS 110-63-4 BDO Liquid 1,4-Butanediol 1 4 BDO Warehouse Supply For Excellent...
 
PYODERMA, IMPETIGO, FOLLICULITIS, FURUNCLES, CARBUNCLES.pdf
PYODERMA, IMPETIGO, FOLLICULITIS, FURUNCLES, CARBUNCLES.pdfPYODERMA, IMPETIGO, FOLLICULITIS, FURUNCLES, CARBUNCLES.pdf
PYODERMA, IMPETIGO, FOLLICULITIS, FURUNCLES, CARBUNCLES.pdf
 
NDCT Rules, 2019: An Overview | New Drugs and Clinical Trial Rules 2019
NDCT Rules, 2019: An Overview | New Drugs and Clinical Trial Rules 2019NDCT Rules, 2019: An Overview | New Drugs and Clinical Trial Rules 2019
NDCT Rules, 2019: An Overview | New Drugs and Clinical Trial Rules 2019
 
The Orbit & its contents by Dr. Rabia I. Gandapore.pptx
The Orbit & its contents by Dr. Rabia I. Gandapore.pptxThe Orbit & its contents by Dr. Rabia I. Gandapore.pptx
The Orbit & its contents by Dr. Rabia I. Gandapore.pptx
 
ANAPHYLAXIS BY DR.SOHAN BISWAS,MBBS,DNB(INTERNAL MEDICINE) RESIDENT.pptx
ANAPHYLAXIS BY DR.SOHAN BISWAS,MBBS,DNB(INTERNAL MEDICINE) RESIDENT.pptxANAPHYLAXIS BY DR.SOHAN BISWAS,MBBS,DNB(INTERNAL MEDICINE) RESIDENT.pptx
ANAPHYLAXIS BY DR.SOHAN BISWAS,MBBS,DNB(INTERNAL MEDICINE) RESIDENT.pptx
 
Gallbladder Double-Diverticular: A Case Report المرارة مزدوجة التج: تقرير حالة
Gallbladder Double-Diverticular: A Case Report  المرارة مزدوجة التج: تقرير حالةGallbladder Double-Diverticular: A Case Report  المرارة مزدوجة التج: تقرير حالة
Gallbladder Double-Diverticular: A Case Report المرارة مزدوجة التج: تقرير حالة
 
Cytoskeleton and Cell Inclusions - Dr Muhammad Ali Rabbani - Medicose Academics
Cytoskeleton and Cell Inclusions - Dr Muhammad Ali Rabbani - Medicose AcademicsCytoskeleton and Cell Inclusions - Dr Muhammad Ali Rabbani - Medicose Academics
Cytoskeleton and Cell Inclusions - Dr Muhammad Ali Rabbani - Medicose Academics
 
Treatment Choices for Slip Disc at Gokuldas Hospital
Treatment Choices for Slip Disc at Gokuldas HospitalTreatment Choices for Slip Disc at Gokuldas Hospital
Treatment Choices for Slip Disc at Gokuldas Hospital
 
Overview on the Automatic pill identifier
Overview on the Automatic pill identifierOverview on the Automatic pill identifier
Overview on the Automatic pill identifier
 
ESC HF 2024 Spotlights Day-2.pptx heart failure
ESC HF 2024 Spotlights Day-2.pptx heart failureESC HF 2024 Spotlights Day-2.pptx heart failure
ESC HF 2024 Spotlights Day-2.pptx heart failure
 
Histology of Epithelium - Dr Muhammad Ali Rabbani - Medicose Academics
Histology of Epithelium - Dr Muhammad Ali Rabbani - Medicose AcademicsHistology of Epithelium - Dr Muhammad Ali Rabbani - Medicose Academics
Histology of Epithelium - Dr Muhammad Ali Rabbani - Medicose Academics
 
Unveiling Alcohol Withdrawal Syndrome: exploring it's hidden depths
Unveiling Alcohol Withdrawal Syndrome: exploring it's hidden depthsUnveiling Alcohol Withdrawal Syndrome: exploring it's hidden depths
Unveiling Alcohol Withdrawal Syndrome: exploring it's hidden depths
 
Connective Tissue II - Dr Muhammad Ali Rabbani - Medicose Academics
Connective Tissue II - Dr Muhammad Ali Rabbani - Medicose AcademicsConnective Tissue II - Dr Muhammad Ali Rabbani - Medicose Academics
Connective Tissue II - Dr Muhammad Ali Rabbani - Medicose Academics
 

Featured

How to Prepare For a Successful Job Search for 2024
How to Prepare For a Successful Job Search for 2024How to Prepare For a Successful Job Search for 2024
How to Prepare For a Successful Job Search for 2024Albert Qian
 
Social Media Marketing Trends 2024 // The Global Indie Insights
Social Media Marketing Trends 2024 // The Global Indie InsightsSocial Media Marketing Trends 2024 // The Global Indie Insights
Social Media Marketing Trends 2024 // The Global Indie InsightsKurio // The Social Media Age(ncy)
 
Trends In Paid Search: Navigating The Digital Landscape In 2024
Trends In Paid Search: Navigating The Digital Landscape In 2024Trends In Paid Search: Navigating The Digital Landscape In 2024
Trends In Paid Search: Navigating The Digital Landscape In 2024Search Engine Journal
 
5 Public speaking tips from TED - Visualized summary
5 Public speaking tips from TED - Visualized summary5 Public speaking tips from TED - Visualized summary
5 Public speaking tips from TED - Visualized summarySpeakerHub
 
ChatGPT and the Future of Work - Clark Boyd
ChatGPT and the Future of Work - Clark Boyd ChatGPT and the Future of Work - Clark Boyd
ChatGPT and the Future of Work - Clark Boyd Clark Boyd
 
Getting into the tech field. what next
Getting into the tech field. what next Getting into the tech field. what next
Getting into the tech field. what next Tessa Mero
 
Google's Just Not That Into You: Understanding Core Updates & Search Intent
Google's Just Not That Into You: Understanding Core Updates & Search IntentGoogle's Just Not That Into You: Understanding Core Updates & Search Intent
Google's Just Not That Into You: Understanding Core Updates & Search IntentLily Ray
 
Time Management & Productivity - Best Practices
Time Management & Productivity -  Best PracticesTime Management & Productivity -  Best Practices
Time Management & Productivity - Best PracticesVit Horky
 
The six step guide to practical project management
The six step guide to practical project managementThe six step guide to practical project management
The six step guide to practical project managementMindGenius
 
Beginners Guide to TikTok for Search - Rachel Pearson - We are Tilt __ Bright...
Beginners Guide to TikTok for Search - Rachel Pearson - We are Tilt __ Bright...Beginners Guide to TikTok for Search - Rachel Pearson - We are Tilt __ Bright...
Beginners Guide to TikTok for Search - Rachel Pearson - We are Tilt __ Bright...RachelPearson36
 
Unlocking the Power of ChatGPT and AI in Testing - A Real-World Look, present...
Unlocking the Power of ChatGPT and AI in Testing - A Real-World Look, present...Unlocking the Power of ChatGPT and AI in Testing - A Real-World Look, present...
Unlocking the Power of ChatGPT and AI in Testing - A Real-World Look, present...Applitools
 
12 Ways to Increase Your Influence at Work
12 Ways to Increase Your Influence at Work12 Ways to Increase Your Influence at Work
12 Ways to Increase Your Influence at WorkGetSmarter
 
Ride the Storm: Navigating Through Unstable Periods / Katerina Rudko (Belka G...
Ride the Storm: Navigating Through Unstable Periods / Katerina Rudko (Belka G...Ride the Storm: Navigating Through Unstable Periods / Katerina Rudko (Belka G...
Ride the Storm: Navigating Through Unstable Periods / Katerina Rudko (Belka G...DevGAMM Conference
 
Barbie - Brand Strategy Presentation
Barbie - Brand Strategy PresentationBarbie - Brand Strategy Presentation
Barbie - Brand Strategy PresentationErica Santiago
 
Good Stuff Happens in 1:1 Meetings: Why you need them and how to do them well
Good Stuff Happens in 1:1 Meetings: Why you need them and how to do them wellGood Stuff Happens in 1:1 Meetings: Why you need them and how to do them well
Good Stuff Happens in 1:1 Meetings: Why you need them and how to do them wellSaba Software
 
Introduction to C Programming Language
Introduction to C Programming LanguageIntroduction to C Programming Language
Introduction to C Programming LanguageSimplilearn
 

Featured (20)

How to Prepare For a Successful Job Search for 2024
How to Prepare For a Successful Job Search for 2024How to Prepare For a Successful Job Search for 2024
How to Prepare For a Successful Job Search for 2024
 
Social Media Marketing Trends 2024 // The Global Indie Insights
Social Media Marketing Trends 2024 // The Global Indie InsightsSocial Media Marketing Trends 2024 // The Global Indie Insights
Social Media Marketing Trends 2024 // The Global Indie Insights
 
Trends In Paid Search: Navigating The Digital Landscape In 2024
Trends In Paid Search: Navigating The Digital Landscape In 2024Trends In Paid Search: Navigating The Digital Landscape In 2024
Trends In Paid Search: Navigating The Digital Landscape In 2024
 
5 Public speaking tips from TED - Visualized summary
5 Public speaking tips from TED - Visualized summary5 Public speaking tips from TED - Visualized summary
5 Public speaking tips from TED - Visualized summary
 
ChatGPT and the Future of Work - Clark Boyd
ChatGPT and the Future of Work - Clark Boyd ChatGPT and the Future of Work - Clark Boyd
ChatGPT and the Future of Work - Clark Boyd
 
Getting into the tech field. what next
Getting into the tech field. what next Getting into the tech field. what next
Getting into the tech field. what next
 
Google's Just Not That Into You: Understanding Core Updates & Search Intent
Google's Just Not That Into You: Understanding Core Updates & Search IntentGoogle's Just Not That Into You: Understanding Core Updates & Search Intent
Google's Just Not That Into You: Understanding Core Updates & Search Intent
 
How to have difficult conversations
How to have difficult conversations How to have difficult conversations
How to have difficult conversations
 
Introduction to Data Science
Introduction to Data ScienceIntroduction to Data Science
Introduction to Data Science
 
Time Management & Productivity - Best Practices
Time Management & Productivity -  Best PracticesTime Management & Productivity -  Best Practices
Time Management & Productivity - Best Practices
 
The six step guide to practical project management
The six step guide to practical project managementThe six step guide to practical project management
The six step guide to practical project management
 
Beginners Guide to TikTok for Search - Rachel Pearson - We are Tilt __ Bright...
Beginners Guide to TikTok for Search - Rachel Pearson - We are Tilt __ Bright...Beginners Guide to TikTok for Search - Rachel Pearson - We are Tilt __ Bright...
Beginners Guide to TikTok for Search - Rachel Pearson - We are Tilt __ Bright...
 
Unlocking the Power of ChatGPT and AI in Testing - A Real-World Look, present...
Unlocking the Power of ChatGPT and AI in Testing - A Real-World Look, present...Unlocking the Power of ChatGPT and AI in Testing - A Real-World Look, present...
Unlocking the Power of ChatGPT and AI in Testing - A Real-World Look, present...
 
12 Ways to Increase Your Influence at Work
12 Ways to Increase Your Influence at Work12 Ways to Increase Your Influence at Work
12 Ways to Increase Your Influence at Work
 
ChatGPT webinar slides
ChatGPT webinar slidesChatGPT webinar slides
ChatGPT webinar slides
 
More than Just Lines on a Map: Best Practices for U.S Bike Routes
More than Just Lines on a Map: Best Practices for U.S Bike RoutesMore than Just Lines on a Map: Best Practices for U.S Bike Routes
More than Just Lines on a Map: Best Practices for U.S Bike Routes
 
Ride the Storm: Navigating Through Unstable Periods / Katerina Rudko (Belka G...
Ride the Storm: Navigating Through Unstable Periods / Katerina Rudko (Belka G...Ride the Storm: Navigating Through Unstable Periods / Katerina Rudko (Belka G...
Ride the Storm: Navigating Through Unstable Periods / Katerina Rudko (Belka G...
 
Barbie - Brand Strategy Presentation
Barbie - Brand Strategy PresentationBarbie - Brand Strategy Presentation
Barbie - Brand Strategy Presentation
 
Good Stuff Happens in 1:1 Meetings: Why you need them and how to do them well
Good Stuff Happens in 1:1 Meetings: Why you need them and how to do them wellGood Stuff Happens in 1:1 Meetings: Why you need them and how to do them well
Good Stuff Happens in 1:1 Meetings: Why you need them and how to do them well
 
Introduction to C Programming Language
Introduction to C Programming LanguageIntroduction to C Programming Language
Introduction to C Programming Language
 

Copenhagen Bioscience Lecture 10 Oct 2017 - Søren Brunak